Starting /dee2/code/volunteer_pipeline.sh SRR11701744 current disk space = 3051900612608 free memory = 1415719272 SRR11701744 SRAfilesize 04c5eaed622b0861b4e2fe707ef5e63b SRR11701744.sra SRR11701744.sra file validated SRR11701744 is paired end SRR11701744 is conventional basespace SRR11701744 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701744_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.44875 32.0 32.0 32.0 32.0 32.0 2 31.78875 32.0 32.0 32.0 32.0 32.0 3 36.12 37.0 37.0 37.0 32.0 37.0 4 36.44 37.0 37.0 37.0 37.0 37.0 5 36.38 37.0 37.0 37.0 37.0 37.0 6 39.602 41.0 41.0 41.0 37.0 41.0 7 39.75225 41.0 41.0 41.0 37.0 41.0 8 39.674 41.0 41.0 41.0 37.0 41.0 9 40.104 41.0 41.0 41.0 37.0 41.0 10-14 39.70360000000001 41.0 41.0 41.0 37.0 41.0 15-19 39.511700000000005 41.0 41.0 41.0 37.0 41.0 20-24 39.651300000000006 41.0 41.0 41.0 37.0 41.0 25-29 39.36905 41.0 41.0 41.0 37.0 41.0 30-34 38.9692 41.0 41.0 41.0 35.0 41.0 35-39 39.6436 41.0 41.0 41.0 37.0 41.0 40-44 39.87325 41.0 41.0 41.0 37.8 41.0 45-49 40.224650000000004 41.0 41.0 41.0 37.8 41.0 50-54 40.07385000000001 41.0 41.0 41.0 37.0 41.0 55-59 40.144549999999995 41.0 41.0 41.0 37.0 41.0 60-64 39.967549999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.87505 41.0 41.0 41.0 37.0 41.0 70-74 40.00165 41.0 41.0 41.0 37.0 41.0 75-79 39.60955 41.0 41.0 41.0 37.0 41.0 80-84 39.28215 41.0 41.0 41.0 36.0 41.0 85-89 39.6625 41.0 41.0 41.0 37.0 41.0 90-94 39.593399999999995 41.0 41.0 41.0 37.0 41.0 95-99 39.66655 41.0 41.0 41.0 37.0 41.0 100-104 39.5947 41.0 41.0 41.0 37.0 41.0 105-109 39.5908 41.0 41.0 41.0 37.0 41.0 110-114 39.20925 41.0 40.2 41.0 36.0 41.0 115-119 39.485699999999994 41.0 41.0 41.0 37.0 41.0 120-124 39.597899999999996 41.0 41.0 41.0 37.0 41.0 125-129 38.978899999999996 41.0 41.0 41.0 35.0 41.0 130-134 39.0901 41.0 41.0 41.0 36.0 41.0 135-139 38.67755 41.0 38.6 41.0 34.0 41.0 140-144 38.587300000000006 41.0 37.8 41.0 33.0 41.0 145-149 37.9285 41.0 37.0 41.0 31.0 41.0 150 38.16175 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 2.0 29 11.0 30 18.0 31 29.0 32 29.0 33 57.0 34 104.0 35 108.0 36 152.0 37 234.0 38 323.0 39 639.0 40 2294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.25 17.724999999999998 15.299999999999999 33.725 2 26.075 24.75 31.2 17.974999999999998 3 23.075000000000003 29.299999999999997 24.525 23.1 4 24.175 37.425000000000004 19.625 18.775 5 25.275 37.824999999999996 20.674999999999997 16.225 6 16.7 39.475 24.75 19.075 7 17.275 18.925 42.125 21.675 8 18.825 22.05 30.049999999999997 29.075 9 18.625 23.724999999999998 31.574999999999996 26.075 10-14 20.765 30.09 27.065 22.08 15-19 21.67 28.285 28.494999999999997 21.55 20-24 21.215 29.115000000000002 28.095 21.575 25-29 21.5 29.73 