Starting /dee2/code/volunteer_pipeline.sh SRR11678139 current disk space = 3051836215296 free memory = 1443420124 SRR11678139 SRAfilesize 2fccdf660d8b33cbf991d9f6afb4a4c5 SRR11678139.sra SRR11678139.sra file validated SRR11678139 is paired end SRR11678139 is conventional basespace SRR11678139 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.79475 37.0 36.0 37.0 32.0 38.0 2 35.22775 37.0 36.0 37.0 30.0 38.0 3 35.75975 37.0 36.0 37.0 32.0 38.0 4 35.7175 37.0 36.0 37.0 32.0 38.0 5 35.714 37.0 36.0 37.0 32.0 38.0 6 35.61575 37.0 36.0 37.0 32.0 38.0 7 35.77275 37.0 36.0 37.0 33.0 38.0 8 35.836 37.0 36.0 37.0 33.0 38.0 9 35.7275 37.0 36.0 37.0 32.0 38.0 10-14 35.729 37.0 36.0 37.0 32.0 38.0 15-19 35.67205 37.0 36.0 37.0 32.2 38.0 20-24 35.560500000000005 37.0 36.0 37.0 31.6 38.0 25-29 35.671800000000005 37.0 36.0 37.0 32.0 38.0 30-34 35.618849999999995 37.0 36.0 37.0 32.0 38.0 35-39 35.611200000000004 37.0 36.0 37.0 31.8 38.0 40-44 35.622550000000004 37.0 36.0 37.0 31.8 38.0 45-49 35.60995 37.0 36.0 37.0 32.2 38.0 50-54 35.535900000000005 37.0 36.0 37.0 31.4 38.0 55-59 35.5073 37.0 36.0 37.0 31.4 38.0 60-64 35.46825 37.0 36.0 37.0 31.2 38.0 65-69 35.371 37.0 36.0 37.0 31.2 38.0 70-74 35.3115 37.0 36.0 37.0 30.8 38.0 75-79 35.3108 37.0 36.0 37.0 30.4 38.0 80-84 35.26095 37.0 36.0 37.0 30.6 38.0 85-89 35.2069 37.0 36.0 37.0 30.4 38.0 90-94 35.17244999999999 37.0 35.6 37.0 30.2 38.0 95-99 35.11965 37.0 35.4 37.0 30.0 38.0 100-104 35.0411 37.0 35.0 37.0 29.6 38.0 105-109 34.897349999999996 37.0 35.0 37.0 29.2 38.0 110-114 34.901900000000005 37.0 35.0 37.0 29.4 38.0 115-119 34.814350000000005 37.0 35.0 37.0 29.0 38.0 120-124 34.7435 37.0 35.0 37.0 29.0 38.0 125-129 34.5696 37.0 34.8 37.0 28.4 38.0 130-134 34.508449999999996 37.0 34.4 37.0 28.0 38.0 135-139 34.4345 37.0 34.0 37.0 27.8 38.0 140-144 34.2927 37.0 34.0 37.0 27.0 38.0 145-149 34.2303 37.0 34.0 37.0 27.0 38.0 150 34.188 37.0 34.0 37.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 17.0 27 22.0 28 29.0 29 58.0 30 83.0 31 125.0 32 180.0 33 256.0 34 493.0 35 772.0 36 1829.0 37 131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.624999999999996 19.125 12.775 36.475 2 16.875 24.2 47.275 11.65 3 14.299999999999999 26.950000000000003 33.900000000000006 24.85 4 18.825 35.975 29.475 15.725 5 19.025 34.5 28.925 17.549999999999997 6 14.399999999999999 34.2 31.775 19.625 7 13.975000000000001 15.9 47.775 22.35 8 18.5 20.3 30.099999999999998 31.1 9 20.05 21.3 30.049999999999997 28.599999999999998 10-14 20.474999999999998 28.625 27.495000000000005 23.405 15-19 20.445 28.98 28.315 22.259999999999998 20-24 20.93 28.115000000000002 28.720000000000002 22.235 25-29 21.165 28.84 27.96 22.035 30-34 21.224999999999998 28.199999999999996 28.265 22.31 35-39 20.855 28.27 28.225 22.650000000000002 40-44 21.625 28.08 28.285 22.009999999999998 45-49 21.060000000000002 28.37 28.37 22.2 50-54 21.66 28.43 28.065 21.845 55-59 21.91 28.055000000000003 28.075 21.959999999999997 60-64 21.275 28.7 28.01 22.015 65-69 21.95 28.470000000000002 27.92 21.66 70-74 21.185000000000002 28.1 28.33 22.384999999999998 75-79 22.63 27.785 27.975 21.61 80-84 21.465 27.66 28.775000000000002 