Starting /dee2/code/volunteer_pipeline.sh SRR11678136 current disk space = 3051615064064 free memory = 1581696368 SRR11678136 SRAfilesize 876c3442b507e3adf66672fba016a4a3 SRR11678136.sra SRR11678136.sra file validated SRR11678136 is paired end SRR11678136 is conventional basespace SRR11678136 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8545 37.0 36.0 37.0 33.0 38.0 2 35.32375 37.0 36.0 37.0 31.0 38.0 3 35.87475 37.0 36.0 37.0 33.0 38.0 4 35.902 37.0 36.0 37.0 33.0 38.0 5 35.8455 37.0 36.0 37.0 33.0 38.0 6 35.73275 37.0 36.0 37.0 32.0 38.0 7 35.90175 37.0 36.0 37.0 33.0 38.0 8 35.798 37.0 36.0 37.0 33.0 38.0 9 35.7895 37.0 36.0 37.0 32.0 38.0 10-14 35.78874999999999 37.0 36.0 37.0 32.2 38.0 15-19 35.7435 37.0 36.0 37.0 32.2 38.0 20-24 35.707449999999994 37.0 36.0 37.0 32.0 38.0 25-29 35.7119 37.0 36.0 37.0 32.0 38.0 30-34 35.7009 37.0 36.0 37.0 32.0 38.0 35-39 35.7039 37.0 36.0 37.0 32.2 38.0 40-44 35.70845 37.0 36.0 37.0 32.0 38.0 45-49 35.67255 37.0 36.0 37.0 32.0 38.0 50-54 35.65255 37.0 36.0 37.0 32.0 38.0 55-59 35.6282 37.0 36.0 37.0 32.0 38.0 60-64 35.5782 37.0 36.0 37.0 32.0 38.0 65-69 35.58225 37.0 36.0 37.0 31.8 38.0 70-74 35.5048 37.0 36.0 37.0 31.2 38.0 75-79 35.52315 37.0 36.0 37.0 31.6 38.0 80-84 35.49275 37.0 36.0 37.0 31.4 38.0 85-89 35.4068 37.0 36.0 37.0 31.2 38.0 90-94 35.386900000000004 37.0 36.0 37.0 31.0 38.0 95-99 35.293150000000004 37.0 36.0 37.0 30.8 38.0 100-104 35.2906 37.0 36.0 37.0 30.6 38.0 105-109 35.203700000000005 37.0 35.8 37.0 30.4 38.0 110-114 35.1127 37.0 35.0 37.0 30.0 38.0 115-119 35.1354 37.0 35.4 37.0 30.0 38.0 120-124 35.04455 37.0 35.0 37.0 29.8 38.0 125-129 34.99855 37.0 35.0 37.0 29.6 38.0 130-134 34.88099999999999 37.0 35.0 37.0 29.2 38.0 135-139 34.814 37.0 35.0 37.0 29.2 38.0 140-144 34.7171 37.0 35.0 37.0 28.6 38.0 145-149 34.67375 37.0 34.8 37.0 28.4 38.0 150 34.58025 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 10.0 26 12.0 27 20.0 28 26.0 29 39.0 30 70.0 31 109.0 32 143.0 33 218.0 34 377.0 35 795.0 36 2039.0 37 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.825000000000003 18.725 11.575000000000001 38.875 2 16.725 23.674999999999997 47.825 11.774999999999999 3 13.775 26.375 35.0 24.85 4 18.3 35.9 28.625 17.175 5 19.575 34.35 28.575 17.5 6 15.225 33.625 32.15 19.0 7 14.35 14.95 47.625 23.075000000000003 8 18.6 21.85 29.849999999999998 29.7 9 20.625 21.275 30.65 27.450000000000003 10-14 20.255000000000003 28.735 27.98 23.03 15-19 20.41 27.694999999999997 29.455 22.439999999999998 20-24 20.75 28.144999999999996 28.92 22.185 25-29 20.905 28.27 29.13 21.695 30-34 20.830000000000002 28.799999999999997 28.415000000000003 21.955 35-39 21.060000000000002 28.89 28.24 21.81 40-44 20.775 28.249999999999996 28.294999999999998 22.68 45-49 21.215 28.475 28.215 22.095000000000002 50-54 21.349999999999998 28.625 28.29 21.735 55-59 21.235 28.835 27.98 21.95 60-64 21.915000000000003 28.215 28.044999999999998 21.825 65-69 20.979999999999997 28.43 28.53 22.06 70-74 21.435000000000002 28.285 28.62 21.66 75-79 21.615000000000002 28.715000000000003 28.16 21.51 80-84 21.61 28.389999999999997 27.955000000000002 22.045 85-89 21.39 28.74 28.23 21.64 90-94 21.72 28.384999999999998 27.88 22.015 