Starting /dee2/code/volunteer_pipeline.sh SRR11678135 current disk space = 3051550425088 free memory = 1579061260 SRR11678135 SRAfilesize 939687a64a923c2d1865daf0a02e5783 SRR11678135.sra SRR11678135.sra file validated SRR11678135 is paired end SRR11678135 is conventional basespace SRR11678135 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.74375 37.0 36.0 37.0 32.0 38.0 2 35.3725 37.0 36.0 37.0 31.0 38.0 3 35.9125 37.0 36.0 37.0 33.0 38.0 4 35.72975 37.0 36.0 37.0 32.0 38.0 5 35.8 37.0 36.0 37.0 32.0 38.0 6 35.66025 37.0 36.0 37.0 32.0 38.0 7 35.8965 37.0 36.0 37.0 33.0 38.0 8 35.88975 37.0 36.0 37.0 33.0 38.0 9 35.78475 37.0 36.0 37.0 32.0 38.0 10-14 35.73385 37.0 36.0 37.0 32.0 38.0 15-19 35.75835 37.0 36.0 37.0 32.0 38.0 20-24 35.70735 37.0 36.0 37.0 32.2 38.0 25-29 35.713 37.0 36.0 37.0 32.0 38.0 30-34 35.69475 37.0 36.0 37.0 31.8 38.0 35-39 35.615300000000005 37.0 36.0 37.0 32.0 38.0 40-44 35.6749 37.0 36.0 37.0 32.2 38.0 45-49 35.64020000000001 37.0 36.0 37.0 32.0 38.0 50-54 35.5329 37.0 36.0 37.0 31.8 38.0 55-59 35.54755 37.0 36.0 37.0 31.6 38.0 60-64 35.5146 37.0 36.0 37.0 31.4 38.0 65-69 35.47205 37.0 36.0 37.0 31.2 38.0 70-74 35.423199999999994 37.0 36.0 37.0 31.0 38.0 75-79 35.413149999999995 37.0 36.0 37.0 31.0 38.0 80-84 35.36104999999999 37.0 36.0 37.0 31.0 38.0 85-89 35.3278 37.0 36.0 37.0 30.8 38.0 90-94 35.20075 37.0 35.6 37.0 30.4 38.0 95-99 35.1089 37.0 35.6 37.0 30.0 38.0 100-104 35.12545 37.0 35.0 37.0 30.0 38.0 105-109 35.07555 37.0 35.2 37.0 30.0 38.0 110-114 34.926249999999996 37.0 35.0 37.0 29.4 38.0 115-119 34.8714 37.0 35.0 37.0 29.0 38.0 120-124 34.81865 37.0 35.0 37.0 29.0 38.0 125-129 34.8209 37.0 35.0 37.0 29.0 38.0 130-134 34.621399999999994 37.0 35.0 37.0 28.4 38.0 135-139 34.50335 37.0 34.6 37.0 28.2 38.0 140-144 34.434999999999995 37.0 34.2 37.0 27.8 38.0 145-149 34.383849999999995 37.0 34.0 37.0 27.6 38.0 150 34.146 37.0 34.0 37.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 7.0 26 18.0 27 16.0 28 37.0 29 47.0 30 73.0 31 112.0 32 155.0 33 277.0 34 442.0 35 763.0 36 1928.0 37 122.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.3 18.85 11.700000000000001 38.15 2 16.1 24.5 48.25 11.15 3 13.5 27.725 36.0 22.775000000000002 4 19.575 35.55 28.1 16.775000000000002 5 19.525000000000002 35.6 28.875 16.0 6 14.549999999999999 34.0 32.75 18.7 7 13.900000000000002 14.649999999999999 48.425000000000004 23.025000000000002 8 18.625 21.349999999999998 30.725 29.299999999999997 9 20.225 22.325 29.599999999999998 27.85 10-14 20.74 28.99 27.98 22.29 15-19 21.38 27.800000000000004 28.794999999999998 22.025 20-24 21.315 28.335 28.515 21.834999999999997 25-29 21.165 28.275 29.080000000000002 21.48 30-34 21.595 28.475 28.110000000000003 21.82 35-39 21.36 27.985 28.74 21.915000000000003 40-44 21.29 28.505000000000003 28.299999999999997 21.905 45-49 21.63 28.38 28.155 21.834999999999997 50-54 21.325 28.285 28.21 22.18 55-59 21.955 28.415000000000003 28.105000000000004 21.525 60-64 21.395 28.720000000000002 28.04 21.845 65-69 22.1 28.565 27.785 21.55 70-74 21.834999999999997 28.634999999999998 27.68 21.85 75-79 21.055 28.9 28.255000000000003 21.790000000000003 80-84 21.445 28.77 28.115000000000002 21.67 85-89 21.23 28.73 