Starting /dee2/code/volunteer_pipeline.sh SRR11678140 current disk space = 3051734515712 free memory = 1466446620 SRR11678140 SRAfilesize 21108c40a09b780f719bb4c2ab410b66 SRR11678140.sra SRR11678140.sra file validated SRR11678140 is paired end SRR11678140 is conventional basespace SRR11678140 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9705 37.0 36.0 37.0 33.0 38.0 2 35.131 37.0 36.0 37.0 31.0 38.0 3 35.91175 37.0 36.0 37.0 33.0 38.0 4 35.70475 37.0 36.0 37.0 32.0 38.0 5 35.63375 37.0 36.0 37.0 32.0 38.0 6 35.7455 37.0 36.0 37.0 32.0 38.0 7 35.97825 37.0 36.0 37.0 33.0 38.0 8 35.978 37.0 36.0 37.0 33.0 38.0 9 35.94275 37.0 36.0 37.0 33.0 38.0 10-14 35.804449999999996 37.0 36.0 37.0 32.6 38.0 15-19 35.81955000000001 37.0 36.0 37.0 32.4 38.0 20-24 35.790099999999995 37.0 36.0 37.0 32.6 38.0 25-29 35.7341 37.0 36.0 37.0 32.0 38.0 30-34 35.79350000000001 37.0 36.0 37.0 32.4 38.0 35-39 35.7529 37.0 36.0 37.0 32.2 38.0 40-44 35.68425 37.0 36.0 37.0 32.0 38.0 45-49 35.6838 37.0 36.0 37.0 32.0 38.0 50-54 35.58 37.0 36.0 37.0 31.8 38.0 55-59 35.6296 37.0 36.0 37.0 32.0 38.0 60-64 35.563900000000004 37.0 36.0 37.0 31.6 38.0 65-69 35.570800000000006 37.0 36.0 37.0 31.8 38.0 70-74 35.46325 37.0 36.0 37.0 31.6 38.0 75-79 35.4359 37.0 36.0 37.0 31.2 38.0 80-84 35.4916 37.0 36.0 37.0 31.6 38.0 85-89 35.446299999999994 37.0 36.0 37.0 31.2 38.0 90-94 35.32345 37.0 36.0 37.0 30.8 38.0 95-99 35.221199999999996 37.0 36.0 37.0 30.8 38.0 100-104 35.15325 37.0 35.8 37.0 30.2 38.0 105-109 35.18705 37.0 35.8 37.0 30.0 38.0 110-114 34.937349999999995 37.0 35.0 37.0 29.8 38.0 115-119 35.053700000000006 37.0 35.2 37.0 30.0 38.0 120-124 34.9202 37.0 35.0 37.0 29.6 38.0 125-129 34.884100000000004 37.0 35.0 37.0 29.2 38.0 130-134 34.797399999999996 37.0 35.0 37.0 29.0 38.0 135-139 34.745599999999996 37.0 35.0 37.0 29.0 38.0 140-144 34.5481 37.0 34.8 37.0 28.0 38.0 145-149 34.5268 37.0 34.6 37.0 27.8 38.0 150 34.52225 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 11.0 27 18.0 28 23.0 29 56.0 30 69.0 31 95.0 32 159.0 33 262.0 34 391.0 35 818.0 36 1948.0 37 147.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.6 18.175 13.325000000000001 36.9 2 17.575 23.65 47.375 11.4 3 14.85 26.75 33.4 25.0 4 18.3 35.65 27.725 18.325 5 18.875 35.925000000000004 27.950000000000003 17.25 6 13.850000000000001 35.725 31.275 19.15 7 14.725 14.875 47.55 22.85 8 18.2 21.15 30.525000000000002 30.125 9 19.425 22.625 30.625000000000004 27.325 10-14 20.705000000000002 29.125 27.54 22.63 15-19 21.46 27.529999999999998 29.12 21.89 20-24 21.42 27.935 28.499999999999996 22.145 25-29 21.224999999999998 28.725 28.110000000000003 21.94 30-34 20.82 28.375 28.634999999999998 22.17 35-39 21.165 28.425 28.199999999999996 22.21 40-44 21.45 28.599999999999998 28.59 21.36 45-49 21.17 27.755000000000003 28.185 22.89 50-54 21.279999999999998 28.485 28.410000000000004 21.825 55-59 22.165000000000003 27.744999999999997 28.23 21.86 60-64 21.65 28.63 28.035 21.685 65-69 21.595 28.189999999999998 28.194999999999997 22.02 70-74 21.6 28.015 28.110000000000003 22.275 75-79 21.335 28.449999999999996 27.994999999999997 22.220000000000002 80-84 21.23 28.22 28.63 21.92 85-89 