22.1 85-89 21.34 28.349999999999998 27.855 22.455 90-94 21.72 28.060000000000002 28.299999999999997 21.92 95-99 21.375 27.839999999999996 28.415000000000003 22.37 100-104 21.925 28.105000000000004 27.689999999999998 22.28 105-109 21.5 27.589999999999996 28.63 22.28 110-114 21.625 28.705000000000002 27.74 21.93 115-119 21.63 27.605 28.725 22.040000000000003 120-124 21.92 27.6 28.310000000000002 22.17 125-129 22.115000000000002 27.565 28.754999999999995 21.565 130-134 22.345000000000002 27.800000000000004 28.299999999999997 21.555 135-139 22.255 28.060000000000002 27.839999999999996 21.845 140-144 21.709999999999997 27.935 28.044999999999998 22.31 145-149 22.195 28.144999999999996 28.025 21.634999999999998 150 22.45 28.499999999999996 27.825 21.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 2.5 19 1.5 20 1.5 21 1.5 22 1.5 23 3.0 24 4.5 25 6.0 26 8.5 27 11.0 28 16.0 29 21.0 30 28.5 31 39.5 32 49.0 33 59.5 34 70.5 35 76.5 36 87.5 37 114.5 38 141.5 39 159.5 40 194.5 41 219.0 42 224.0 43 271.0 44 277.0 45 253.0 46 257.0 47 250.5 48 237.5 49 203.5 50 166.5 51 133.0 52 98.0 53 74.0 54 64.5 55 46.0 56 29.0 57 21.5 58 18.5 59 16.0 60 7.5 61 6.5 62 5.5 63 3.5 64 2.5 65 1.0 66 2.5 67 3.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACCT 10 0.006973645 144.0 7 >>END_MODULE SRR11678139 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2335 37.0 36.0 37.0 30.0 38.0 2 34.09875 37.0 34.0 37.0 26.0 38.0 3 35.115 37.0 35.0 37.0 30.0 38.0 4 35.0555 37.0 35.0 37.0 30.0 38.0 5 34.967 37.0 35.0 37.0 30.0 38.0 6 35.01675 37.0 35.0 37.0 30.0 38.0 7 34.9615 37.0 35.0 37.0 30.0 37.0 8 35.22675 37.0 35.0 37.0 30.0 38.0 9 35.1085 37.0 35.0 37.0 30.0 38.0 10-14 35.05194999999999 37.0 35.4 37.0 29.8 38.0 15-19 35.075 37.0 35.4 37.0 30.0 38.0 20-24 35.0103 37.0 35.0 37.0 29.8 38.0 25-29 34.95 37.0 35.0 37.0 29.6 38.0 30-34 34.969 37.0 35.0 37.0 29.8 38.0 35-39 34.9911 37.0 35.2 37.0 29.8 38.0 40-44 34.936699999999995 37.0 35.0 37.0 29.4 38.0 45-49 34.90965 37.0 35.0 37.0 29.6 38.0 50-54 34.85625 37.0 35.0 37.0 29.4 38.0 55-59 34.8697 37.0 35.0 37.0 29.2 38.0 60-64 34.8117 37.0 35.0 37.0 28.8 38.0 65-69 34.7912 37.0 35.0 37.0 29.0 38.0 70-74 34.7725 37.0 35.0 37.0 29.2 38.0 75-79 34.748099999999994 37.0 35.0 37.0 29.0 38.0 80-84 34.7295 37.0 35.0 37.0 28.6 38.0 85-89 34.669650000000004 37.0 35.0 37.0 28.6 38.0 90-94 34.60305 37.0 34.8 37.0 28.4 38.0 95-99 34.529250000000005 37.0 34.8 37.0 28.0 38.0 100-104 34.45195 37.0 34.6 37.0 27.8 38.0 105-109 34.39685000000001 37.0 34.6 37.0 27.6 38.0 110-114 34.382400000000004 37.0 34.0 37.0 27.8 38.0 115-119 34.2836 37.0 34.0 37.0 27.0 38.0 120-124 34.1781 37.0 34.0 37.0 26.8 38.0 125-129 34.02425 37.0 33.8 37.0 26.4 38.0 130-134 33.9163 37.0 33.8 37.0 26.0 38.0 135-139 33.86 37.0 33.2 37.0 25.8 38.0 140-144 33.73455 37.0 33.0 37.0 25.4 38.0 145-149 33.588300000000004 37.0 33.0 37.0 24.8 38.0 150 33.6965 37.0 33.0 37.