Starting /dee2/code/volunteer_pipeline.sh SRR11678137 current disk space = 3051434008576 free memory = 1579402656 SRR11678137 SRAfilesize 85b586d98da1ddf25b0b6c142d8537ea SRR11678137.sra SRR11678137.sra file validated SRR11678137 is paired end SRR11678137 is conventional basespace SRR11678137 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.954 37.0 36.0 37.0 33.0 38.0 2 35.3785 37.0 36.0 37.0 31.0 38.0 3 36.0015 37.0 36.0 37.0 33.0 38.0 4 35.911 37.0 36.0 37.0 33.0 38.0 5 35.83 37.0 36.0 37.0 33.0 38.0 6 35.7745 37.0 36.0 37.0 32.0 38.0 7 35.90825 37.0 36.0 37.0 33.0 38.0 8 35.917 37.0 36.0 37.0 33.0 38.0 9 36.00125 37.0 36.0 37.0 33.0 38.0 10-14 35.85935 37.0 36.0 37.0 32.8 38.0 15-19 35.8716 37.0 36.0 37.0 32.8 38.0 20-24 35.83115 37.0 36.0 37.0 32.8 38.0 25-29 35.7641 37.0 36.0 37.0 32.2 38.0 30-34 35.849000000000004 37.0 36.0 37.0 32.6 38.0 35-39 35.78495 37.0 36.0 37.0 32.4 38.0 40-44 35.764450000000004 37.0 36.0 37.0 32.2 38.0 45-49 35.75085 37.0 36.0 37.0 32.2 38.0 50-54 35.7028 37.0 36.0 37.0 32.0 38.0 55-59 35.70175 37.0 36.0 37.0 32.0 38.0 60-64 35.64085 37.0 36.0 37.0 32.0 38.0 65-69 35.66095 37.0 36.0 37.0 32.0 38.0 70-74 35.66865 37.0 36.0 37.0 32.0 38.0 75-79 35.577000000000005 37.0 36.0 37.0 31.4 38.0 80-84 35.543099999999995 37.0 36.0 37.0 31.6 38.0 85-89 35.48485 37.0 36.0 37.0 31.4 38.0 90-94 35.404399999999995 37.0 36.0 37.0 31.0 38.0 95-99 35.395450000000004 37.0 36.0 37.0 31.0 38.0 100-104 35.3239 37.0 35.8 37.0 30.8 38.0 105-109 35.312 37.0 35.8 37.0 30.8 38.0 110-114 35.1607 37.0 35.4 37.0 30.0 38.0 115-119 35.126999999999995 37.0 35.0 37.0 30.0 38.0 120-124 35.06595 37.0 35.0 37.0 30.2 38.0 125-129 34.9949 37.0 35.0 37.0 29.8 38.0 130-134 34.884949999999996 37.0 35.0 37.0 29.2 38.0 135-139 34.790800000000004 37.0 35.0 37.0 29.0 38.0 140-144 34.72795 37.0 35.0 37.0 28.6 38.0 145-149 34.6551 37.0 34.8 37.0 28.4 38.0 150 34.66975 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 5.0 26 4.0 27 26.0 28 37.0 29 39.0 30 59.0 31 90.0 32 158.0 33 206.0 34 364.0 35 774.0 36 2056.0 37 181.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.475 19.25 9.075 41.199999999999996 2 16.35 22.325 50.375 10.95 3 13.850000000000001 24.9 34.699999999999996 26.55 4 18.8 36.05 28.849999999999998 16.3 5 19.325 35.075 28.7 16.900000000000002 6 14.524999999999999 34.575 31.85 19.05 7 14.35 15.775 47.199999999999996 22.675 8 17.849999999999998 20.325 30.925000000000004 30.9 9 19.45 22.1 31.075000000000003 27.375 10-14 20.89 28.21 28.139999999999997 22.759999999999998 15-19 20.765 27.85 29.005 22.38 20-24 21.315 28.804999999999996 28.175 21.705 25-29 21.25 28.549999999999997 28.575 21.625 30-34 21.67 27.96 28.405 21.965 35-39 21.04 28.22 28.785 21.955 40-44 21.995 28.410000000000004 27.839999999999996 21.755 45-49 21.560000000000002 28.444999999999997 28.18 21.815 50-54 21.14 28.625 28.485 21.75 55-59 21.82 28.425 27.735 22.02 60-64 22.295 28.155 27.389999999999997 22.16 65-69 21.875 28.565 27.884999999999998 21.675 70-74 21.490000000000002 27.685 28.33 22.495 75-79 21.44 27.975 28.21 22.375 80-84 21.395 28.15 28.685 21.77 85-89 22.009999999999998 28.07 28.565 21.355 90-94 21.975 28.08 27.88 22.065 95-99 21.615000000000002 