95-99 21.725 28.355000000000004 28.08 21.84 100-104 21.555 27.950000000000003 28.655 21.84 105-109 21.755 27.900000000000002 28.27 22.075 110-114 22.009999999999998 27.950000000000003 27.87 22.17 115-119 21.69 27.755000000000003 28.74 21.815 120-124 21.560000000000002 27.66 28.68 22.1 125-129 21.87 27.944999999999997 28.01 22.175 130-134 21.815 28.325 27.744999999999997 22.115000000000002 135-139 21.575 28.255000000000003 28.050000000000004 22.12 140-144 21.775 28.475 27.894999999999996 21.855 145-149 21.795 27.845 27.805000000000003 22.555 150 21.099999999999998 28.849999999999998 28.225 21.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.5 20 2.0 21 1.5 22 2.0 23 4.0 24 5.5 25 5.5 26 11.0 27 14.0 28 20.0 29 28.0 30 30.5 31 43.5 32 54.5 33 54.0 34 68.0 35 89.5 36 113.5 37 117.0 38 128.5 39 164.5 40 195.0 41 220.0 42 252.0 43 268.5 44 263.0 45 261.5 46 251.0 47 235.0 48 218.0 49 199.0 50 156.5 51 119.0 52 99.0 53 75.5 54 56.5 55 45.5 56 33.5 57 22.5 58 14.0 59 9.0 60 9.5 61 9.5 62 8.0 63 4.5 64 2.5 65 2.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGAGG 10 0.006973645 144.0 6 TTTTTTT 55 2.945433E-4 52.363636 1 >>END_MODULE SRR11678136 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2925 37.0 36.0 37.0 31.0 37.0 2 33.8365 37.0 34.0 37.0 26.0 37.0 3 34.9685 37.0 35.0 37.0 30.0 37.0 4 34.91875 37.0 35.0 37.0 29.0 37.0 5 34.9725 37.0 35.0 37.0 30.0 37.0 6 34.9675 37.0 35.0 37.0 30.0 37.0 7 34.733 37.0 35.0 37.0 29.0 37.0 8 35.1055 37.0 35.0 37.0 30.0 37.0 9 35.01875 37.0 35.0 37.0 30.0 37.0 10-14 34.890750000000004 37.0 35.0 37.0 29.4 37.4 15-19 34.8907 37.0 35.0 37.0 29.4 37.0 20-24 34.880050000000004 37.0 35.0 37.0 29.2 37.8 25-29 34.794200000000004 37.0 35.0 37.0 29.2 37.4 30-34 34.8456 37.0 35.0 37.0 29.0 37.6 35-39 34.851549999999996 37.0 35.0 37.0 29.4 37.8 40-44 34.79235 37.0 35.0 37.0 29.0 37.8 45-49 34.75725 37.0 35.0 37.0 28.6 37.8 50-54 34.706599999999995 37.0 35.0 37.0 28.8 37.8 55-59 34.69965 37.0 35.0 37.0 29.0 37.8 60-64 34.742599999999996 37.0 35.0 37.0 29.0 37.6 65-69 34.62140000000001 37.0 35.0 37.0 28.2 38.0 70-74 34.628949999999996 37.0 35.0 37.0 28.6 37.8 75-79 34.55775 37.0 34.8 37.0 28.2 38.0 80-84 34.49504999999999 37.0 34.4 37.0 28.0 37.6 85-89 34.496449999999996 37.0 34.6 37.0 28.0 37.8 90-94 34.42875 37.0 34.2 37.0 27.8 37.8 95-99 34.4188 37.0 34.2 37.0 27.6 38.0 100-104 34.342099999999995 37.0 34.2 37.0 27.6 37.6 105-109 34.198750000000004 37.0 33.8 37.0 27.2 37.8 110-114 34.117200000000004 37.0 34.0 37.0 26.6 38.0 115-119 34.1763 37.0 34.0 37.0 26.8 37.8 120-124 34.0349 37.0 34.0 37.0 26.4 37.4 125-129 33.976350000000004 37.0 33.4 37.0 26.4 37.8 130-134 33.83495 37.0 33.4 37.0 25.8 37.6 135-139 33.79545 36.8 33.2 37.0 25.6 37.4 140-144 33.7414 37.0 33.0 37.0 25.2 38.0 145-149 33.515550000000005 36.4 32.8 37.0 25.0 37.2 150 33.5625 37.0 33.