Starting /dee2/code/volunteer_pipeline.sh SRR11678142 current disk space = 3051734704128 free memory = 998744792 SRR11678142 SRAfilesize dc628f1e95da0c403d06f4e2f4699a30 SRR11678142.sra SRR11678142.sra file validated SRR11678142 is paired end SRR11678142 is conventional basespace SRR11678142 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03525 37.0 37.0 37.0 33.0 38.0 2 35.16425 37.0 36.0 37.0 30.0 38.0 3 35.9295 37.0 36.0 37.0 32.0 38.0 4 35.972 37.0 36.0 37.0 33.0 38.0 5 35.8295 37.0 36.0 37.0 32.0 38.0 6 35.8475 37.0 36.0 37.0 33.0 38.0 7 35.91675 37.0 36.0 37.0 33.0 38.0 8 36.0785 37.0 36.0 37.0 33.0 38.0 9 35.971 37.0 36.0 37.0 33.0 38.0 10-14 35.9848 37.0 36.0 37.0 33.0 38.0 15-19 35.898050000000005 37.0 36.0 37.0 32.8 38.0 20-24 35.8783 37.0 36.0 37.0 32.8 38.0 25-29 35.8964 37.0 36.0 37.0 32.8 38.0 30-34 35.83195 37.0 36.0 37.0 32.8 38.0 35-39 35.87235 37.0 36.0 37.0 32.8 38.0 40-44 35.83635 37.0 36.0 37.0 32.8 38.0 45-49 35.7712 37.0 36.0 37.0 32.6 38.0 50-54 35.7264 37.0 36.0 37.0 32.0 38.0 55-59 35.773649999999996 37.0 36.0 37.0 32.2 38.0 60-64 35.73105 37.0 36.0 37.0 32.0 38.0 65-69 35.700649999999996 37.0 36.0 37.0 32.0 38.0 70-74 35.669200000000004 37.0 36.0 37.0 31.8 38.0 75-79 35.62595 37.0 36.0 37.0 31.8 38.0 80-84 35.590250000000005 37.0 36.0 37.0 32.0 38.0 85-89 35.55625 37.0 36.0 37.0 31.6 38.0 90-94 35.55544999999999 37.0 36.0 37.0 31.6 38.0 95-99 35.5351 37.0 36.0 37.0 31.6 38.0 100-104 35.4242 37.0 36.0 37.0 31.2 38.0 105-109 35.4014 37.0 36.0 37.0 31.0 38.0 110-114 35.345150000000004 37.0 36.0 37.0 30.8 38.0 115-119 35.273250000000004 37.0 35.8 37.0 30.8 38.0 120-124 35.1856 37.0 35.6 37.0 30.4 38.0 125-129 35.164699999999996 37.0 35.6 37.0 30.2 38.0 130-134 35.023450000000004 37.0 35.0 37.0 30.0 38.0 135-139 34.943349999999995 37.0 35.0 37.0 29.6 38.0 140-144 34.9193 37.0 35.0 37.0 29.6 38.0 145-149 34.81045 37.0 35.0 37.0 29.0 38.0 150 34.76725 37.0 35.0 37.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 5.0 27 21.0 28 18.0 29 36.0 30 58.0 31 95.0 32 145.0 33 195.0 34 372.0 35 747.0 36 2087.0 37 218.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.975 18.175 11.3 39.550000000000004 2 17.45 24.7 46.925 10.925 3 13.475000000000001 27.325 33.900000000000006 25.3 4 17.599999999999998 36.85 27.500000000000004 18.05 5 18.5 36.9 27.650000000000002 16.950000000000003 6 14.674999999999999 35.8 30.3 19.225 7 14.124999999999998 15.6 48.675000000000004 21.6 8 19.75 19.925 29.725 30.599999999999998 9 19.6 23.075000000000003 30.45 26.875 10-14 20.19 29.099999999999998 27.634999999999998 23.075000000000003 15-19 20.945 28.62 28.435 22.0 20-24 20.849999999999998 28.505000000000003 27.975 22.67 25-29 21.07 29.235 27.985 21.709999999999997 30-34 21.365000000000002 28.199999999999996 27.900000000000002 22.535 35-39 21.34 28.634999999999998 27.66 22.365 40-44 21.745 28.23 27.975 22.05 45-49 20.77 28.575 27.925 22.73 50-54 21.335 28.46 27.675 22.53 55-59 21.529999999999998 28.575 27.455000000000002 22.439999999999998 60-64 20.82 28.965000000000003 27.644999999999996 22.57 65-69 22.0 28.065 28.389999999999997 21.545 70-74 21.685 28.384999999999998 27.584999999999997 22.345000000000002 75-79 