27.51 28.4 22.475 100-104 21.39 28.165000000000003 28.7 21.745 105-109 21.395 28.22 28.54 21.845 110-114 21.785 28.055000000000003 28.42 21.740000000000002 115-119 22.31 27.76 27.994999999999997 21.935 120-124 22.055 28.185 28.22 21.54 125-129 21.965 28.060000000000002 28.355000000000004 21.62 130-134 21.565 28.735 28.185 21.515 135-139 22.439999999999998 28.175 27.74 21.645 140-144 22.05 28.235 28.1 21.615000000000002 145-149 22.335 28.065 27.505000000000003 22.095000000000002 150 21.15 28.7 28.475 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 2.0 21 1.0 22 0.0 23 3.0 24 6.5 25 8.0 26 9.0 27 13.5 28 15.5 29 16.5 30 27.5 31 37.0 32 38.5 33 46.5 34 52.0 35 75.5 36 99.5 37 113.0 38 146.0 39 176.5 40 195.0 41 223.5 42 263.5 43 281.5 44 275.5 45 260.0 46 240.5 47 247.5 48 226.5 49 192.0 50 170.0 51 131.5 52 107.5 53 78.5 54 52.0 55 36.0 56 26.0 57 23.0 58 21.0 59 12.0 60 6.5 61 8.5 62 9.5 63 5.5 64 3.0 65 3.0 66 2.5 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88776541961577 97.8 2 1.1122345803842264 2.1999999999999997 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATCT 10 0.006973645 144.0 1 >>END_MODULE SRR11678137 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.18725 37.0 36.0 37.0 31.0 38.0 2 34.0605 37.0 34.0 37.0 26.0 37.0 3 35.249 37.0 35.0 37.0 31.0 38.0 4 35.25475 37.0 36.0 37.0 31.0 38.0 5 35.1415 37.0 36.0 37.0 30.0 38.0 6 35.11375 37.0 35.0 37.0 30.0 38.0 7 35.03075 37.0 35.0 37.0 30.0 37.0 8 35.31725 37.0 36.0 37.0 31.0 38.0 9 35.16275 37.0 36.0 37.0 31.0 38.0 10-14 35.0521 37.0 35.0 37.0 30.0 38.0 15-19 35.1108 37.0 35.0 37.0 30.2 38.0 20-24 35.093399999999995 37.0 35.0 37.0 30.2 38.0 25-29 35.05385 37.0 35.0 37.0 30.2 38.0 30-34 35.018 37.0 35.0 37.0 30.0 38.0 35-39 35.0507 37.0 35.0 37.0 30.0 38.0 40-44 34.96825 37.0 35.0 37.0 29.8 38.0 45-49 34.8712 37.0 35.0 37.0 29.2 38.0 50-54 34.87605 37.0 35.0 37.0 29.4 38.0 55-59 34.927099999999996 37.0 35.0 37.0 29.6 38.0 60-64 34.85295 37.0 35.0 37.0 29.2 38.0 65-69 34.8294 37.0 35.0 37.0 29.2 38.0 70-74 34.80615 37.0 35.0 37.0 29.0 38.0 75-79 34.73125 37.0 35.0 37.0 29.0 38.0 80-84 34.696000000000005 37.0 35.0 37.0 29.0 38.0 85-89 34.6282 37.0 35.0 37.0 28.6 38.0 90-94 34.56325 37.0 34.8 37.0 28.2 38.0 95-99 34.480900000000005 37.0 34.2 37.0 28.2 38.0 100-104 34.48435 37.0 34.6 37.0 28.0 38.0 105-109 34.3587 37.0 34.0 37.0 27.6 38.0 110-114 34.210750000000004 37.0 34.0 37.0 27.2 38.0 115-119 34.215 37.0 34.0 37.0 27.2 38.0 120-124 34.178349999999995 37.0 34.0 37.0 26.8 38.0 125-129 34.07295 37.0 34.0 37.0 26.6 38.0 130-134 33.949400000000004 37.0 33.6 37.0 26.4 38.0 135-139 33.80155 37.0 33.2 37.0 26.0 38.0 140-144 33.6577 36.4 33.0 37.0 24.8 38.0 145-149 33.584999999999994 36.2 33.0 37.0 25.0 37.8 150 33.66125 37.0 33.