Starting /dee2/code/volunteer_pipeline.sh SRR11701742 current disk space = 3050729201664 free memory = 1568678772 SRR11701742 SRAfilesize 22c9b0ae8f956657225b253f497a6642 SRR11701742.sra SRR11701742.sra file validated SRR11701742 is paired end SRR11701742 is conventional basespace SRR11701742 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701742_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.78625 32.0 32.0 32.0 32.0 32.0 2 31.7925 32.0 32.0 32.0 32.0 32.0 3 35.995 37.0 37.0 37.0 32.0 37.0 4 36.34375 37.0 37.0 37.0 37.0 37.0 5 36.31125 37.0 37.0 37.0 37.0 37.0 6 39.5645 41.0 41.0 41.0 37.0 41.0 7 39.737 41.0 41.0 41.0 37.0 41.0 8 39.66 41.0 41.0 41.0 37.0 41.0 9 39.9625 41.0 41.0 41.0 37.0 41.0 10-14 39.69625 41.0 41.0 41.0 37.0 41.0 15-19 39.55005 41.0 41.0 41.0 37.0 41.0 20-24 39.5772 41.0 41.0 41.0 37.0 41.0 25-29 39.33645 41.0 41.0 41.0 37.0 41.0 30-34 39.09305 41.0 41.0 41.0 35.0 41.0 35-39 39.763850000000005 41.0 41.0 41.0 37.0 41.0 40-44 39.845800000000004 41.0 41.0 41.0 37.0 41.0 45-49 40.2081 41.0 41.0 41.0 38.6 41.0 50-54 40.11685 41.0 41.0 41.0 37.0 41.0 55-59 40.115449999999996 41.0 41.0 41.0 37.0 41.0 60-64 39.923899999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.9751 41.0 41.0 41.0 37.0 41.0 70-74 40.04415 41.0 41.0 41.0 37.0 41.0 75-79 39.66275 41.0 41.0 41.0 37.0 41.0 80-84 39.53035 41.0 41.0 41.0 36.0 41.0 85-89 39.7239 41.0 41.0 41.0 37.0 41.0 90-94 39.6875 41.0 41.0 41.0 37.0 41.0 95-99 39.73389999999999 41.0 41.0 41.0 37.0 41.0 100-104 39.5564 41.0 41.0 41.0 37.0 41.0 105-109 39.6729 41.0 41.0 41.0 37.0 41.0 110-114 39.313700000000004 41.0 41.0 41.0 36.0 41.0 115-119 39.609350000000006 41.0 41.0 41.0 37.0 41.0 120-124 39.6635 41.0 41.0 41.0 37.0 41.0 125-129 39.17685 41.0 41.0 41.0 35.0 41.0 130-134 39.12385 41.0 41.0 41.0 35.0 41.0 135-139 38.729499999999994 41.0 39.4 41.0 34.0 41.0 140-144 38.62605 41.0 37.8 41.0 33.0 41.0 145-149 37.99145 41.0 37.0 41.0 31.0 41.0 150 38.251 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 1.0 29 8.0 30 20.0 31 21.0 32 35.0 33 51.0 34 71.0 35 119.0 36 176.0 37 243.0 38 319.0 39 609.0 40 2326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75 15.950000000000001 14.725 35.575 2 27.650000000000002 23.875 29.675 18.8 3 23.599999999999998 28.999999999999996 23.825 23.575 4 24.05 34.775 20.625 20.549999999999997 5 24.6 38.0 20.45 16.950000000000003 6 17.125 38.975 23.549999999999997 20.349999999999998 7 17.575 17.95 42.85 21.625 8 19.55 22.725 28.875 28.849999999999998 9 17.224999999999998 22.7 32.824999999999996 27.250000000000004 10-14 21.43 28.83 27.245 22.495 15-19 21.43 27.725 28.215 22.63 20-24 21.67 29.265 26.965 22.1 25-29 21.15 29.215000000000003 27.205000000000002 22.43 30-34 21.705 28.470000000000002 27.48 22.345000000000002 35-39 21.845 28.425 27.67 22.06 40-44 21.62 28.725 27.985 21.67 45-49 21.69 28.315 27.189999999999998 22.805 50-54 21.795 28.689999999999998 27.155 22.36 55-59 21.29 28.955 26.745 23.01 60-64 21.54 28.57 27.435 22.455 65-69 