21.345 28.634999999999998 27.965 22.055 90-94 22.21 28.225 27.865000000000002 21.7 95-99 21.481074053702685 27.936396819840994 27.946397319865994 22.636131806590328 100-104 21.822182218221823 28.217821782178216 27.86278627862786 22.097209720972096 105-109 21.7 27.85 28.325 22.125 110-114 21.945 28.33 27.625 22.1 115-119 21.69 27.815 28.425 22.07 120-124 21.651082554127708 28.56642832141607 27.541377068853446 22.24111205560278 125-129 21.84 28.134999999999998 28.285 21.740000000000002 130-134 22.195 27.805000000000003 28.134999999999998 21.865000000000002 135-139 22.065 28.01 28.095 21.83 140-144 22.040000000000003 27.944999999999997 27.91 22.105 145-149 22.36 27.755000000000003 28.07 21.815 150 23.7 26.974999999999998 27.650000000000002 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 2.0 24 4.5 25 7.0 26 8.0 27 15.0 28 23.5 29 25.5 30 27.5 31 34.0 32 40.5 33 48.5 34 60.5 35 80.0 36 97.0 37 109.5 38 139.0 39 178.0 40 196.5 41 217.0 42 256.5 43 282.5 44 273.0 45 256.5 46 244.5 47 240.5 48 229.0 49 196.5 50 166.5 51 125.5 52 96.0 53 79.0 54 58.5 55 47.5 56 34.5 57 21.5 58 18.0 59 12.5 60 9.0 61 8.5 62 4.5 63 4.0 64 4.5 65 3.5 66 2.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTAG 10 0.006973645 144.0 9 ATTCTAT 10 0.006973645 144.0 5 CTTTTGC 20 3.687869E-4 108.0 1 >>END_MODULE SRR11678140 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.285 37.0 36.0 37.0 31.0 38.0 2 34.169 37.0 34.0 37.0 26.0 38.0 3 35.05775 37.0 35.0 37.0 30.0 38.0 4 35.14075 37.0 36.0 37.0 30.0 38.0 5 35.00775 37.0 35.0 37.0 30.0 38.0 6 34.88875 37.0 35.0 37.0 30.0 38.0 7 34.94 37.0 35.0 37.0 30.0 38.0 8 35.07775 37.0 35.0 37.0 30.0 38.0 9 35.1215 37.0 35.0 37.0 30.0 38.0 10-14 35.033649999999994 37.0 35.4 37.0 29.8 38.0 15-19 35.0342 37.0 35.0 37.0 29.8 38.0 20-24 34.981649999999995 37.0 35.0 37.0 29.8 38.0 25-29 34.97240000000001 37.0 35.0 37.0 29.8 38.0 30-34 34.94395 37.0 35.0 37.0 29.6 38.0 35-39 34.928 37.0 35.0 37.0 29.2 38.0 40-44 34.917 37.0 35.0 37.0 29.8 38.0 45-49 34.8444 37.0 35.0 37.0 29.4 38.0 50-54 34.75135 37.0 35.0 37.0 28.8 38.0 55-59 34.72420000000001 37.0 35.0 37.0 29.0 38.0 60-64 34.754149999999996 37.0 35.0 37.0 28.8 38.0 65-69 34.71575000000001 37.0 35.0 37.0 28.8 38.0 70-74 34.64175 37.0 35.0 37.0 28.6 38.0 75-79 34.601749999999996 37.0 35.0 37.0 28.6 38.0 80-84 34.604850000000006 37.0 35.0 37.0 28.4 38.0 85-89 34.5794 37.0 35.0 37.0 28.4 38.0 90-94 34.50505 37.0 34.6 37.0 28.0 38.0 95-99 34.507850000000005 37.0 34.8 37.0 28.0 38.0 100-104 34.441050000000004 37.0 34.4 37.0 28.0 38.0 105-109 34.35635 37.0 34.2 37.0 27.6 38.0 110-114 34.1769 37.0 34.0 37.0 27.0 38.0 115-119 34.08385 37.0 34.0 37.0 26.2 38.0 120-124 34.08055 37.0 34.0 37.0 26.6 38.0 125-129 33.96560000000001 37.0 34.0 37.0 26.2 38.0 130-134 33.8423 37.0 33.6 37.0 25.6 38.0 135-139 33.789750000000005 37.0 33.2 37.0 25.6 38.0 140-144 33.70865 37.0 33.2 37.0 25.2 37.8 145-149 33.5404 37.0 32.8 37.0 24.6 38.0 150 33.692 37.0 33.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 14.0 25 33.0 26 57.0 27 59.0 28 93.0 29 99.0 30 127.0 31 169.0 32 193.0 33 295.0 34 435.0 35 804.0 36 1466.0 37 150.