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 9.0 24 14.0 25 33.0 26 37.0 27 61.0 28 92.0 29 109.0 30 125.0 31 157.0 32 205.0 33 259.0 34 414.0 35 803.0 36 1541.0 37 140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.049999999999997 18.15 12.675 39.125 2 17.175 24.825 46.1 11.899999999999999 3 15.55 26.6 31.95 25.900000000000002 4 18.099999999999998 37.225 26.950000000000003 17.724999999999998 5 18.15 35.675000000000004 28.95 17.224999999999998 6 14.7 34.449999999999996 30.025000000000002 20.825 7 14.575 14.774999999999999 46.85 23.799999999999997 8 18.05 20.424999999999997 31.624999999999996 29.9 9 19.925 20.849999999999998 30.775000000000002 28.449999999999996 10-14 20.79 28.65 27.435 23.125 15-19 21.18 28.7 28.125 21.995 20-24 21.245 28.599999999999998 28.025 22.13 25-29 21.0 28.749999999999996 28.389999999999997 21.86 30-34 21.45 28.07 28.38 22.1 35-39 21.645 28.305000000000003 27.894999999999996 22.155 40-44 21.759999999999998 28.24 28.199999999999996 21.8 45-49 21.490000000000002 28.7 28.04 21.77 50-54 21.63 28.139999999999997 28.37 21.86 55-59 21.98 28.645 27.875 21.5 60-64 22.41 28.005000000000003 27.98 21.605 65-69 22.18 28.110000000000003 27.744999999999997 21.965 70-74 21.634999999999998 28.67 27.400000000000002 22.295 75-79 21.705 28.665000000000003 27.57 22.06 80-84 21.81 28.365000000000002 27.985 21.84 85-89 22.06 28.449999999999996 27.400000000000002 22.09 90-94 21.21 28.050000000000004 28.12 22.62 95-99 21.375 28.255000000000003 28.425 21.945 100-104 21.765 28.305000000000003 27.68 22.25 105-109 21.46 28.4 27.985 22.155 110-114 21.92 28.48 27.845 21.755 115-119 22.105 28.425 27.97 21.5 120-124 22.165000000000003 28.32 27.785 21.73 125-129 21.971098554927746 28.366418320916047 27.91639581979099 21.74608730436522 130-134 22.49 27.87 27.694999999999997 21.945 135-139 21.595 28.74 27.87 21.795 140-144 22.255 28.310000000000002 27.500000000000004 21.935 145-149 22.095000000000002 27.894999999999996 28.189999999999998 21.82 150 21.925 27.825 28.175 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 2.5 24 3.5 25 4.5 26 11.5 27 16.0 28 15.0 29 21.0 30 27.0 31 32.5 32 40.0 33 44.5 34 52.0 35 71.5 36 100.0 37 130.5 38 155.5 39 165.0 40 187.5 41 217.0 42 234.0 43 255.5 44 278.0 45 274.5 46 252.0 47 232.5 48 218.5 49 200.5 50 169.5 51 144.0 52 109.5 53 79.0 54 61.0 55 45.0 56 38.0 57 30.5 58 20.5 59 9.0 60 9.5 61 9.0 62 2.0 63 6.0 64 6.5 65 2.0 66 2.5 67 2.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATACTG 10 0.006973645 144.0 3 AGATTCA 10 0.006973645 144.0 4 >>END_MODULE Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083051 spots for SRR11678139.sra Written 1083051 spots for SRR11678139.sra Read 1083069 spots for SRR11678139.sra Written 1083069 spots for SRR11678139.sra SRR ids: ['SRR11678139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5hg5ys0w SRR11678139.sra spots: 21661038 blocks: [[1, 1083051], [1083052, 2166102], [2166103, 3249153], [3249154, 4332204], [4332205, 5415255], [5415256, 6498306], [6498307, 7581357], [7581358, 8664408], [8664409, 9747459], [9747460, 10830510], [10830511, 11913561], [11913562, 12996612], [12996613, 14079663], [14079664, 15162714], [15162715, 16245765], [16245766, 17328816], [17328817, 18411867], [18411868, 19494918], [19494919, 20577969], [20577970, 21661038]] SRR11678139 file size 7710125 SRR11678139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678139 SRR11678139_1.fastq SRR11678139_2.fastq Input file: SRR11678139_1.fastq Paired file: SRR11678139_2.fastq trimmed: SRR11678139-trimmed-pair1.fastq, SRR11678139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:27:46 2025 >> started Wed Feb 12 17:28:12 2025 >> done (26.429s) 21661038 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21661038 (100.00%) read pairs available; of these: 564969 ( 2.61%) trimmed read pairs available after processing 21096069 (97.