Starting /dee2/code/volunteer_pipeline.sh SRR11678138 current disk space = 3051796807680 free memory = 1418568012 SRR11678138 SRAfilesize e13ef5dcc769131de0b4008ffeccb59f SRR11678138.sra SRR11678138.sra file validated SRR11678138 is paired end SRR11678138 is conventional basespace SRR11678138 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9365 37.0 36.0 37.0 33.0 38.0 2 35.39925 37.0 36.0 37.0 31.0 38.0 3 35.9665 37.0 36.0 37.0 33.0 38.0 4 35.84275 37.0 36.0 37.0 32.0 38.0 5 35.85375 37.0 36.0 37.0 33.0 38.0 6 35.81125 37.0 36.0 37.0 33.0 38.0 7 35.99 37.0 36.0 37.0 33.0 38.0 8 35.95875 37.0 36.0 37.0 33.0 38.0 9 35.848 37.0 36.0 37.0 33.0 38.0 10-14 35.8543 37.0 36.0 37.0 32.4 38.0 15-19 35.8097 37.0 36.0 37.0 32.6 38.0 20-24 35.80145 37.0 36.0 37.0 32.4 38.0 25-29 35.7917 37.0 36.0 37.0 32.6 38.0 30-34 35.803399999999996 37.0 36.0 37.0 32.2 38.0 35-39 35.77325 37.0 36.0 37.0 32.2 38.0 40-44 35.74825 37.0 36.0 37.0 32.2 38.0 45-49 35.7294 37.0 36.0 37.0 32.4 38.0 50-54 35.650549999999996 37.0 36.0 37.0 32.0 38.0 55-59 35.6693 37.0 36.0 37.0 32.0 38.0 60-64 35.617149999999995 37.0 36.0 37.0 31.8 38.0 65-69 35.5766 37.0 36.0 37.0 31.8 38.0 70-74 35.5561 37.0 36.0 37.0 31.8 38.0 75-79 35.486000000000004 37.0 36.0 37.0 31.0 38.0 80-84 35.463499999999996 37.0 36.0 37.0 31.4 38.0 85-89 35.4288 37.0 36.0 37.0 31.0 38.0 90-94 35.379599999999996 37.0 36.0 37.0 31.0 38.0 95-99 35.288500000000006 37.0 36.0 37.0 30.8 38.0 100-104 35.26945 37.0 35.8 37.0 30.8 38.0 105-109 35.251149999999996 37.0 35.8 37.0 30.8 38.0 110-114 35.159000000000006 37.0 35.6 37.0 30.0 38.0 115-119 35.11070000000001 37.0 35.0 37.0 30.2 38.0 120-124 34.964600000000004 37.0 35.0 37.0 29.4 38.0 125-129 34.96635 37.0 35.0 37.0 29.6 38.0 130-134 34.8298 37.0 35.0 37.0 29.2 38.0 135-139 34.76585 37.0 35.0 37.0 29.0 38.0 140-144 34.665749999999996 37.0 34.8 37.0 28.8 38.0 145-149 34.614 37.0 34.8 37.0 28.4 38.0 150 34.709 37.0 35.0 37.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 11.0 27 23.0 28 30.0 29 48.0 30 59.0 31 101.0 32 158.0 33 233.0 34 359.0 35 795.0 36 2031.0 37 149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.975 19.400000000000002 11.725 38.9 2 15.925 23.400000000000002 49.075 11.600000000000001 3 13.8 27.0 33.5 25.7 4 19.8 35.0 27.3 17.9 5 19.575 36.275 28.000000000000004 16.150000000000002 6 14.274999999999999 34.25 32.675 18.8 7 13.750000000000002 15.275 47.75 23.225 8 18.125 21.55 30.775000000000002 29.549999999999997 9 19.6 22.825 30.65 26.924999999999997 10-14 19.985 29.709999999999997 27.99 22.314999999999998 15-19 20.669999999999998 27.845 28.65 22.835 20-24 21.01 28.060000000000002 28.46 22.470000000000002 25-29 21.05 28.9 28.525 21.525 30-34 21.349999999999998 28.449999999999996 28.439999999999998 21.759999999999998 35-39 21.205 29.060000000000002 27.965 21.77 40-44 21.385 28.895 28.005000000000003 21.715 45-49 21.8 28.499999999999996 27.744999999999997 21.955 50-54 21.905 28.310000000000002 28.535 21.25 55-59 21.81 28.67 27.765 21.755 60-64 21.715 28.43 28.515 21.34 65-69 21.66 28.139999999999997 28.360000000000003 21.84 70-74 22.23 27.865000000000002 28.215 21.69 75-79 21.575 28.199999999999996 28.4 21.825 80-84 21.775 28.599999999999998 