21.529999999999998 28.705000000000002 27.189999999999998 22.575 70-74 21.59 28.98 27.345000000000002 22.085 75-79 21.765 28.37 27.284999999999997 22.58 80-84 21.044999999999998 28.82 27.815 22.32 85-89 21.990000000000002 29.104999999999997 26.805 22.1 90-94 21.55 28.535 27.615000000000002 22.3 95-99 22.655 27.639999999999997 27.32 22.384999999999998 100-104 22.52 27.644999999999996 27.735 22.1 105-109 21.69 27.800000000000004 28.205000000000002 22.305 110-114 21.95 28.165000000000003 28.225 21.66 115-119 22.21 28.34 27.625 21.825 120-124 22.115000000000002 27.6 27.529999999999998 22.755 125-129 22.09 27.85 28.084999999999997 21.975 130-134 22.54 27.345000000000002 28.015 22.1 135-139 22.705000000000002 27.565 28.15 21.58 140-144 22.37 27.525 28.22 21.884999999999998 145-149 22.66 27.85 28.310000000000002 21.18 150 22.575 27.075 27.474999999999998 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 0.5 23 1.0 24 3.5 25 3.5 26 3.5 27 8.5 28 9.5 29 12.5 30 20.5 31 32.5 32 33.5 33 43.0 34 70.5 35 79.5 36 83.0 37 101.5 38 124.5 39 158.5 40 198.0 41 214.5 42 233.5 43 246.5 44 243.0 45 262.5 46 267.0 47 236.5 48 221.0 49 209.0 50 184.5 51 145.5 52 116.0 53 103.5 54 80.0 55 56.5 56 41.0 57 29.0 58 25.5 59 22.0 60 15.0 61 11.5 62 8.0 63 8.5 64 8.0 65 6.0 66 4.0 67 2.5 68 2.0 69 2.0 70 1.0 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.25059039622147 90.75 2 4.618210443453162 8.799999999999999 3 0.10495932826029913 0.3 4 0.0 0.0 5 0.0 0.0 6 0.026239832065074783 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.075 0.0 0.0 0.0 0.0 136-137 0.36250000000000004 0.0 0.0 0.0 0.0 138 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATC 10 0.006973645 144.0 2 TGGAGGT 10 0.006973645 144.0 3 >>END_MODULE SRR11701742 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701742_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.665 32.0 32.0 32.0 32.0 32.0 2 31.61125 32.0 32.0 32.0 32.0 32.0 3 35.12875 37.0 37.0 37.0 32.0 37.0 4 36.395 37.0 37.0 37.0 37.0 37.0 5 36.52875 37.0 37.0 37.0 37.0 37.0 6 40.0565 41.0 41.0 41.0 37.0 41.0 7 39.7645 41.0 41.0 41.0 37.0 41.0 8 40.19575 41.0 41.0 41.0 37.0 41.0 9 39.96875 41.0 41.0 41.0 37.0 41.0 10-14 40.27765 41.0 41.0 41.0 39.4 41.0 15-19 39.7789 41.0 41.0 41.0 37.0 41.0 20-24 40.03465 41.0 41.0 41.0 37.0 41.0 25-29 39.9072 41.0 41.0 41.0 37.0 41.0 30-34 39.884100000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.91705 41.0 41.0 41.0 37.0 41.0 40-44 39.857899999999994 41.0 41.0 41.0 37.0 41.0 45-49 39.9215 41.0 41.0 41.0 37.0 41.0 50-54 39.8755 41.0 41.0 41.0 37.0 41.0 55-59 39.96795 41.0 41.0 41.0 37.0 41.0 60-64 39.828050000000005 41.0 41.0 41.0 37.0 41.0 65-69 39.61985 41.0 41.0 41.0 37.0 41.0 70-74 39.080450000000006 41.0 41.0 41.0 34.0 41.0 75-79 38.67455 41.0 38.6 41.0 33.0 41.0 80-84 38.8651 41.0 41.0 41.0 34.0 41.0 85-89 38.59625 41.0 39.4 41.0 32.0 41.0 90-94 39.33705 41.0 41.0 41.0 36.0 41.0 95-99 39.2407 41.0 40.2 41.0 36.0 41.0 100-104 38.925 41.0 40.2 41.0 35.0 41.0 105-109 