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 142 3 0.00% 143 3 0.00% 144 1 0.00% 145 4 0.00% 146 3 0.00% 147 96 0.00% 148 3296 0.02% 149 561563 2.59% 150 21096069 97.39% 21661038 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=55.80 fanout-score-rank=7 prefix-density=0.51 prefix-fanout=25.6 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=356.55 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=34.8 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=49.63 fanout-score-rank=5 prefix-density=0.53 prefix-fanout=24.6 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=189.02 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=23.3 sequence=CCACCACCAACA SRR11678139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:28:58 Started mapping on | Feb 12 17:28:58 Finished on | Feb 12 17:30:59 Mapping speed, Million of reads per hour | 644.46 Number of input reads | 21661038 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20762923 Uniquely mapped reads % | 95.85% Average mapped length | 298.32 Number of splices: Total | 19006615 Number of splices: Annotated (sjdb) | 18658024 Number of splices: GT/AG | 18705270 Number of splices: GC/AG | 233823 Number of splices: AT/AC | 17672 Number of splices: Non-canonical | 49850 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 420302 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 1653 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477813 477813 477813 N_multimapping 420302 420302 420302 N_noFeature 700219 10598475 10711483 N_ambiguous 258126 53420 52221 UnstrandedReadsAssigned:19804578 PositiveStrandReadsAssigned:10111028 NegativeStrandReadsAssigned:9999219 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678139-trimmed-pair1.fastq SRR11678139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,661,038 reads, 20,289,958 reads pseudoaligned [quant] estimated average fragment length: 259.151 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds 52401 SRR11678139.ke.tsv 34699 SRR11678139.se.tsv 87100 total ==> SRR11678139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.85 1565 44.7682 Potri.005G024800.1.v4.1 1035 776.849 182 11.7941 Potri.004G059700.1.v4.1 961 702.867 37 2.65008 Potri.007G009000.2.v4.1 1416 1157.85 0 0 Potri.003G141000.2.v4.1 2943 2684.85 385.281 7.22419 Potri.016G087400.1.v4.1 270 62.2222 1102 891.595 Potri.015G069301.1.v4.1 564 307.437 0 0 Potri.010G195200.1.v4.1 1773 1514.85 78 2.59213 Potri.012G127500.1.v4.1 977 718.867 4828 338.104 ==> SRR11678139.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2932 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 499 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR11678139 completed mapping pipeline successfully