Starting /dee2/code/volunteer_pipeline.sh SRR11678141 current disk space = 3051770990592 free memory = 1490196460 SRR11678141 SRAfilesize 2a11adb0b21ed5433e34a9c47036716a SRR11678141.sra SRR11678141.sra file validated SRR11678141 is paired end SRR11678141 is conventional basespace SRR11678141 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.01325 37.0 37.0 37.0 33.0 38.0 2 35.16725 37.0 36.0 37.0 31.0 38.0 3 35.9575 37.0 36.0 37.0 33.0 38.0 4 35.45825 37.0 36.0 37.0 32.0 38.0 5 35.643 37.0 36.0 37.0 32.0 38.0 6 35.792 37.0 36.0 37.0 32.0 38.0 7 35.94375 37.0 36.0 37.0 33.0 38.0 8 35.99425 37.0 36.0 37.0 33.0 38.0 9 35.94625 37.0 36.0 37.0 33.0 38.0 10-14 35.83695 37.0 36.0 37.0 32.6 38.0 15-19 35.84775 37.0 36.0 37.0 32.8 38.0 20-24 35.853 37.0 36.0 37.0 32.8 38.0 25-29 35.823899999999995 37.0 36.0 37.0 32.4 38.0 30-34 35.768100000000004 37.0 36.0 37.0 32.4 38.0 35-39 35.8009 37.0 36.0 37.0 32.6 38.0 40-44 35.7653 37.0 36.0 37.0 32.4 38.0 45-49 35.72385 37.0 36.0 37.0 32.2 38.0 50-54 35.615050000000004 37.0 36.0 37.0 32.0 38.0 55-59 35.706 37.0 36.0 37.0 32.0 38.0 60-64 35.55 37.0 36.0 37.0 31.8 38.0 65-69 35.5791 37.0 36.0 37.0 31.8 38.0 70-74 35.405649999999994 37.0 36.0 37.0 31.4 38.0 75-79 35.39450000000001 37.0 36.0 37.0 31.4 38.0 80-84 35.4836 37.0 36.0 37.0 31.4 38.0 85-89 35.47315 37.0 36.0 37.0 31.2 38.0 90-94 35.3414 37.0 36.0 37.0 30.8 38.0 95-99 35.15575 37.0 36.0 37.0 30.6 38.0 100-104 35.1214 37.0 36.0 37.0 30.2 38.0 105-109 35.27735 37.0 36.0 37.0 30.8 38.0 110-114 34.88465 37.0 35.0 37.0 29.6 38.0 115-119 35.12555 37.0 35.2 37.0 29.8 38.0 120-124 34.8134 37.0 35.0 37.0 28.8 38.0 125-129 34.82125 37.0 35.0 37.0 29.4 38.0 130-134 34.86835 37.0 35.0 37.0 29.6 38.0 135-139 34.806 37.0 35.0 37.0 29.0 38.0 140-144 34.617200000000004 37.0 35.0 37.0 28.4 38.0 145-149 34.59915 37.0 34.6 37.0 28.2 38.0 150 34.545 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 13.0 27 20.0 28 31.0 29 37.0 30 72.0 31 91.0 32 158.0 33 228.0 34 404.0 35 855.0 36 1935.0 37 152.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.974999999999998 18.625 11.825 37.574999999999996 2 18.15 23.674999999999997 46.45 11.725 3 14.45 27.05 33.525 24.975 4 18.625 38.45 26.275 16.650000000000002 5 19.925 37.35 26.85 15.875 6 15.375 34.65 31.0 18.975 7 14.674999999999999 13.875000000000002 49.325 22.125 8 18.099999999999998 21.525 30.8 29.575000000000003 9 21.05 22.3 29.175 27.474999999999998 10-14 20.84 28.865000000000002 27.955000000000002 22.34 15-19 20.810000000000002 28.470000000000002 28.415000000000003 22.305 20-24 21.07 28.27 28.605000000000004 22.055 25-29 21.245 29.03 28.34 21.385 30-34 21.055 28.610000000000003 28.37 21.965 35-39 21.14 28.410000000000004 28.255000000000003 22.195 40-44 21.615000000000002 28.28 28.555000000000003 21.55 45-49 21.38 28.694999999999997 28.4 21.525 50-54 21.115000000000002 28.73 28.244999999999997 21.91 55-59 22.1 28.665000000000003 27.57 21.665 60-64 21.16 28.645 27.860000000000003 22.335 65-69 21.965 28.4 28.01 21.625 70-74 22.205 28.74 27.605 21.45 75-79 22.41 28.01 28.189999999999998 21.39 80-84 22.115000000000002 28.235 28.005000000000003 21.645 