27.88 21.745 85-89 21.34 28.705000000000002 27.750000000000004 22.205 90-94 21.154999999999998 28.08 28.110000000000003 22.655 95-99 21.634999999999998 28.46 27.975 21.93 100-104 21.665 28.625 28.015 21.695 105-109 21.38 28.32 28.549999999999997 21.75 110-114 21.8 28.599999999999998 27.725 21.875 115-119 21.685 28.59 28.03 21.695 120-124 22.48 27.529999999999998 28.17 21.82 125-129 22.2 28.435 28.21 21.154999999999998 130-134 21.47 28.310000000000002 28.425 21.795 135-139 21.69 28.515 28.299999999999997 21.495 140-144 21.815 28.03 28.560000000000002 21.595 145-149 22.15 28.59 27.815 21.445 150 21.75 28.825 27.450000000000003 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 2.5 20 3.5 21 2.0 22 3.5 23 7.0 24 8.0 25 8.5 26 10.0 27 15.0 28 19.0 29 19.5 30 29.0 31 35.5 32 44.5 33 51.5 34 51.5 35 68.0 36 97.5 37 118.5 38 150.5 39 186.0 40 207.5 41 229.0 42 249.5 43 280.0 44 288.0 45 259.5 46 241.5 47 234.5 48 208.5 49 180.0 50 158.5 51 131.0 52 104.5 53 76.5 54 51.0 55 41.5 56 34.5 57 25.5 58 17.0 59 12.5 60 8.0 61 5.0 62 5.5 63 5.0 64 4.5 65 3.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83662114314619 97.7 2 1.163378856853819 2.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGCT 10 0.006973645 144.0 3 >>END_MODULE SRR11678138 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3755 37.0 36.0 37.0 31.0 38.0 2 34.2475 37.0 34.0 37.0 27.0 37.0 3 35.145 37.0 35.0 37.0 30.0 38.0 4 35.02375 37.0 35.0 37.0 30.0 38.0 5 35.10225 37.0 35.0 37.0 30.0 38.0 6 35.062 37.0 35.0 37.0 30.0 38.0 7 34.93475 37.0 35.0 37.0 30.0 37.0 8 35.2035 37.0 35.0 37.0 30.0 38.0 9 35.06175 37.0 35.0 37.0 30.0 38.0 10-14 35.049099999999996 37.0 35.2 37.0 30.0 38.0 15-19 35.0345 37.0 35.0 37.0 30.0 38.0 20-24 35.01685 37.0 35.0 37.0 29.8 38.0 25-29 34.998599999999996 37.0 35.0 37.0 29.8 38.0 30-34 34.962599999999995 37.0 35.0 37.0 29.6 38.0 35-39 34.9469 37.0 35.0 37.0 29.8 38.0 40-44 34.93035 37.0 35.0 37.0 29.2 38.0 45-49 34.9369 37.0 35.0 37.0 29.6 38.0 50-54 34.8827 37.0 35.0 37.0 29.6 38.0 55-59 34.87505 37.0 35.0 37.0 29.2 38.0 60-64 34.77725 37.0 35.0 37.0 28.8 38.0 65-69 34.7657 37.0 35.0 37.0 29.0 38.0 70-74 34.71965 37.0 35.0 37.0 29.0 38.0 75-79 34.697199999999995 37.0 35.0 37.0 28.4 38.0 80-84 34.66759999999999 37.0 35.0 37.0 28.8 38.0 85-89 34.6007 37.0 34.8 37.0 28.6 38.0 90-94 34.48525 37.0 34.4 37.0 27.8 38.0 95-99 34.40685 37.0 34.0 37.0 27.6 38.0 100-104 34.33935 37.0 34.0 37.0 27.6 38.0 105-109 34.334050000000005 37.0 34.0 37.0 27.6 38.0 110-114 34.213649999999994 37.0 34.0 37.0 27.0 38.0 115-119 34.16055000000001 37.0 34.0 37.0 27.0 38.0 120-124 34.03985 37.0 33.8 37.0 26.8 38.0 125-129 33.978500000000004 37.0 33.6 37.0 26.2 38.0 130-134 33.843599999999995 37.0 33.0 37.0 25.8 38.0 135-139 33.69375 36.8 33.0 37.0 25.2 38.0 140-144 33.6903 36.6 33.0 37.0 25.2 38.0 145-149 33.565799999999996 36.0 33.0 37.0 24.8 38.0 150 33.605 37.0 33.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 6.0 24 16.0 25 31.0 26 63.0 27 71.0 28 73.0 29 99.0 30 119.0 31 138.0 32 196.0 33 292.0 34 479.0 35 813.0 36 1478.0 37 126.