38.227700000000006 41.0 37.0 41.0 31.0 41.0 110-114 38.1207 41.0 37.0 41.0 31.0 41.0 115-119 38.389799999999994 41.0 37.8 41.0 32.0 41.0 120-124 38.7847 41.0 39.4 41.0 34.0 41.0 125-129 37.5404 41.0 37.0 41.0 28.0 41.0 130-134 37.435050000000004 41.0 37.0 41.0 29.0 41.0 135-139 37.329600000000006 41.0 37.0 41.0 27.0 41.0 140-144 37.194900000000004 41.0 37.0 41.0 27.0 41.0 145-149 36.51575 41.0 36.0 41.0 25.0 41.0 150 36.6845 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 6.0 29 26.0 30 49.0 31 71.0 32 68.0 33 92.0 34 123.0 35 164.0 36 175.0 37 235.0 38 355.0 39 607.0 40 2029.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.897423067300476 15.386539904928698 14.761070803102328 39.9549662246685 2 26.488244122061033 25.212606303151574 28.96448224112056 19.334667333666832 3 21.95 32.525 24.0 21.525 4 25.275 35.25 19.45 20.025000000000002 5 25.025 38.725 20.175 16.075 6 16.900000000000002 39.675 24.325 19.1 7 18.3 18.0 40.175 23.525 8 18.15 22.0 30.325000000000003 29.525000000000002 9 19.025 23.5 31.624999999999996 25.85 10-14 21.21 29.54 27.075 22.175 15-19 21.285 27.655 28.63 22.43 20-24 21.955 29.595 26.790000000000003 21.66 25-29 21.59 29.125 27.155 22.13 30-34 21.305 29.160000000000004 27.205000000000002 22.33 35-39 21.505 29.160000000000004 26.705000000000002 22.63 40-44 21.099999999999998 29.695 26.575 22.63 45-49 21.349999999999998 29.054999999999996 26.924999999999997 22.67 50-54 21.27 29.494999999999997 27.24 21.995 55-59 21.325 29.294999999999998 27.105 22.275 60-64 21.295 28.73 27.36 22.615 65-69 22.13 29.25 26.895000000000003 21.725 70-74 22.040000000000003 28.87 27.41 21.68 75-79 21.884999999999998 28.22 27.88 22.015 80-84 22.34 28.175 27.08 22.405 85-89 22.02 29.285 26.650000000000002 22.045 90-94 22.17 28.665000000000003 27.255000000000003 21.91 95-99 21.72 28.499999999999996 27.82 21.959999999999997 100-104 22.32 28.549999999999997 27.22 21.91 105-109 22.23 27.939999999999998 28.125 21.705 110-114 21.759999999999998 28.315 27.785 22.14 115-119 21.69 27.74 27.839999999999996 22.73 120-124 22.24 28.325 27.47 21.965 125-129 21.815 28.22 28.225 21.740000000000002 130-134 22.605 27.584999999999997 28.105000000000004 21.705 135-139 22.125 27.525 27.944999999999997 22.405 140-144 21.975 28.235 27.575 22.215 145-149 22.625 27.79 27.595 21.990000000000002 150 22.55 28.425 26.75 22.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 2.0 24 3.5 25 4.5 26 6.0 27 10.0 28 11.0 29 11.5 30 20.0 31 34.5 32 45.5 33 61.5 34 71.0 35 76.0 36 93.0 37 113.5 38 139.5 39 162.0 40 174.0 41 199.0 42 230.5 43 227.5 44 235.0 45 259.0 46 262.0 47 252.5 48 232.0 49 209.0 50 175.5 51 133.5 52 111.5 53 97.0 54 75.5 55 59.0 56 49.0 57 35.5 58 22.0 59 21.0 60 18.0 61 12.5 62 9.0 63 6.0 64 5.5 65 5.0 66 3.5 67 2.0 68 1.5 69 1.5 70 1.