21.404999999999998 28.43 27.935 22.23 80-84 21.240000000000002 27.794999999999998 28.32 22.645 85-89 21.85 27.49 28.155 22.505 90-94 21.735 28.345 28.16 21.759999999999998 95-99 21.275 28.73 27.345000000000002 22.650000000000002 100-104 21.85 28.155 28.225 21.77 105-109 21.58 28.58 27.76 22.08 110-114 21.775 28.02 27.515 22.689999999999998 115-119 21.775 28.09 28.000000000000004 22.134999999999998 120-124 21.675 28.34 27.93 22.055 125-129 21.935 27.785 27.860000000000003 22.42 130-134 21.975 28.62 27.68 21.725 135-139 21.905 28.18 28.275 21.64 140-144 21.97 27.334999999999997 28.54 22.155 145-149 22.395 27.894999999999996 28.17 21.54 150 22.475 28.075 27.750000000000004 21.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.5 19 2.0 20 2.5 21 2.5 22 3.5 23 2.5 24 4.5 25 11.0 26 15.5 27 12.0 28 11.5 29 18.5 30 22.0 31 26.5 32 40.5 33 50.0 34 51.0 35 67.0 36 89.5 37 114.5 38 126.0 39 150.0 40 199.0 41 249.0 42 272.5 43 268.5 44 283.0 45 292.0 46 259.5 47 230.0 48 220.0 49 191.5 50 164.5 51 136.5 52 98.5 53 74.5 54 59.0 55 46.0 56 34.0 57 26.5 58 20.0 59 12.0 60 11.0 61 8.0 62 4.5 63 2.0 64 3.5 65 3.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83662114314619 97.7 2 1.163378856853819 2.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.006139246 28.8 140-144 >>END_MODULE SRR11678142 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11678142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1645 37.0 35.0 37.0 30.0 38.0 2 34.279 37.0 35.0 37.0 27.0 37.0 3 35.0905 37.0 36.0 37.0 30.0 38.0 4 35.2365 37.0 35.0 37.0 31.0 38.0 5 35.113 37.0 36.0 37.0 30.0 38.0 6 35.119 37.0 36.0 37.0 30.0 38.0 7 35.03975 37.0 35.0 37.0 30.0 37.0 8 35.275 37.0 36.0 37.0 31.0 38.0 9 35.31 37.0 36.0 37.0 31.0 38.0 10-14 35.14775000000001 37.0 35.8 37.0 30.0 38.0 15-19 35.14385 37.0 35.8 37.0 30.0 38.0 20-24 35.11854999999999 37.0 35.4 37.0 30.2 37.8 25-29 35.1152 37.0 35.0 37.0 30.0 38.0 30-34 35.1177 37.0 35.2 37.0 30.2 38.0 35-39 35.0419 37.0 35.2 37.0 29.8 38.0 40-44 35.0695 37.0 35.4 37.0 30.0 38.0 45-49 35.00345 37.0 35.0 37.0 29.8 38.0 50-54 34.986149999999995 37.0 35.0 37.0 29.4 38.0 55-59 34.9916 37.0 35.0 37.0 30.0 38.0 60-64 34.980650000000004 37.0 35.0 37.0 30.0 38.0 65-69 34.92045 37.0 35.0 37.0 29.6 38.0 70-74 34.8806 37.0 35.0 37.0 29.2 38.0 75-79 34.861599999999996 37.0 35.0 37.0 29.0 38.0 80-84 34.8312 37.0 35.0 37.0 29.0 38.0 85-89 34.76665 37.0 35.0 37.0 29.0 38.0 90-94 34.75665000000001 37.0 35.0 37.0 29.0 38.0 95-99 34.69665 37.0 35.0 37.0 28.4 38.0 100-104 34.61505 37.0 35.0 37.0 28.6 38.0 105-109 34.5672 37.0 34.8 37.0 28.2 38.0 110-114 34.49555 37.0 34.6 37.0 28.0 38.0 115-119 34.4101 37.0 34.2 37.0 27.6 38.0 120-124 34.378299999999996 37.0 34.0 37.0 27.8 38.0 125-129 34.23225 37.0 34.0 37.0 27.0 38.0 130-134 34.1793 37.0 34.0 37.0 27.2 38.0 135-139 33.993849999999995 37.0 33.4 37.0 26.2 38.0 140-144 33.94615 37.0 33.8 37.0 26.0 38.0 145-149 33.884100000000004 37.0 33.6 37.0 25.8 38.0 150 34.06275 37.0 34.0 37.