Starting /dee2/code/volunteer_pipeline.sh SRR11701743 current disk space = 3051210981376 free memory = 1570949296 SRR11701743 SRAfilesize fe7fa58c69a061bbe2143c8ea33dad7f SRR11701743.sra SRR11701743.sra file validated SRR11701743 is paired end SRR11701743 is conventional basespace SRR11701743 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701743_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81 32.0 32.0 32.0 32.0 32.0 2 31.7625 32.0 32.0 32.0 32.0 32.0 3 36.07 37.0 37.0 37.0 32.0 37.0 4 36.39625 37.0 37.0 37.0 37.0 37.0 5 36.2575 37.0 37.0 37.0 37.0 37.0 6 39.67575 41.0 41.0 41.0 37.0 41.0 7 39.705 41.0 41.0 41.0 37.0 41.0 8 39.76375 41.0 41.0 41.0 37.0 41.0 9 40.08325 41.0 41.0 41.0 37.0 41.0 10-14 39.709649999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.52355 41.0 41.0 41.0 37.0 41.0 20-24 39.5761 41.0 41.0 41.0 37.0 41.0 25-29 39.282300000000006 41.0 41.0 41.0 37.0 41.0 30-34 38.9432 41.0 41.0 41.0 35.0 41.0 35-39 39.5127 41.0 41.0 41.0 37.0 41.0 40-44 39.77185 41.0 41.0 41.0 37.0 41.0 45-49 40.11735 41.0 41.0 41.0 37.8 41.0 50-54 40.03815 41.0 41.0 41.0 37.0 41.0 55-59 40.0855 41.0 41.0 41.0 37.0 41.0 60-64 39.921499999999995 41.0 41.0 41.0 37.0 41.0 65-69 39.92015 41.0 41.0 41.0 37.0 41.0 70-74 39.95264999999999 41.0 41.0 41.0 37.0 41.0 75-79 39.505449999999996 41.0 41.0 41.0 37.0 41.0 80-84 39.36715 41.0 41.0 41.0 36.0 41.0 85-89 39.635149999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.593149999999994 41.0 41.0 41.0 37.0 41.0 95-99 39.6666 41.0 41.0 41.0 37.0 41.0 100-104 39.54715 41.0 41.0 41.0 37.0 41.0 105-109 39.524249999999995 41.0 41.0 41.0 37.0 41.0 110-114 39.2182 41.0 40.2 41.0 36.0 41.0 115-119 39.55565 41.0 41.0 41.0 37.0 41.0 120-124 39.61305 41.0 41.0 41.0 37.0 41.0 125-129 38.958349999999996 41.0 41.0 41.0 35.0 41.0 130-134 39.07645 41.0 41.0 41.0 36.0 41.0 135-139 38.70145 41.0 38.6 41.0 33.0 41.0 140-144 38.5858 41.0 37.8 41.0 33.0 41.0 145-149 37.88405 41.0 37.0 41.0 31.0 41.0 150 38.1765 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 2.0 28 2.0 29 16.0 30 17.0 31 37.0 32 40.0 33 65.0 34 85.0 35 99.0 36 165.0 37 210.0 38 345.0 39 634.0 40 2283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.0 17.825 15.65 34.525 2 25.35 25.025 32.324999999999996 17.299999999999997 3 21.8 29.75 25.6 22.85 4 23.575 36.075 20.424999999999997 19.925 5 24.05 38.4 20.325 17.224999999999998 6 15.4 40.25 24.5 19.85 7 17.075000000000003 19.125 42.425000000000004 21.375 8 17.5 21.725 31.15 29.625 9 19.3 21.55 32.425 26.724999999999998 10-14 20.655 29.665000000000003 27.46 22.220000000000002 15-19 21.415 28.199999999999996 28.439999999999998 21.945 20-24 21.25 29.404999999999998 27.515 21.83 25-29 21.505 28.694999999999997 28.255000000000003 21.545 30-34 20.72 29.48 27.68 22.12 35-39 21.51 28.435 27.99 22.065 40-44 20.669999999999998 28.84 28.494999999999997 21.995 45-49 21.529999999999998 28.58 27.83 22.06 50-54 21.490000000000002 28.720000000000002 27.82 21.97 55-59 21.990000000000002 28.59 27.589999999999996 21.83 60-64 21.505 29.160000000000004 27.38 21.955 65-69 21.345 28.17 27.97 22.515 70-74 21.235 28.785 27.85 22.13 75-79 21.709999999999997 28.95 27.345000000000002 21.995 80-84 21.415 28.42 28.26 21.905 85-89 21.985 28.405 27.529999999999998 22.08 90-94 21.625 28.494999999999997 28.299999999999997 21.58 95-99 21.93 28.46 27.46 22.15 100-104 21.875 28.21 28.075 21.84 105-109 21.834999999999997 28.225 28.46 21.48 110-114 21.404999999999998 28.744999999999997 28.444999999999997 21.404999999999998 115-119 21.759999999999998 27.93 28.52 21.790000000000003 120-124 22.34 28.175 28.044999999999998 21.44 125-129 22.015 28.21 28.375 21.4 130-134 21.02 28.22 28.139999999999997 22.62 135-139 22.13 28.04 28.465 21.365000000000002 140-144 22.220000000000002 28.000000000000004 28.13 21.65 145-149 22.814999999999998 28.470000000000002 27.54 21.175 150 21.55 27.575 29.275000000000002 21.