85-89 22.66 28.17 27.865000000000002 21.305 90-94 22.3 28.01 27.97 21.72 95-99 22.025 28.16 27.99 21.825 100-104 21.965 28.27 27.755000000000003 22.009999999999998 105-109 21.69 29.315 27.725 21.27 110-114 21.584999999999997 28.77 27.725 21.92 115-119 22.395 28.389999999999997 27.845 21.37 120-124 22.365 27.985 27.860000000000003 21.790000000000003 125-129 22.650000000000002 28.000000000000004 28.09 21.26 130-134 22.61 28.360000000000003 27.584999999999997 21.445 135-139 22.145 27.405 29.01 21.44 140-144 22.24611230561528 28.581429071453574 27.796389819490976 21.37606880344017 145-149 22.08 28.26 27.71 21.95 150 21.975 27.700000000000003 28.549999999999997 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 1.5 21 3.5 22 3.5 23 2.0 24 3.0 25 5.0 26 5.5 27 13.5 28 20.5 29 19.0 30 21.0 31 26.5 32 36.0 33 51.0 34 69.0 35 86.0 36 94.0 37 113.5 38 142.5 39 174.0 40 210.5 41 236.0 42 262.0 43 279.5 44 276.0 45 262.5 46 255.5 47 236.0 48 207.5 49 178.0 50 151.5 51 144.0 52 111.0 53 81.0 54 56.5 55 33.5 56 35.5 57 27.0 58 17.5 59 13.5 60 8.5 61 4.5 62 3.5 63 4.5 64 3.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTGG 10 0.006973645 144.0 9 >>END_MODULE SRR11678141 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0415 37.0 35.0 37.0 30.0 37.0 2 33.73825 37.0 34.0 37.0 25.0 37.0 3 34.89025 37.0 35.0 37.0 29.0 37.0 4 34.68175 37.0 35.0 37.0 29.0 37.0 5 34.76425 37.0 35.0 37.0 29.0 37.0 6 34.27825 37.0 35.0 37.0 27.0 37.0 7 34.59225 37.0 35.0 37.0 29.0 37.0 8 34.80075 37.0 35.0 37.0 29.0 37.0 9 34.9215 37.0 35.0 37.0 29.0 37.0 10-14 34.73685 37.0 35.0 37.0 29.0 37.0 15-19 34.69825000000001 37.0 35.0 37.0 29.0 37.0 20-24 34.773199999999996 37.0 35.0 37.0 29.0 37.0 25-29 34.6757 37.0 35.0 37.0 28.8 37.0 30-34 34.68385 37.0 35.0 37.0 28.8 37.2 35-39 34.66555 37.0 35.0 37.0 28.8 37.4 40-44 34.585150000000006 37.0 35.0 37.0 28.4 37.2 45-49 34.5758 37.0 35.0 37.0 28.6 37.0 50-54 34.5817 37.0 35.0 37.0 28.0 37.6 55-59 34.5136 37.0 34.4 37.0 28.2 37.8 60-64 34.4777 37.0 34.4 37.0 27.8 37.6 65-69 34.46915 37.0 34.2 37.0 28.0 37.6 70-74 34.35955 37.0 34.0 37.0 27.6 37.6 75-79 34.2899 37.0 34.0 37.0 27.2 37.8 80-84 34.304899999999996 37.0 34.0 37.0 27.8 37.6 85-89 34.1461 37.0 34.0 37.0 26.8 37.6 90-94 34.076350000000005 37.0 34.0 37.0 26.2 37.4 95-99 34.058749999999996 37.0 33.8 37.0 26.6 37.6 100-104 33.873200000000004 37.0 33.4 37.0 26.2 37.4 105-109 33.8363 37.0 33.4 37.0 25.8 37.4 110-114 33.78945 37.0 33.2 37.0 25.4 37.4 115-119 33.620149999999995 36.8 33.0 37.0 25.4 37.0 120-124 33.557500000000005 36.4 33.0 37.0 25.2 37.4 125-129 33.484 36.2 33.0 37.0 24.8 37.0 130-134 33.34925 36.0 32.6 37.0 24.2 37.2 135-139 33.10845 36.0 32.0 37.0 23.4 37.0 140-144 33.0448 36.0 32.0 37.0 23.0 37.0 145-149 32.802499999999995 36.0 31.2 37.0 22.6 37.0 150 32.6105 36.0 31.0 37.0 22.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 10.0 24 20.0 25 50.0 26 74.0 27 89.0 28 92.0 29 115.0 30 158.0 31 186.0 32 237.0 33 323.0 34 494.0 35 791.0 36 1243.0 37 115.