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.349999999999998 18.025 12.875 39.75 2 17.875 24.425 46.175 11.525 3 13.5 26.700000000000003 35.0 24.8 4 18.9 36.05 28.125 16.925 5 19.525000000000002 35.8 27.675 17.0 6 14.2 34.925 31.6 19.275000000000002 7 14.725 14.799999999999999 47.449999999999996 23.025000000000002 8 19.125 20.125 30.375000000000004 30.375000000000004 9 19.575 21.3 31.65 27.474999999999998 10-14 20.549999999999997 28.305000000000003 28.025 23.119999999999997 15-19 20.68 28.265 28.935 22.12 20-24 21.82 28.415000000000003 27.99 21.775 25-29 21.115000000000002 28.93 28.265 21.69 30-34 21.490000000000002 28.315 28.235 21.959999999999997 35-39 21.16 28.82 28.389999999999997 21.63 40-44 21.495 28.53 28.46 21.515 45-49 21.875 28.605000000000004 28.09 21.43 50-54 21.990000000000002 27.62 28.04 22.35 55-59 21.64 28.595 27.534999999999997 22.23 60-64 21.310000000000002 28.720000000000002 28.155 21.815 65-69 21.815 28.095 27.83 22.259999999999998 70-74 22.005 28.449999999999996 27.639999999999997 21.905 75-79 21.935 28.799999999999997 27.49 21.775 80-84 22.075 28.804999999999996 27.38 21.740000000000002 85-89 21.790000000000003 28.74 27.71 21.759999999999998 90-94 22.02 28.305000000000003 28.18 21.495 95-99 21.625 28.865000000000002 27.500000000000004 22.009999999999998 100-104 21.634999999999998 27.83 28.13 22.405 105-109 21.42 28.405 28.335 21.84 110-114 22.21 27.975 27.705000000000002 22.11 115-119 22.12 27.815 27.705000000000002 22.36 120-124 22.005 28.060000000000002 28.07 21.865000000000002 125-129 22.515 28.1 28.225 21.16 130-134 22.81 27.944999999999997 27.79 21.455 135-139 21.95 28.09 27.800000000000004 22.16 140-144 22.075 28.71 27.139999999999997 22.075 145-149 22.685 28.410000000000004 27.12 21.785 150 21.95 29.049999999999997 27.025 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.5 18 1.5 19 0.5 20 1.0 21 2.0 22 3.5 23 7.0 24 7.0 25 6.0 26 10.0 27 14.5 28 15.0 29 19.5 30 29.5 31 35.0 32 41.5 33 57.0 34 73.5 35 83.0 36 96.0 37 113.5 38 139.0 39 166.5 40 188.5 41 225.0 42 261.5 43 266.5 44 257.0 45 249.0 46 246.5 47 238.5 48 222.5 49 189.5 50 160.0 51 131.5 52 105.5 53 94.5 54 62.0 55 34.0 56 22.5 57 20.0 58 21.0 59 18.0 60 14.5 61 10.5 62 8.5 63 7.0 64 4.5 65 5.5 66 4.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089649 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089649 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra Read 1089630 spots for SRR11678140.sra Written 1089630 spots for SRR11678140.sra SRR ids: ['SRR11678140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__3o69a6z SRR11678140.sra spots: 21792619 blocks: [[1, 1089630], [1089631, 2179260], [2179261, 3268890], [3268891, 4358520], [4358521, 5448150], [5448151, 6537780], [6537781, 7627410], [7627411, 8717040], [8717041, 9806670], [9806671, 10896300], [10896301, 11985930], [11985931, 13075560], [13075561, 14165190], [14165191, 15254820], [15254821, 16344450], [16344451, 17434080], [17434081, 18523710], [18523711, 19613340], [19613341, 20702970], [20702971, 21792619]] SRR11678140 file size 7757027 SRR11678140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678140 SRR11678140_1.fastq SRR11678140_2.fastq Input file: SRR11678140_1.fastq Paired file: SRR11678140_2.fastq trimmed: SRR11678140-trimmed-pair1.fastq, SRR11678140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:37:05 2025 >> started Wed Feb 12 17:37:44 2025 >> done (38.887s) 21792619 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21792619 (100.00%) read pairs available; of these: 549992 ( 2.52%) trimmed read pairs available after processing 21242627 (97.