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 3.5 19 4.0 20 2.0 21 2.0 22 3.5 23 4.0 24 6.0 25 9.0 26 10.0 27 11.5 28 14.0 29 20.0 30 25.5 31 33.0 32 46.0 33 61.0 34 67.0 35 74.0 36 102.0 37 131.5 38 143.0 39 160.5 40 192.5 41 218.0 42 229.0 43 236.5 44 248.5 45 256.0 46 268.0 47 246.5 48 214.5 49 189.0 50 145.0 51 116.0 52 102.5 53 85.5 54 67.5 55 52.5 56 41.5 57 33.0 58 24.0 59 17.0 60 14.0 61 17.0 62 14.5 63 6.5 64 5.0 65 6.5 66 5.0 67 3.5 68 1.5 69 1.0 70 2.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52356020942409 91.225 2 4.2408376963350785 8.1 3 0.2356020942408377 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0375 0.0 0.0 0.0 0.0 136-137 0.25 0.0 0.0 0.0 0.0 138 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11701743 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701743_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6625 32.0 32.0 32.0 32.0 32.0 2 31.515 32.0 32.0 32.0 32.0 32.0 3 35.11875 37.0 37.0 37.0 32.0 37.0 4 36.3375 37.0 37.0 37.0 37.0 37.0 5 36.48625 37.0 37.0 37.0 37.0 37.0 6 40.04025 41.0 41.0 41.0 37.0 41.0 7 39.843 41.0 41.0 41.0 37.0 41.0 8 40.2305 41.0 41.0 41.0 37.0 41.0 9 39.988 41.0 41.0 41.0 37.0 41.0 10-14 40.23285 41.0 41.0 41.0 39.4 41.0 15-19 39.7562 41.0 41.0 41.0 37.0 41.0 20-24 39.96165 41.0 41.0 41.0 37.0 41.0 25-29 39.8997 41.0 41.0 41.0 37.0 41.0 30-34 39.923500000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.9797 41.0 41.0 41.0 37.0 41.0 40-44 39.81555 41.0 41.0 41.0 37.0 41.0 45-49 39.89045 41.0 41.0 41.0 37.0 41.0 50-54 39.94 41.0 41.0 41.0 37.0 41.0 55-59 39.93025 41.0 41.0 41.0 37.0 41.0 60-64 39.79765 41.0 41.0 41.0 37.0 41.0 65-69 39.60145 41.0 41.0 41.0 37.0 41.0 70-74 39.02275 41.0 41.0 41.0 34.0 41.0 75-79 38.5322 41.0 38.6 41.0 33.0 41.0 80-84 38.8983 41.0 41.0 41.0 33.0 41.0 85-89 38.578199999999995 41.0 40.2 41.0 32.0 41.0 90-94 39.24525 41.0 41.0 41.0 36.0 41.0 95-99 39.20745 41.0 40.2 41.0 36.0 41.0 100-104 38.85085 41.0 40.2 41.0 34.0 41.0 105-109 38.065000000000005 41.0 37.0 41.0 31.0 41.0 110-114 38.05275 41.0 37.0 41.0 31.0 41.0 115-119 38.29174999999999 41.0 37.0 41.0 31.0 41.0 120-124 38.68535 41.0 38.6 41.0 34.0 41.0 125-129 37.50735 41.0 37.0 41.0 28.0 41.0 130-134 37.34785 41.0 37.0 41.0 27.0 41.0 135-139 37.3044 41.0 37.0 41.0 27.0 41.0 140-144 37.10809999999999 41.0 37.0 41.0 27.0 41.0 145-149 36.35675 41.0 36.0 41.0 24.0 41.0 150 36.54675 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 6.0 29 29.0 30 50.0 31 60.0 32 81.0 33 95.0 34 125.0 35 149.0 36 188.0 37 268.0 38 369.0 39 591.0 40 1988.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.53566958698373 15.219023779724655 14.993742177722153 41.251564455569465 2 25.894420815611706 24.993745308981737 30.122591943957964 18.989241931448586 3 24.575 30.2 23.25 21.975 4 24.7 34.725 20.150000000000002 20.424999999999997 5 24.425 38.375 19.900000000000002 17.299999999999997 6 15.375 40.0 22.5 22.125 7 17.45 17.299999999999997 42.575 22.675 8 18.575 24.125 29.299999999999997 28.000000000000004 9 18.875 23.0 31.85 26.275 10-14 20.150000000000002 29.854999999999997 27.384999999999998 22.61 15-19 20.915 28.325 28.105000000000004 22.655 20-24 21.04 29.635 27.49 21.834999999999997 25-29 21.265 29.099999999999998 27.72 21.915000000000003 30-34 20.255000000000003 29.28 28.595 21.87 35-39 20.73 28.849999999999998 28.494999999999997 21.925 40-44 21.349999999999998 29.335 27.445000000000004 