27.71 22.33 90-94 21.695 28.134999999999998 27.889999999999997 22.28 95-99 21.755 28.77 27.815 21.66 100-104 21.51 28.365000000000002 28.22 21.905 105-109 21.815 27.815 28.275 22.095000000000002 110-114 21.915000000000003 28.77 27.785 21.529999999999998 115-119 21.94 28.37 27.725 21.965 120-124 21.5 27.735 28.67 22.095000000000002 125-129 21.790000000000003 28.16 28.749999999999996 21.3 130-134 22.075 27.915 28.139999999999997 21.87 135-139 22.005 28.08 28.16 21.755 140-144 22.54 28.185 27.515 21.759999999999998 145-149 22.27 28.04 27.900000000000002 21.790000000000003 150 21.675 28.199999999999996 28.549999999999997 21.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.5 18 2.5 19 1.0 20 0.5 21 1.0 22 2.0 23 5.5 24 8.5 25 10.5 26 12.0 27 13.0 28 14.5 29 17.0 30 28.0 31 41.5 32 46.0 33 54.0 34 57.0 35 66.5 36 93.0 37 120.0 38 152.0 39 187.0 40 209.5 41 215.5 42 231.0 43 272.0 44 287.0 45 267.0 46 262.0 47 265.0 48 230.5 49 189.5 50 157.0 51 113.0 52 83.5 53 67.0 54 53.0 55 46.0 56 32.5 57 18.0 58 13.5 59 7.5 60 7.0 61 8.5 62 7.0 63 4.0 64 3.0 65 4.0 66 4.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91304347826086 97.82499999999999 2 1.0616784630940344 2.1 3 0.02527805864509606 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGAT 10 0.006973645 144.0 1 >>END_MODULE SRR11678135 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.943 37.0 35.0 37.0 29.0 38.0 2 34.00625 37.0 34.0 37.0 26.0 37.0 3 35.09275 37.0 35.0 37.0 30.0 37.0 4 35.13925 37.0 36.0 37.0 30.0 38.0 5 35.02175 37.0 35.0 37.0 30.0 38.0 6 34.845 37.0 35.0 37.0 29.0 37.0 7 34.96275 37.0 35.0 37.0 30.0 37.0 8 35.20475 37.0 35.0 37.0 30.0 37.0 9 35.086 37.0 35.0 37.0 30.0 38.0 10-14 34.956900000000005 37.0 35.0 37.0 29.4 37.6 15-19 34.9864 37.0 35.0 37.0 29.6 37.6 20-24 34.90455 37.0 35.0 37.0 29.4 37.6 25-29 34.90685 37.0 35.0 37.0 29.4 37.8 30-34 34.8669 37.0 35.0 37.0 29.2 37.8 35-39 34.875299999999996 37.0 35.0 37.0 29.0 38.0 40-44 34.8238 37.0 35.0 37.0 29.0 38.0 45-49 34.86045 37.0 35.0 37.0 29.2 37.8 50-54 34.7546 37.0 35.0 37.0 28.8 38.0 55-59 34.787099999999995 37.0 35.0 37.0 28.8 38.0 60-64 34.7329 37.0 35.0 37.0 29.0 38.0 65-69 34.7162 37.0 35.0 37.0 28.8 38.0 70-74 34.656600000000005 37.0 35.0 37.0 28.6 38.0 75-79 34.627500000000005 37.0 35.0 37.0 28.4 38.0 80-84 34.59015 37.0 34.8 37.0 28.4 38.0 85-89 34.59465 37.0 35.0 37.0 28.2 38.0 90-94 34.4851 37.0 34.4 37.0 28.0 38.0 95-99 34.44405 37.0 34.2 37.0 27.8 38.0 100-104 34.427350000000004 37.0 34.2 37.0 27.8 38.0 105-109 34.2932 37.0 34.0 37.0 27.2 38.0 110-114 34.070100000000004 37.0 34.0 37.0 26.0 38.0 115-119 34.04175 37.0 34.0 37.0 26.2 38.0 120-124 34.03855 37.0 33.6 37.0 26.4 38.0 125-129 33.9048 37.0 33.2 37.0 26.2 38.0 130-134 33.82585 37.0 33.4 37.0 26.0 37.8 135-139 33.7101 37.0 33.0 37.0 25.4 38.0 140-144 33.5869 36.8 33.0 37.0 24.4 38.0 145-149 33.4904 36.8 32.6 37.0 24.6 38.0 150 33.28975 36.0 32.