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.849999999999998 19.475 12.6 38.074999999999996 2 18.0 25.324999999999996 45.525 11.15 3 14.674999999999999 27.400000000000002 32.5 25.424999999999997 4 18.65 36.625 27.3 17.424999999999997 5 18.8 36.8 27.375 17.025000000000002 6 13.875000000000002 35.55 31.974999999999998 18.6 7 14.224999999999998 15.775 46.2 23.799999999999997 8 17.65 19.950000000000003 31.65 30.75 9 20.3 22.025 29.275000000000002 28.4 10-14 19.950000000000003 29.285 27.765 23.0 15-19 21.01 28.335 28.29 22.365 20-24 20.580000000000002 28.88 27.97 22.57 25-29 20.48 28.970000000000002 28.22 22.33 30-34 21.18 28.155 28.29 22.375 35-39 20.495 28.349999999999998 28.65 22.505 40-44 21.015 28.48 28.065 22.439999999999998 45-49 21.6 28.904999999999998 27.245 22.25 50-54 21.13 28.439999999999998 27.87 22.56 55-59 21.345 28.57 27.975 22.11 60-64 20.9 28.83 27.88 22.39 65-69 21.535 29.5 27.185 21.78 70-74 21.195 28.7 28.065 22.040000000000003 75-79 21.485000000000003 28.485 27.689999999999998 22.34 80-84 21.6 28.225 27.889999999999997 22.285 85-89 21.83 28.48 27.985 21.705 90-94 21.245 28.87 27.49 22.395 95-99 21.12605630281514 27.971398569928496 28.24641232061603 22.656132806640333 100-104 21.55 28.895 27.815 21.740000000000002 105-109 21.83 28.16 27.91 22.1 110-114 21.7 28.000000000000004 28.084999999999997 22.215 115-119 21.94 28.125 28.24 21.695 120-124 21.345 27.685 28.26 22.71 125-129 21.240000000000002 27.85 28.494999999999997 22.415 130-134 21.955 27.655 28.199999999999996 22.189999999999998 135-139 22.015 27.705000000000002 28.185 22.095000000000002 140-144 22.06 27.439999999999998 28.375 22.125 145-149 22.009999999999998 28.7 27.284999999999997 22.005 150 21.875 28.825 27.1 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.0 21 1.5 22 3.0 23 5.0 24 6.5 25 6.0 26 8.5 27 12.5 28 18.0 29 20.5 30 24.0 31 34.5 32 40.0 33 51.0 34 70.0 35 79.0 36 92.5 37 119.5 38 142.5 39 173.5 40 204.0 41 233.5 42 249.0 43 258.5 44 273.0 45 272.5 46 252.0 47 229.5 48 231.5 49 202.0 50 146.0 51 127.5 52 101.0 53 73.0 54 68.5 55 47.0 56 29.5 57 27.0 58 19.5 59 10.5 60 7.5 61 6.5 62 4.5 63 2.5 64 2.0 65 0.5 66 1.0 67 2.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATAG 10 0.006973645 144.0 3 GATAGTA 10 0.006973645 144.0 5 AGATAGT 15 1.1730364E-4 144.0 4 >>END_MODULE Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra Read 1088244 spots for SRR11678141.sra Written 1088244 spots for SRR11678141.sra Read 1088237 spots for SRR11678141.sra Written 1088237 spots for SRR11678141.sra SRR ids: ['SRR11678141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5yw5eo7v SRR11678141.sra spots: 21764747 blocks: [[1, 1088237], [1088238, 2176474], [2176475, 3264711], [3264712, 4352948], [4352949, 5441185], [5441186, 6529422], [6529423, 7617659], [7617660, 8705896], [8705897, 9794133], [9794134, 10882370], [10882371, 11970607], [11970608, 13058844], [13058845, 14147081], [14147082, 15235318], [15235319, 16323555], [16323556, 17411792], [17411793, 18500029], [18500030, 19588266], [19588267, 20676503], [20676504, 21764747]] SRR11678141 file size 7747092 SRR11678141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678141 SRR11678141_1.fastq SRR11678141_2.fastq Input file: SRR11678141_1.fastq Paired file: SRR11678141_2.fastq trimmed: SRR11678141-trimmed-pair1.fastq, SRR11678141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:32:49 2025 >> started Wed Feb 12 17:33:15 2025 >> done (25.250s) 21764747 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21764747 (100.00%) read pairs available; of these: 570413 ( 2.62%) trimmed read pairs available after processing 21194334 (97.