21.87 45-49 21.485000000000003 28.305000000000003 28.645 21.565 50-54 21.695 29.485 27.029999999999998 21.790000000000003 55-59 21.695 29.849999999999998 27.41 21.044999999999998 60-64 21.105 28.744999999999997 27.88 22.27 65-69 21.48 28.535 28.235 21.75 70-74 21.575 28.660000000000004 27.97 21.795 75-79 21.165 28.73 27.98 22.125 80-84 22.045 29.635 27.095000000000002 21.224999999999998 85-89 21.375 27.91 28.225 22.49 90-94 21.834999999999997 28.895 27.66 21.61 95-99 21.275 29.294999999999998 27.775 21.654999999999998 100-104 21.32 28.515 27.79 22.375 105-109 21.68 28.095 28.625 21.6 110-114 22.07 28.084999999999997 27.88 21.965 115-119 21.81 28.7 27.455000000000002 22.035 120-124 21.535 28.01 28.26 22.195 125-129 21.625 29.43 27.224999999999998 21.72 130-134 21.990000000000002 27.865000000000002 27.85 22.295 135-139 21.47 28.389999999999997 28.54 21.6 140-144 22.009999999999998 27.975 28.349999999999998 21.665 145-149 23.02 28.165000000000003 28.115000000000002 20.7 150 22.025 27.0 28.925 22.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 2.0 18 4.0 19 3.0 20 2.5 21 4.0 22 5.0 23 6.5 24 5.0 25 7.5 26 14.0 27 14.0 28 19.0 29 28.0 30 27.0 31 31.5 32 38.5 33 52.5 34 68.5 35 83.0 36 108.0 37 128.0 38 141.0 39 162.0 40 188.5 41 208.5 42 225.5 43 243.0 44 272.5 45 259.0 46 220.5 47 228.0 48 220.5 49 194.5 50 163.0 51 128.5 52 106.5 53 89.0 54 65.5 55 49.0 56 46.5 57 32.5 58 23.0 59 17.5 60 12.0 61 11.0 62 11.0 63 10.0 64 5.0 65 2.0 66 3.0 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.5520669806384 91.3 2 4.23861852433281 8.1 3 0.20931449502878074 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.0625 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916916 spots for SRR11701743.sra Written 916916 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra Read 916898 spots for SRR11701743.sra Written 916898 spots for SRR11701743.sra SRR ids: ['SRR11701743.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i62ru4zz SRR11701743.sra spots: 18337978 blocks: [[1, 916898], [916899, 1833796], [1833797, 2750694], [2750695, 3667592], [3667593, 4584490], [4584491, 5501388], [5501389, 6418286], [6418287, 7335184], [7335185, 8252082], [8252083, 9168980], [9168981, 10085878], [10085879, 11002776], [11002777, 11919674], [11919675, 12836572], [12836573, 13753470], [13753471, 14670368], [14670369, 15587266], [15587267, 16504164], [16504165, 17421062], [17421063, 18337978]] SRR11701743 file size 6174530 SRR11701743 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701743 SRR11701743_1.fastq SRR11701743_2.fastq Input file: SRR11701743_1.fastq Paired file: SRR11701743_2.fastq trimmed: SRR11701743-trimmed-pair1.fastq, SRR11701743-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:35:25 2025 >> started Thu Feb 13 01:35:50 2025 >> done (25.156s) 18337978 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 18337977 (100.00%) read pairs available; of these: 512510 ( 2.79%) trimmed read pairs available after processing 17825467 (97.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 8 0.00% 26 9 0.00% 27 4 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 3 0.00% 32 8 0.00% 33 3 0.00% 34 7 0.00% 35 7 0.00% 36 5 0.00% 37 3 0.00% 38 6 0.00% 39 3 0.00% 40 7 0.00% 41 6 0.00% 42 1 0.00% 43 8 0.00% 44 4 0.00% 45 5 0.00% 46 5 0.00% 47 5 0.00% 48 3 0.00% 49 6 0.00% 50 0 0.00% 51 4 0.00% 52 2 0.00% 53 3 0.00% 54 3 0.00% 55 6 0.00% 56 4 0.00% 57 6 0.00% 58 4 0.00% 59 4 0.00% 60 7 0.00% 61 5 0.00% 62 4 0.00% 63 2 0.00% 64 3 0.00% 65 4 0.00% 66 3 0.00% 67 4 0.00% 68 5 0.00% 69 6 0.00% 70 3 0.00% 71 2 0.00% 72 3 0.00% 73 1 0.00% 74 2 0.00% 75 2 0.00% 76 2 0.00% 77 1 0.00% 78 2 0.00% 