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 19.55 12.1 38.6 2 17.65 23.974999999999998 47.425 10.95 3 13.55 26.900000000000002 34.5 25.05 4 18.075 36.425000000000004 28.675 16.825000000000003 5 19.900000000000002 35.55 27.375 17.175 6 14.575 35.075 30.575000000000003 19.775000000000002 7 15.0 14.45 48.3 22.25 8 18.95 21.05 29.975 30.025000000000002 9 18.6 22.275 30.2 28.925 10-14 21.015 28.68 28.189999999999998 22.115000000000002 15-19 21.395 28.13 28.225 22.25 20-24 21.545 28.970000000000002 27.72 21.765 25-29 21.22 28.435 28.74 21.605 30-34 21.025 28.455000000000002 28.325 22.195 35-39 21.45 28.599999999999998 27.900000000000002 22.05 40-44 20.724999999999998 29.020000000000003 27.700000000000003 22.555 45-49 21.115000000000002 28.15 28.315 22.42 50-54 21.7 28.375 28.09 21.834999999999997 55-59 21.385 28.215 28.435 21.965 60-64 20.895 28.52 28.435 22.15 65-69 21.465 28.605000000000004 28.144999999999996 21.785 70-74 21.365000000000002 28.71 27.85 22.075 75-79 21.445 28.499999999999996 27.694999999999997 22.36 80-84 21.7 28.325 28.165000000000003 21.81 85-89 21.65 28.299999999999997 28.29 21.759999999999998 90-94 21.845 28.57 27.88 21.705 95-99 21.91 27.834999999999997 28.294999999999998 21.959999999999997 100-104 22.195 27.98 28.175 21.65 105-109 21.490000000000002 27.185 28.565 22.759999999999998 110-114 21.52 28.470000000000002 28.035 21.975 115-119 22.215 27.794999999999998 28.355000000000004 21.634999999999998 120-124 21.77 28.04 27.88 22.31 125-129 22.035 28.249999999999996 28.07 21.645 130-134 22.05 28.18 27.839999999999996 21.93 135-139 22.065 27.875 27.63 22.43 140-144 21.985 27.994999999999997 28.62 21.4 145-149 21.575 27.584999999999997 28.375 22.465 150 22.525000000000002 26.974999999999998 28.325 22.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 1.5 18 0.5 19 0.5 20 1.0 21 1.5 22 4.0 23 5.0 24 4.5 25 7.0 26 11.0 27 14.5 28 16.0 29 24.0 30 30.5 31 35.0 32 41.0 33 50.5 34 64.0 35 77.5 36 99.5 37 130.5 38 155.0 39 166.5 40 196.0 41 225.5 42 245.5 43 258.5 44 266.5 45 276.0 46 253.5 47 222.0 48 225.0 49 204.0 50 147.5 51 121.5 52 101.0 53 75.5 54 60.0 55 46.5 56 33.0 57 23.5 58 14.5 59 9.5 60 12.5 61 11.5 62 10.0 63 5.5 64 2.0 65 2.5 66 2.5 67 1.5 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91331817033105 97.85000000000001 2 1.0866818296689411 2.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAACAG 10 0.006973645 144.0 1 >>END_MODULE Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090465 spots for SRR11678138.sra Written 1090465 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra Read 1090447 spots for SRR11678138.sra Written 1090447 spots for SRR11678138.sra SRR ids: ['SRR11678138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5zeudrcj SRR11678138.sra spots: 21808958 blocks: [[1, 1090447], [1090448, 2180894], [2180895, 3271341], [3271342, 4361788], [4361789, 5452235], [5452236, 6542682], [6542683, 7633129], [7633130, 8723576], [8723577, 9814023], [9814024, 10904470], [10904471, 11994917], [11994918, 13085364], [13085365, 14175811], [14175812, 15266258], [15266259, 16356705], [16356706, 17447152], [17447153, 18537599], [18537600, 19628046], [19628047, 20718493], [20718494, 21808958]] SRR11678138 file size 7762851 SRR11678138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678138 SRR11678138_1.fastq SRR11678138_2.fastq Input file: SRR11678138_1.fastq Paired file: SRR11678138_2.fastq trimmed: SRR11678138-trimmed-pair1.fastq, SRR11678138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:19:45 2025 >> started Wed Feb 12 17:20:26 2025 >> done (40.101s) 21808958 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21808958 (100.00%) read pairs available; of these: 530584 ( 2.43%) trimmed read pairs available after processing 21278374 (97.