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 6.0 24 21.0 25 44.0 26 41.0 27 61.0 28 77.0 29 72.0 30 119.0 31 132.0 32 180.0 33 256.0 34 365.0 35 772.0 36 1641.0 37 211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.374999999999996 18.475 11.375 38.775 2 18.35 24.95 45.5 11.200000000000001 3 13.4 27.500000000000004 34.475 24.625 4 17.775 36.0 28.65 17.575 5 19.3 35.025 28.675 17.0 6 15.15 33.4 32.175 19.275000000000002 7 14.875 14.499999999999998 46.9 23.724999999999998 8 19.950000000000003 21.05 28.199999999999996 30.8 9 19.0 23.225 32.0 25.775 10-14 20.3 28.405 28.07 23.225 15-19 21.13 28.244999999999997 28.360000000000003 22.264999999999997 20-24 21.565 28.435 28.235 21.765 25-29 20.925 28.63 28.095 22.35 30-34 21.205 28.03 28.29 22.475 35-39 21.15 28.215 28.515 22.12 40-44 21.475 27.965 28.04 22.52 45-49 21.66 28.15 28.01 22.18 50-54 21.475 29.110000000000003 27.57 21.845 55-59 21.775 28.33 27.92 21.975 60-64 21.69 27.900000000000002 28.46 21.95 65-69 21.565 27.805000000000003 28.310000000000002 22.32 70-74 21.475 28.675 27.6 22.25 75-79 21.67 28.52 27.82 21.990000000000002 80-84 21.545 28.875 27.525 22.055 85-89 22.175 28.835 27.465 21.525 90-94 22.09 28.435 27.425 22.05 95-99 22.025 28.375 28.04 21.560000000000002 100-104 21.790000000000003 28.51 27.689999999999998 22.009999999999998 105-109 21.795 28.015 28.015 22.175 110-114 21.584999999999997 28.405 28.294999999999998 21.715 115-119 22.134999999999998 28.139999999999997 27.785 21.94 120-124 22.055 28.23 27.689999999999998 22.025 125-129 22.065 28.395 27.400000000000002 22.14 130-134 22.475 28.4 27.655 21.47 135-139 22.485 27.235 28.28 22.0 140-144 22.29 27.439999999999998 28.595 21.675 145-149 22.185 27.894999999999996 28.395 21.525 150 22.525000000000002 27.224999999999998 28.349999999999998 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 3.0 23 4.5 24 5.5 25 9.5 26 10.0 27 13.0 28 17.0 29 19.5 30 24.5 31 32.5 32 38.0 33 47.0 34 66.0 35 79.5 36 96.0 37 113.0 38 131.0 39 166.5 40 194.0 41 210.0 42 241.0 43 257.0 44 283.0 45 282.0 46 251.0 47 251.5 48 230.5 49 200.0 50 164.0 51 131.0 52 116.0 53 87.0 54 61.0 55 46.5 56 26.0 57 19.5 58 19.0 59 12.5 60 10.0 61 7.0 62 6.5 63 4.5 64 3.5 65 2.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78481012658227 97.55 2 1.1645569620253164 2.3 3 0.05063291139240507 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAAT 10 0.006973645 144.0 5 TTGCATA 10 0.006973645 144.0 2 >>END_MODULE Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089876 spots for SRR11678142.sra Written 1089876 spots for SRR11678142.sra Read 1089894 spots for SRR11678142.sra Written 1089894 spots for SRR11678142.sra SRR ids: ['SRR11678142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eq1qye_m SRR11678142.sra spots: 21797538 blocks: [[1, 1089876], [1089877, 2179752], [2179753, 3269628], [3269629, 4359504], [4359505, 5449380], [5449381, 6539256], [6539257, 7629132], [7629133, 8719008], [8719009, 9808884], [9808885, 10898760], [10898761, 11988636], [11988637, 13078512], [13078513, 14168388], [14168389, 15258264], [15258265, 16348140], [16348141, 17438016], [17438017, 18527892], [18527893, 19617768], [19617769, 20707644], [20707645, 21797538]] SRR11678142 file size 7758780 SRR11678142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11678142 SRR11678142_1.fastq SRR11678142_2.fastq Input file: SRR11678142_1.fastq Paired file: SRR11678142_2.fastq trimmed: SRR11678142-trimmed-pair1.fastq, SRR11678142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:39:26 2025 >> started Wed Feb 12 17:39:57 2025 >> done (30.830s) 21797538 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21797538 (100.00%) read pairs available; of these: 527872 ( 2.42%) trimmed read pairs available after processing 21269666 (97.