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 4.0 24 20.0 25 28.0 26 55.0 27 75.0 28 93.0 29 105.0 30 118.0 31 167.0 32 212.0 33 302.0 34 431.0 35 729.0 36 1533.0 37 125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.2 19.525000000000002 11.075 39.2 2 17.925 23.674999999999997 46.425 11.975 3 14.124999999999998 26.950000000000003 33.5 25.424999999999997 4 17.625 37.075 26.775 18.525 5 19.1 36.325 27.150000000000002 17.424999999999997 6 13.65 36.65 31.4 18.3 7 14.2 16.55 47.725 21.525 8 19.650000000000002 20.25 29.875 30.225 9 20.275000000000002 22.35 29.15 28.225 10-14 20.8 29.275000000000002 27.150000000000002 22.775000000000002 15-19 21.23 28.155 28.29 22.325 20-24 21.044999999999998 28.49 28.389999999999997 22.075 25-29 20.9 28.64 28.525 21.935 30-34 21.32 28.560000000000002 28.32 21.8 35-39 21.22 28.77 27.855 22.155 40-44 21.05 28.854999999999997 28.27 21.825 45-49 21.535 27.98 27.965 22.52 50-54 21.37 28.48 27.935 22.215 55-59 21.6 28.285 28.144999999999996 21.97 60-64 21.445 28.999999999999996 27.54 22.015 65-69 21.035 28.1 28.65 22.215 70-74 21.75 27.560000000000002 28.610000000000003 22.08 75-79 21.560000000000002 28.249999999999996 28.244999999999997 21.945 80-84 21.48 28.165000000000003 28.375 21.98 85-89 21.57 28.42 28.205000000000002 21.805 90-94 21.884999999999998 28.305000000000003 27.794999999999998 22.015 95-99 21.61 28.225 28.12 22.045 100-104 21.555 28.735 27.765 21.945 105-109 21.615000000000002 28.055000000000003 28.255000000000003 22.075 110-114 21.695 28.335 28.315 21.654999999999998 115-119 21.87 28.105000000000004 27.689999999999998 22.335 120-124 21.545 28.005000000000003 28.025 22.425 125-129 22.040000000000003 27.584999999999997 28.315 22.06 130-134 21.645 28.42 27.894999999999996 22.040000000000003 135-139 22.07 27.99 27.87 22.07 140-144 22.32 28.12 28.005000000000003 21.555 145-149 22.17 27.615000000000002 28.03 22.185 150 20.325 29.025000000000002 28.725 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 1.5 20 1.0 21 3.0 22 4.5 23 6.0 24 6.5 25 8.0 26 9.0 27 13.0 28 19.0 29 22.5 30 25.5 31 33.5 32 43.0 33 52.5 34 63.5 35 76.0 36 91.5 37 112.5 38 134.5 39 167.0 40 206.5 41 228.0 42 239.5 43 270.5 44 286.5 45 268.5 46 260.5 47 243.0 48 210.0 49 180.5 50 151.0 51 132.0 52 107.0 53 81.0 54 59.5 55 41.5 56 38.5 57 31.0 58 22.0 59 12.0 60 7.0 61 8.0 62 5.5 63 2.5 64 3.0 65 3.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83662114314619 97.7 2 1.163378856853819 2.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTCT 10 0.006973645 144.0 9 GTTTTCC 15 1.1730364E-4 144.0 1 >>END_MODULE Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086499 spots for SRR11678135.sra Written 1086499 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra Read 1086482 spots for SRR11678135.sra Written 1086482 spots for SRR11678135.sra SRR ids: ['SRR11678135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__beuqj5p SRR11678135.sra spots: 21729657 blocks: [[1, 1086482], [1086483, 2172964], [2172965, 3259446], [3259447, 4345928], [4345929, 5432410], [5432411, 6518892], [6518893, 7605374], [7605375, 8691856], [8691857, 9778338], [9778339, 10864820], [10864821, 11951302], [11951303, 13037784], [13037785, 14124266], [14124267, 15210748], [15210749, 16297230], [16297231, 17383712], [17383713, 18470194], [18470195, 19556676], [19556677, 20643158], [20643159, 21729657]] SRR11678135 file size 7734584 SRR11678135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678135 SRR11678135_1.fastq SRR11678135_2.fastq Input file: SRR11678135_1.fastq Paired file: SRR11678135_2.fastq trimmed: SRR11678135-trimmed-pair1.fastq, SRR11678135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:00:27 2025 >> started Wed Feb 12 18:00:53 2025 >> done (26.000s) 21729657 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21729657 (100.00%) read pairs available; of these: 546048 ( 2.51%) trimmed read pairs available after processing 21183609 (97.