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 5.0 24 16.0 25 25.0 26 49.0 27 63.0 28 82.0 29 82.0 30 116.0 31 142.0 32 197.0 33 321.0 34 471.0 35 855.0 36 1464.0 37 112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.275000000000002 19.175 8.175 42.375 2 15.45 24.65 48.925000000000004 10.975 3 14.025000000000002 26.400000000000002 35.25 24.325 4 17.875 35.75 28.999999999999996 17.375 5 17.974999999999998 34.775 30.349999999999998 16.900000000000002 6 15.1 32.975 32.300000000000004 19.625 7 15.225 14.2 47.9 22.675 8 17.349999999999998 20.575 32.125 29.95 9 21.349999999999998 21.3 30.825000000000003 26.525 10-14 20.86 28.904999999999998 27.615000000000002 22.62 15-19 20.849999999999998 27.860000000000003 28.439999999999998 22.85 20-24 20.76 28.505000000000003 28.225 22.509999999999998 25-29 21.87 29.535 27.284999999999997 21.310000000000002 30-34 21.145 28.499999999999996 28.015 22.34 35-39 21.895 28.689999999999998 27.605 21.81 40-44 21.185000000000002 28.555000000000003 28.804999999999996 21.455 45-49 21.545 28.389999999999997 28.025 22.040000000000003 50-54 22.08 28.155 27.965 21.8 55-59 21.445 28.689999999999998 27.655 22.21 60-64 21.955 28.244999999999997 27.47 22.33 65-69 21.325 28.555000000000003 28.299999999999997 21.82 70-74 21.7 28.249999999999996 28.360000000000003 21.69 75-79 21.905 28.16 27.96 21.975 80-84 21.77 28.46 28.244999999999997 21.525 85-89 21.545 28.565 27.865000000000002 22.025 90-94 22.13 28.205000000000002 28.194999999999997 21.47 95-99 22.235 28.565 27.525 21.675 100-104 22.2 28.249999999999996 27.500000000000004 22.05 105-109 21.48 28.27 27.800000000000004 22.45 110-114 21.7 28.555000000000003 28.24 21.505 115-119 21.67 27.950000000000003 28.410000000000004 21.97 120-124 22.42 27.195000000000004 28.18 22.205 125-129 21.62 28.560000000000002 27.534999999999997 22.285 130-134 22.095000000000002 28.075 28.02 21.81 135-139 21.875 28.175 28.185 21.765 140-144 22.21 27.97 27.415 22.405 145-149 22.314999999999998 27.689999999999998 28.005000000000003 21.990000000000002 150 22.425 28.9 27.900000000000002 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.5 19 1.5 20 2.0 21 2.0 22 1.5 23 3.0 24 7.5 25 8.5 26 6.5 27 8.5 28 12.5 29 16.5 30 26.5 31 37.5 32 37.5 33 50.5 34 71.5 35 73.5 36 81.0 37 115.5 38 152.5 39 186.0 40 208.5 41 228.5 42 253.0 43 270.5 44 269.0 45 261.0 46 254.0 47 236.0 48 225.5 49 199.0 50 158.5 51 122.5 52 94.0 53 74.0 54 63.0 55 48.0 56 32.0 57 24.5 58 17.0 59 11.0 60 9.0 61 7.5 62 5.5 63 7.0 64 6.0 65 2.5 66 2.0 67 2.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73417721518987 97.5 2 1.2658227848101267 2.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCCCA 10 0.006973645 144.0 6 AAATCCC 10 0.006973645 144.0 4 >>END_MODULE Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088390 spots for SRR11678137.sra Written 1088390 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra Read 1088380 spots for SRR11678137.sra Written 1088380 spots for SRR11678137.sra SRR ids: ['SRR11678137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_059zoneb SRR11678137.sra spots: 21767610 blocks: [[1, 1088380], [1088381, 2176760], [2176761, 3265140], [3265141, 4353520], [4353521, 5441900], [5441901, 6530280], [6530281, 7618660], [7618661, 8707040], [8707041, 9795420], [9795421, 10883800], [10883801, 11972180], [11972181, 13060560], [13060561, 14148940], [14148941, 15237320], [15237321, 16325700], [16325701, 17414080], [17414081, 18502460], [18502461, 19590840], [19590841, 20679220], [20679221, 21767610]] SRR11678137 file size 7748112 SRR11678137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678137 SRR11678137_1.fastq SRR11678137_2.fastq Input file: SRR11678137_1.fastq Paired file: SRR11678137_2.fastq trimmed: SRR11678137-trimmed-pair1.fastq, SRR11678137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:17:34 2025 >> started Wed Feb 12 18:17:58 2025 >> done (24.367s) 21767610 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21767610 (100.00%) read pairs available; of these: 518585 ( 2.38%) trimmed read pairs available after processing 21249025 (97.