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 1 0.00% 142 3 0.00% 143 2 0.00% 144 2 0.00% 145 5 0.00% 146 13 0.00% 147 88 0.00% 148 3254 0.01% 149 527216 2.42% 150 21278374 97.57% 21808958 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=38.12 fanout-score-rank=5 prefix-density=0.34 prefix-fanout=19.4 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=299.31 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=18.4 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=42.52 fanout-score-rank=6 prefix-density=0.37 prefix-fanout=22.0 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=341.98 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=29.7 sequence=CTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGA SRR11678138 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:22:01 Started mapping on | Feb 12 17:22:01 Finished on | Feb 12 17:24:12 Mapping speed, Million of reads per hour | 599.33 Number of input reads | 21808958 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20766627 Uniquely mapped reads % | 95.22% Average mapped length | 294.37 Number of splices: Total | 18724560 Number of splices: Annotated (sjdb) | 18379200 Number of splices: GT/AG | 18428719 Number of splices: GC/AG | 228569 Number of splices: AT/AC | 17649 Number of splices: Non-canonical | 49623 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407182 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 1595 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 635149 635149 635149 N_multimapping 407182 407182 407182 N_noFeature 719029 10525032 10799670 N_ambiguous 271576 56737 54546 UnstrandedReadsAssigned:19776022 PositiveStrandReadsAssigned:10184858 NegativeStrandReadsAssigned:9912411 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678138-trimmed-pair1.fastq SRR11678138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,808,958 reads, 20,401,442 reads pseudoaligned [quant] estimated average fragment length: 256.682 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR11678138.ke.tsv 34699 SRR11678138.se.tsv 87100 total ==> SRR11678138.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.32 1637 47.5254 Potri.005G024800.1.v4.1 1035 779.318 195 12.8021 Potri.004G059700.1.v4.1 961 705.326 37 2.68394 Potri.007G009000.2.v4.1 1416 1160.32 0 0 Potri.003G141000.2.v4.1 2943 2687.32 367.054 6.9883 Potri.016G087400.1.v4.1 270 62.2393 944 776.013 Potri.015G069301.1.v4.1 564 309.66 0 0 Potri.010G195200.1.v4.1 1773 1517.32 91 3.0685 Potri.012G127500.1.v4.1 977 721.318 4466 316.777 ==> SRR11678138.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2670 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 488 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR11678138 completed mapping pipeline successfully