79 3 0.00% 80 3 0.00% 81 3 0.00% 82 3 0.00% 83 1 0.00% 84 4 0.00% 85 1 0.00% 86 4 0.00% 87 4 0.00% 88 5 0.00% 89 7 0.00% 90 5 0.00% 91 12 0.00% 92 11 0.00% 93 14 0.00% 94 11 0.00% 95 21 0.00% 96 22 0.00% 97 18 0.00% 98 25 0.00% 99 28 0.00% 100 35 0.00% 101 47 0.00% 102 29 0.00% 103 46 0.00% 104 55 0.00% 105 62 0.00% 106 46 0.00% 107 56 0.00% 108 61 0.00% 109 63 0.00% 110 93 0.00% 111 94 0.00% 112 78 0.00% 113 85 0.00% 114 69 0.00% 115 98 0.00% 116 78 0.00% 117 75 0.00% 118 74 0.00% 119 92 0.00% 120 98 0.00% 121 92 0.00% 122 99 0.00% 123 96 0.00% 124 102 0.00% 125 90 0.00% 126 99 0.00% 127 86 0.00% 128 88 0.00% 129 94 0.00% 130 94 0.00% 131 90 0.00% 132 76 0.00% 133 76 0.00% 134 20394 0.11% 135 20251 0.11% 136 19960 0.11% 137 19913 0.11% 138 19761 0.11% 139 20659 0.11% 140 21719 0.12% 141 22500 0.12% 142 24497 0.13% 143 25804 0.14% 144 26205 0.14% 145 26434 0.14% 146 25870 0.14% 147 26403 0.14% 148 30175 0.16% 149 158900 0.87% 150 17825467 97.21% 18337977 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=37 prefix-density=0.31 prefix-fanout=1.1 sequence=GTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=231.29 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=17.4 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=1.9 sequence=AGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCTTTGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=208.42 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=16.2 sequence=AAGAAGAAGAAG SRR11701743 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:36:30 Started mapping on | Feb 13 01:36:30 Finished on | Feb 13 01:37:55 Mapping speed, Million of reads per hour | 776.67 Number of input reads | 18337977 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16814688 Uniquely mapped reads % | 91.69% Average mapped length | 297.78 Number of splices: Total | 13451239 Number of splices: Annotated (sjdb) | 13171322 Number of splices: GT/AG | 13233186 Number of splices: GC/AG | 166110 Number of splices: AT/AC | 14999 Number of splices: Non-canonical | 36944 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403034 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 2556 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.07% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1120255 1120255 1120255 N_multimapping 403034 403034 403034 N_noFeature 965494 8769851 8908622 N_ambiguous 224494 61657 61728 UnstrandedReadsAssigned:15624700 PositiveStrandReadsAssigned:7983180 NegativeStrandReadsAssigned:7844338 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701743 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701743-trimmed-pair1.fastq SRR11701743-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,337,977 reads, 15,945,351 reads pseudoaligned [quant] estimated average fragment length: 256.253 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR11701743.ke.tsv 34699 SRR11701743.se.tsv 87100 total ==> SRR11701743.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.75 1994 54.2793 Potri.005G024800.1.v4.1 1035 779.747 1905 117.231 Potri.004G059700.1.v4.1 961 705.747 9 0.611918 Potri.007G009000.2.v4.1 1416 1160.75 6 0.248035 Potri.003G141000.2.v4.1 2943 2687.75 702.568 12.5429 Potri.016G087400.1.v4.1 270 59.3295 746 603.348 Potri.015G069301.1.v4.1 564 309.338 0 0 Potri.010G195200.1.v4.1 1773 1517.75 95 3.00347 Potri.012G127500.1.v4.1 977 721.747 8622 573.222 ==> SRR11701743.se.tsv <== Potri.001G166300.v4.1 12 Potri.001G448400.v4.1 258 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 7 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 21 Potri.001G452600.v4.1 23 SRR11701743 completed mapping pipeline successfully