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.38784067085953 91.0 2 4.428721174004193 8.450000000000001 3 0.15723270440251574 0.44999999999999996 4 0.026205450733752623 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.075 0.0 0.0 0.025 0.0 136-137 0.36250000000000004 0.0 0.0 0.025 0.0 138 0.5 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGACAA 10 0.006973645 144.0 1 AAAAAAA 40 0.007966741 18.0 9 >>END_MODULE Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809752 spots for SRR11701742.sra Written 809752 spots for SRR11701742.sra Read 809755 spots for SRR11701742.sra Written 809755 spots for SRR11701742.sra SRR ids: ['SRR11701742.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i3k6um9f SRR11701742.sra spots: 16195043 blocks: [[1, 809752], [809753, 1619504], [1619505, 2429256], [2429257, 3239008], [3239009, 4048760], [4048761, 4858512], [4858513, 5668264], [5668265, 6478016], [6478017, 7287768], [7287769, 8097520], [8097521, 8907272], [8907273, 9717024], [9717025, 10526776], [10526777, 11336528], [11336529, 12146280], [12146281, 12956032], [12956033, 13765784], [13765785, 14575536], [14575537, 15385288], [15385289, 16195043]] SRR11701742 file size 5450452 SRR11701742 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701742 SRR11701742_1.fastq SRR11701742_2.fastq Input file: SRR11701742_1.fastq Paired file: SRR11701742_2.fastq trimmed: SRR11701742-trimmed-pair1.fastq, SRR11701742-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:41:47 2025 >> started Thu Feb 13 00:45:50 2025 >> done (243.302s) 16195043 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 16195040 (100.00%) read pairs available; of these: 481342 ( 2.97%) trimmed read pairs available after processing 15713698 (97.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 6 0.00% 31 8 0.00% 32 2 0.00% 33 7 0.00% 34 6 0.00% 35 3 0.00% 36 4 0.00% 37 7 0.00% 38 3 0.00% 39 6 0.00% 40 5 0.00% 41 7 0.00% 42 9 0.00% 43 2 0.00% 44 2 0.00% 45 4 0.00% 46 3 0.00% 47 1 0.00% 48 6 0.00% 49 9 0.00% 50 4 0.00% 51 7 0.00% 52 3 0.00% 53 4 0.00% 54 5 0.00% 55 5 0.00% 56 1 0.00% 57 5 0.00% 58 6 0.00% 59 1 0.00% 60 0 0.00% 61 2 0.00% 62 4 0.00% 63 3 0.00% 64 4 0.00% 65 5 0.00% 66 3 0.00% 67 2 0.00% 68 9 0.00% 69 1 0.00% 70 2 0.00% 71 4 0.00% 72 2 0.00% 73 1 0.00% 74 3 0.00% 75 7 0.00% 76 3 0.00% 77 2 0.00% 78 2 0.00% 79 2 0.00% 80 5 0.00% 81 6 0.00% 82 1 0.00% 83 4 0.00% 84 2 0.00% 85 4 0.00% 86 6 0.00% 87 5 0.00% 88 4 0.00% 89 6 0.00% 90 6 0.00% 91 7 0.00% 92 9 0.00% 93 12 0.00% 94 7 0.00% 95 11 0.00% 96 17 0.00% 97 16 0.00% 98 13 0.00% 99 19 0.00% 100 27 0.00% 101 30 0.00% 102 36 0.00% 103 31 0.00% 104 35 0.00% 105 48 0.00% 106 53 0.00% 107 47 0.00% 108 70 0.00% 109 62 0.00% 110 60 0.00% 111 65 0.00% 112 72 0.00% 113 62 0.00% 114 69 0.00% 115 76 0.00% 116 67 0.00% 117 55 0.00% 118 57 0.00% 119 69 0.00% 120 72 0.00% 121 67 0.00% 122 92 0.00% 123 92 0.00% 124 72 0.00% 125 93 0.00% 126 100 0.00% 127 99 0.00% 128 75 0.00% 129 102 0.00% 130 97 0.00% 131 92 0.00% 132 75 0.00% 133 78 0.00% 134 19422 0.12% 135 19062 0.12% 136 19035 0.12% 137 18955 0.12% 138 18657 0.12% 139 19557 0.12% 140 20507 0.13% 141 21525 0.13% 142 23266 0.14% 143 24740 0.15% 144 25399 0.16% 145 25798 0.16% 