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 1 0.00% 142 3 0.00% 143 2 0.00% 144 2 0.00% 145 3 0.00% 146 10 0.00% 147 108 0.00% 148 3222 0.01% 149 567062 2.61% 150 21194334 97.38% 21764747 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=35.18 fanout-score-rank=10 prefix-density=0.30 prefix-fanout=18.4 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=255.18 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=16.7 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=37.30 fanout-score-rank=7 prefix-density=0.32 prefix-fanout=20.3 sequence=AAGTCGGATCGTAGCCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=214.72 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=17.1 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA SRR11678141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:34:24 Started mapping on | Feb 12 17:34:24 Finished on | Feb 12 17:35:59 Mapping speed, Million of reads per hour | 824.77 Number of input reads | 21764747 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20753179 Uniquely mapped reads % | 95.35% Average mapped length | 294.38 Number of splices: Total | 18048942 Number of splices: Annotated (sjdb) | 17695093 Number of splices: GT/AG | 17763689 Number of splices: GC/AG | 217826 Number of splices: AT/AC | 17934 Number of splices: Non-canonical | 49493 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414521 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 1554 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597047 597047 597047 N_multimapping 414521 414521 414521 N_noFeature 764917 10432543 10922518 N_ambiguous 280807 61626 56829 UnstrandedReadsAssigned:19707455 PositiveStrandReadsAssigned:10259010 NegativeStrandReadsAssigned:9773832 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678141-trimmed-pair1.fastq SRR11678141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,764,747 reads, 20,321,813 reads pseudoaligned [quant] estimated average fragment length: 260.841 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR11678141.ke.tsv 34699 SRR11678141.se.tsv 87100 total ==> SRR11678141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.16 3367 96.9588 Potri.005G024800.1.v4.1 1035 775.159 414 27.0403 Potri.004G059700.1.v4.1 961 701.159 48 3.46599 Potri.007G009000.2.v4.1 1416 1156.16 0 0 Potri.003G141000.2.v4.1 2943 2683.16 458.658 8.65455 Potri.016G087400.1.v4.1 270 60.5995 893 746.079 Potri.015G069301.1.v4.1 564 305.637 0 0 Potri.010G195200.1.v4.1 1773 1513.16 66 2.20832 Potri.012G127500.1.v4.1 977 717.159 4196 296.226 ==> SRR11678141.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2119 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 554 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR11678141 completed mapping pipeline successfully