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 1 0.00% 141 0 0.00% 142 1 0.00% 143 3 0.00% 144 5 0.00% 145 1 0.00% 146 6 0.00% 147 86 0.00% 148 3067 0.01% 149 515415 2.37% 150 21249025 97.62% 21767610 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=40.47 fanout-score-rank=7 prefix-density=0.35 prefix-fanout=19.8 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=341.28 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=33.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=38.23 fanout-score-rank=11 prefix-density=0.38 prefix-fanout=19.7 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=305.18 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=29.3 sequence=CTTCTTCTTCTT SRR11678137 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:18:48 Started mapping on | Feb 12 18:18:48 Finished on | Feb 12 18:20:44 Mapping speed, Million of reads per hour | 675.55 Number of input reads | 21767610 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20845744 Uniquely mapped reads % | 95.76% Average mapped length | 298.48 Number of splices: Total | 19367640 Number of splices: Annotated (sjdb) | 18999127 Number of splices: GT/AG | 19055520 Number of splices: GC/AG | 244319 Number of splices: AT/AC | 18293 Number of splices: Non-canonical | 49508 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423969 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 1488 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 497897 497897 497897 N_multimapping 423969 423969 423969 N_noFeature 751212 10617150 10832072 N_ambiguous 253274 54670 51511 UnstrandedReadsAssigned:19841258 PositiveStrandReadsAssigned:10173924 NegativeStrandReadsAssigned:9962161 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678137-trimmed-pair1.fastq SRR11678137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,767,610 reads, 20,294,648 reads pseudoaligned [quant] estimated average fragment length: 257.47 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR11678137.ke.tsv 34699 SRR11678137.se.tsv 87100 total ==> SRR11678137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.53 1705 48.8474 Potri.005G024800.1.v4.1 1035 778.53 271 17.5671 Potri.004G059700.1.v4.1 961 704.53 37 2.65039 Potri.007G009000.2.v4.1 1416 1159.53 0 0 Potri.003G141000.2.v4.1 2943 2686.53 434.342 8.1592 Potri.016G087400.1.v4.1 270 60.345 1003 838.815 Potri.015G069301.1.v4.1 564 308.747 0 0 Potri.010G195200.1.v4.1 1773 1516.53 124 4.12646 Potri.012G127500.1.v4.1 977 720.53 5117 358.402 ==> SRR11678137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2548 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 524 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR11678137 completed mapping pipeline successfully