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 142 4 0.00% 143 6 0.00% 144 4 0.00% 145 3 0.00% 146 11 0.00% 147 85 0.00% 148 3322 0.02% 149 542613 2.50% 150 21183609 97.49% 21729657 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=43.19 fanout-score-rank=5 prefix-density=0.34 prefix-fanout=20.8 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=164.83 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=14.8 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=32.64 fanout-score-rank=9 prefix-density=0.30 prefix-fanout=18.3 sequence=AAGTCGGATCGTAGCCAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=116.74 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=21.5 sequence=CAGCAGCAGCAA SRR11678135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:01:34 Started mapping on | Feb 12 18:01:34 Finished on | Feb 12 18:03:20 Mapping speed, Million of reads per hour | 737.99 Number of input reads | 21729657 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20921537 Uniquely mapped reads % | 96.28% Average mapped length | 298.41 Number of splices: Total | 19215707 Number of splices: Annotated (sjdb) | 18825979 Number of splices: GT/AG | 18914221 Number of splices: GC/AG | 232918 Number of splices: AT/AC | 18480 Number of splices: Non-canonical | 50088 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 400699 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 1924 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 407421 407421 407421 N_multimapping 400699 400699 400699 N_noFeature 781515 10606493 10920704 N_ambiguous 281330 54331 51795 UnstrandedReadsAssigned:19858692 PositiveStrandReadsAssigned:10260713 NegativeStrandReadsAssigned:9949038 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678135-trimmed-pair1.fastq SRR11678135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,729,657 reads, 20,290,598 reads pseudoaligned [quant] estimated average fragment length: 266.536 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR11678135.ke.tsv 34699 SRR11678135.se.tsv 87100 total ==> SRR11678135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.46 771 22.4211 Potri.005G024800.1.v4.1 1035 769.464 160 10.597 Potri.004G059700.1.v4.1 961 695.472 40 2.93111 Potri.007G009000.2.v4.1 1416 1150.46 0 0 Potri.003G141000.2.v4.1 2943 2677.46 374.175 7.12201 Potri.016G087400.1.v4.1 270 58.342 1049 916.316 Potri.015G069301.1.v4.1 564 300.185 0 0 Potri.010G195200.1.v4.1 1773 1507.46 90 3.04261 Potri.012G127500.1.v4.1 977 711.472 3124 223.771 ==> SRR11678135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3559 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 604 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 34 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR11678135 completed mapping pipeline successfully