146 25247 0.16% 147 25428 0.16% 148 28598 0.18% 149 143464 0.89% 150 15713698 97.03% 16195040 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=37 prefix-density=0.32 prefix-fanout=1.1 sequence=GTGACCAGACTACTTCTTTTTAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=205.19 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=16.8 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=36 prefix-density=0.31 prefix-fanout=1.1 sequence=GTGACCAGACTACTTCTTTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=284.13 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=13.8 sequence=GAGAAGGGATATAAGGTTAATGATGAAGACGACCGTCGCAGTAGTATTTGTGCTAGGGCTGGCATTCTTGGATCTTCAAGTTGATGCTAAAAGGCTTCTTTTGAAGGAAATCAAGGCAGAAAAAACTGATGATAAGCCTTTGTCTAATGTGCAGCAGGATGGTAAACTAGATGCTGTTAACAATGCTGGAACTGATGTTAAGCCGAATAATCAACCAGGAAACGTTGGCACCTATGGTAATCCAGTGACAGGCTCAGTGCCCGCAGTTGATACCAAGAATGATAATGCAACTAGCAGCCCGTCTACTAGTGACAACAAGGG SRR11701742 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:19:59 Started mapping on | Feb 13 01:20:01 Finished on | Feb 13 01:21:19 Mapping speed, Million of reads per hour | 747.46 Number of input reads | 16195040 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14838962 Uniquely mapped reads % | 91.63% Average mapped length | 297.84 Number of splices: Total | 12670428 Number of splices: Annotated (sjdb) | 12427986 Number of splices: GT/AG | 12470228 Number of splices: GC/AG | 158314 Number of splices: AT/AC | 12473 Number of splices: Non-canonical | 29413 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335448 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 1712 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.27% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1020630 1020630 1020630 N_multimapping 335448 335448 335448 N_noFeature 466338 7535547 7682386 N_ambiguous 179726 47050 45895 UnstrandedReadsAssigned:14192898 PositiveStrandReadsAssigned:7256365 NegativeStrandReadsAssigned:7110681 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701742 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701742-trimmed-pair1.fastq SRR11701742-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,195,040 reads, 14,441,312 reads pseudoaligned [quant] estimated average fragment length: 251.994 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR11701742.ke.tsv 34699 SRR11701742.se.tsv 87100 total ==> SRR11701742.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.01 1134 34.0642 Potri.005G024800.1.v4.1 1035 784.006 429 29.0443 Potri.004G059700.1.v4.1 961 710.022 37 2.766 Potri.007G009000.2.v4.1 1416 1165.01 0 0 Potri.003G141000.2.v4.1 2943 2692.01 366 7.21652 Potri.016G087400.1.v4.1 270 60.0892 836 738.47 Potri.015G069301.1.v4.1 564 313.439 0 0 Potri.010G195200.1.v4.1 1773 1522.01 100 3.48744 Potri.012G127500.1.v4.1 977 726.017 6105 446.336 ==> SRR11701742.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 280 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR11701742 completed mapping pipeline successfully