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 7.0 24 24.0 25 39.0 26 58.0 27 66.0 28 81.0 29 94.0 30 129.0 31 176.0 32 219.0 33 283.0 34 411.0 35 848.0 36 1435.0 37 129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.075000000000003 19.950000000000003 12.825000000000001 37.15 2 18.65 23.925 46.625 10.8 3 13.875000000000002 26.950000000000003 34.300000000000004 24.875 4 17.925 35.625 29.65 16.8 5 19.925 34.925 28.225 16.925 6 15.85 35.025 30.425 18.7 7 14.774999999999999 15.950000000000001 47.225 22.05 8 18.975 21.125 30.325000000000003 29.575000000000003 9 18.325 21.9 33.550000000000004 26.224999999999998 10-14 20.64 29.59 27.0 22.770000000000003 15-19 20.965 28.33 28.060000000000002 22.645 20-24 21.265 28.189999999999998 28.660000000000004 21.884999999999998 25-29 21.075 28.355000000000004 28.775000000000002 21.795 30-34 20.544999999999998 28.645 27.955000000000002 22.855 35-39 21.435000000000002 28.794999999999998 27.805000000000003 21.965 40-44 21.0 28.825 27.41 22.765 45-49 21.349999999999998 28.799999999999997 27.939999999999998 21.91 50-54 21.18 28.084999999999997 28.48 22.255 55-59 21.395 28.62 28.065 21.92 60-64 21.925 28.645 27.500000000000004 21.93 65-69 22.09 28.68 27.894999999999996 21.335 70-74 21.115000000000002 28.62 28.38 21.884999999999998 75-79 22.335 28.235 27.634999999999998 21.795 80-84 22.220000000000002 28.310000000000002 28.175 21.295 85-89 22.16 27.805000000000003 28.084999999999997 21.95 90-94 21.345 28.615000000000002 27.6 22.439999999999998 95-99 22.21 27.889999999999997 28.17 21.73 100-104 22.185 27.465 28.485 21.865000000000002 105-109 21.845 27.884999999999998 28.165000000000003 22.105 110-114 21.4 28.405 28.595 21.6 115-119 21.584999999999997 28.144999999999996 28.24 22.03 120-124 22.02 27.485 28.395 22.1 125-129 21.935 27.775 28.285 22.005 130-134 21.67 28.175 28.38 21.775 135-139 21.91 27.68 28.389999999999997 22.02 140-144 22.125 28.405 27.27 22.2 145-149 22.3 28.345 27.765 21.59 150 20.95 27.525 28.349999999999998 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 1.0 19 1.0 20 0.0 21 2.0 22 4.0 23 4.0 24 5.0 25 6.5 26 6.5 27 10.0 28 15.5 29 22.0 30 35.0 31 43.0 32 44.5 33 52.5 34 66.5 35 77.0 36 94.0 37 119.0 38 143.0 39 180.0 40 212.0 41 224.0 42 246.5 43 258.5 44 254.0 45 261.5 46 266.5 47 238.5 48 206.5 49 187.0 50 164.5 51 128.0 52 92.5 53 80.0 54 66.5 55 44.5 56 33.0 57 22.0 58 12.0 59 14.5 60 11.0 61 8.5 62 5.5 63 3.0 64 5.5 65 5.0 66 4.0 67 3.5 68 3.0 69 2.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTCT 10 0.006973645 144.0 7 >>END_MODULE Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra Read 1087363 spots for SRR11678136.sra Written 1087363 spots for SRR11678136.sra Read 1087346 spots for SRR11678136.sra Written 1087346 spots for SRR11678136.sra SRR ids: ['SRR11678136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pjerovbl SRR11678136.sra spots: 21746937 blocks: [[1, 1087346], [1087347, 2174692], [2174693, 3262038], [3262039, 4349384], [4349385, 5436730], [5436731, 6524076], [6524077, 7611422], [7611423, 8698768], [8698769, 9786114], [9786115, 10873460], [10873461, 11960806], [11960807, 13048152], [13048153, 14135498], [14135499, 15222844], [15222845, 16310190], [16310191, 17397536], [17397537, 18484882], [18484883, 19572228], [19572229, 20659574], [20659575, 21746937]] SRR11678136 file size 7740744 SRR11678136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678136 SRR11678136_1.fastq SRR11678136_2.fastq Input file: SRR11678136_1.fastq Paired file: SRR11678136_2.fastq trimmed: SRR11678136-trimmed-pair1.fastq, SRR11678136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:54:00 2025 >> started Wed Feb 12 17:54:25 2025 >> done (25.427s) 21746937 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21746937 (100.00%) read pairs available; of these: 557752 ( 2.56%) trimmed read pairs available after processing 21189185 (97.