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 1 0.00% 141 0 0.00% 142 3 0.00% 143 3 0.00% 144 2 0.00% 145 3 0.00% 146 14 0.00% 147 71 0.00% 148 2883 0.01% 149 524892 2.41% 150 21269666 97.58% 21797538 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=45.00 fanout-score-rank=7 prefix-density=0.38 prefix-fanout=21.1 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=204.68 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=16.1 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=41.94 fanout-score-rank=4 prefix-density=0.38 prefix-fanout=21.7 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=166.11 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=21.1 sequence=GCAGCAGCAGCAA SRR11678142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:40:48 Started mapping on | Feb 12 17:40:48 Finished on | Feb 12 17:42:57 Mapping speed, Million of reads per hour | 608.30 Number of input reads | 21797538 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20917641 Uniquely mapped reads % | 95.96% Average mapped length | 298.39 Number of splices: Total | 19004758 Number of splices: Annotated (sjdb) | 18637276 Number of splices: GT/AG | 18706184 Number of splices: GC/AG | 230655 Number of splices: AT/AC | 18543 Number of splices: Non-canonical | 49376 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416577 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 1810 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463320 463320 463320 N_multimapping 416577 416577 416577 N_noFeature 745306 10543700 10959917 N_ambiguous 271043 58168 54249 UnstrandedReadsAssigned:19901292 PositiveStrandReadsAssigned:10315773 NegativeStrandReadsAssigned:9903475 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11678142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11678142-trimmed-pair1.fastq SRR11678142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,797,538 reads, 20,359,147 reads pseudoaligned [quant] estimated average fragment length: 266.035 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR11678142.ke.tsv 34699 SRR11678142.se.tsv 87100 total ==> SRR11678142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.97 2342 67.3672 Potri.005G024800.1.v4.1 1035 769.965 469 30.714 Potri.004G059700.1.v4.1 961 695.965 54 3.91238 Potri.007G009000.2.v4.1 1416 1150.97 0 0 Potri.003G141000.2.v4.1 2943 2677.97 490.316 9.23221 Potri.016G087400.1.v4.1 270 59.4679 988 837.74 Potri.015G069301.1.v4.1 564 300.929 0 0 Potri.010G195200.1.v4.1 1773 1507.97 66 2.20692 Potri.012G127500.1.v4.1 977 711.965 4244 300.574 ==> SRR11678142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2402 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 537 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR11678142 completed mapping pipeline successfully