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 142 3 0.00% 143 3 0.00% 144 1 0.00% 145 0 0.00% 146 16 0.00% 147 80 0.00% 148 2962 0.01% 149 546927 2.51% 150 21242627 97.48% 21792619 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=47.36 fanout-score-rank=5 prefix-density=0.36 prefix-fanout=22.1 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=217.41 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.9 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=40.49 fanout-score-rank=5 prefix-density=0.35 prefix-fanout=21.2 sequence=AAGTCGGATCGTAGCCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=325.04 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=30.3 sequence=CTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGC SRR11678140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:38:28 Started mapping on | Feb 12 17:38:28 Finished on | Feb 12 17:40:53 Mapping speed, Million of reads per hour | 541.06 Number of input reads | 21792619 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20943132 Uniquely mapped reads % | 96.10% Average mapped length | 298.33 Number of splices: Total | 18858728 Number of splices: Annotated (sjdb) | 18490403 Number of splices: GT/AG | 18560673 Number of splices: GC/AG | 227858 Number of splices: AT/AC | 18723 Number of splices: Non-canonical | 51474 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424023 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 1830 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425464 425464 425464 N_multimapping 424023 424023 424023 N_noFeature 739216 10599973 10921531 N_ambiguous 270055 56016 53870 UnstrandedReadsAssigned:19933861 PositiveStrandReadsAssigned:10287143 NegativeStrandReadsAssigned:9967731 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678140-trimmed-pair1.fastq SRR11678140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,792,619 reads, 20,401,700 reads pseudoaligned [quant] estimated average fragment length: 262.531 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR11678140.ke.tsv 34699 SRR11678140.se.tsv 87100 total ==> SRR11678140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.47 2406 68.7522 Potri.005G024800.1.v4.1 1035 773.469 454 29.4608 Potri.004G059700.1.v4.1 961 699.492 37 2.65492 Potri.007G009000.2.v4.1 1416 1154.47 0 0 Potri.003G141000.2.v4.1 2943 2681.47 511.24 9.56938 Potri.016G087400.1.v4.1 270 59.5478 1060 893.453 Potri.015G069301.1.v4.1 564 303.975 0 0 Potri.010G195200.1.v4.1 1773 1511.47 70.5328 2.3422 Potri.012G127500.1.v4.1 977 715.492 4321 303.118 ==> SRR11678140.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2425 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 521 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR11678140 completed mapping pipeline successfully