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 142 2 0.00% 143 3 0.00% 144 3 0.00% 145 2 0.00% 146 8 0.00% 147 91 0.00% 148 3383 0.02% 149 554260 2.55% 150 21189185 97.44% 21746937 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=38.72 fanout-score-rank=7 prefix-density=0.29 prefix-fanout=19.4 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=103.55 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=11.5 sequence=AAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCACCTCCTTCAGCTG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=29.82 fanout-score-rank=7 prefix-density=0.28 prefix-fanout=17.2 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=194.71 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=16.7 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGA SRR11678136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:55:10 Started mapping on | Feb 12 17:55:10 Finished on | Feb 12 17:56:53 Mapping speed, Million of reads per hour | 760.09 Number of input reads | 21746937 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20911108 Uniquely mapped reads % | 96.16% Average mapped length | 298.42 Number of splices: Total | 19102210 Number of splices: Annotated (sjdb) | 18714202 Number of splices: GT/AG | 18799053 Number of splices: GC/AG | 234350 Number of splices: AT/AC | 18323 Number of splices: Non-canonical | 50484 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405207 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 1783 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.96% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430622 430622 430622 N_multimapping 405207 405207 405207 N_noFeature 799999 10662053 10874673 N_ambiguous 281577 55236 52657 UnstrandedReadsAssigned:19829532 PositiveStrandReadsAssigned:10193819 NegativeStrandReadsAssigned:9983778 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678136-trimmed-pair1.fastq SRR11678136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,746,937 reads, 20,267,070 reads pseudoaligned [quant] estimated average fragment length: 269.097 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR11678136.ke.tsv 34699 SRR11678136.se.tsv 87100 total ==> SRR11678136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.9 959 27.6305 Potri.005G024800.1.v4.1 1035 766.903 203 13.3457 Potri.004G059700.1.v4.1 961 692.92 32 2.32837 Potri.007G009000.2.v4.1 1416 1147.9 0 0 Potri.003G141000.2.v4.1 2943 2674.9 398.211 7.50569 Potri.016G087400.1.v4.1 270 58.1407 1007 873.24 Potri.015G069301.1.v4.1 564 297.893 0 0 Potri.010G195200.1.v4.1 1773 1504.9 137 4.58983 Potri.012G127500.1.v4.1 977 708.915 4337 308.447 ==> SRR11678136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3259 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 593 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR11678136 completed mapping pipeline successfully