26.735 22.035 30-34 21.52 30.209999999999997 27.224999999999998 21.044999999999998 35-39 21.39 29.630000000000003 27.495000000000005 21.485000000000003 40-44 21.75 28.720000000000002 27.305 22.225 45-49 21.445 28.76 27.845 21.95 50-54 21.33 28.58 28.075 22.015 55-59 21.425 28.73 28.055000000000003 21.790000000000003 60-64 21.365000000000002 29.34 27.32 21.975 65-69 21.04 28.88 28.199999999999996 21.88 70-74 21.77 29.080000000000002 27.37 21.78 75-79 21.605 28.410000000000004 28.26 21.725 80-84 21.349999999999998 29.28 27.66 21.709999999999997 85-89 22.09 28.310000000000002 27.71 21.89 90-94 21.755 28.345 28.26 21.64 95-99 22.0 28.535 27.950000000000003 21.515 100-104 21.905 28.425 27.675 21.995 105-109 22.1 27.565 28.689999999999998 21.645 110-114 21.709999999999997 28.38 27.96 21.95 115-119 22.115000000000002 27.73 28.255000000000003 21.9 120-124 21.51 28.194999999999997 28.655 21.64 125-129 21.455 28.43 28.325 21.790000000000003 130-134 21.89 28.29 27.87 21.95 135-139 21.525 28.24 28.435 21.8 140-144 21.8 28.38 28.305000000000003 21.515 145-149 21.36 28.27 28.58 21.790000000000003 150 21.725 27.750000000000004 28.675 21.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.5 18 2.5 19 3.5 20 3.5 21 2.5 22 5.5 23 7.5 24 7.0 25 8.5 26 12.0 27 18.5 28 23.0 29 21.5 30 26.0 31 36.0 32 47.0 33 58.0 34 68.5 35 84.5 36 94.0 37 106.0 38 135.0 39 171.0 40 196.5 41 201.0 42 219.5 43 268.5 44 275.5 45 248.5 46 241.0 47 226.5 48 205.5 49 182.0 50 157.0 51 131.5 52 98.0 53 76.0 54 65.5 55 52.5 56 42.0 57 36.5 58 28.0 59 22.0 60 18.5 61 11.5 62 10.5 63 8.0 64 3.0 65 1.5 66 2.5 67 4.5 68 5.5 69 3.5 70 1.5 71 2.0 72 2.0 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99341238471673 90.125 2 4.664031620553359 8.85 3 0.2898550724637681 0.8250000000000001 4 0.052700922266139656 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0375 0.0 0.0 0.0 0.0 136-137 0.3875 0.0 0.0 0.0 0.0 138 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAACAT 10 0.006973645 144.0 1 >>END_MODULE SRR11701744 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701744_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56375 32.0 32.0 32.0 32.0 32.0 2 31.45 32.0 32.0 32.0 32.0 32.0 3 34.7825 37.0 32.0 37.0 32.0 37.0 4 36.1775 37.0 37.0 37.0 32.0 37.0 5 36.2625 37.0 37.0 37.0 37.0 37.0 6 39.876 41.0 41.0 41.0 37.0 41.0 7 39.753 41.0 41.0 41.0 37.0 41.0 8 39.93825 41.0 41.0 41.0 37.0 41.0 9 39.9725 41.0 41.0 41.0 37.0 41.0 10-14 40.17725 41.0 41.0 41.0 37.0 41.0 15-19 39.6458 41.0 41.0 41.0 37.0 41.0 20-24 39.799400000000006 41.0 41.0 41.0 37.0 41.0 25-29 39.69539999999999 41.0 41.0 41.0 37.0 41.0 30-34 39.7187 41.0 41.0 41.0 37.0 41.0 35-39 39.74865 41.0 41.0 41.0 37.0 41.0 40-44 39.7217 41.0 41.0 41.0 37.0 41.0 45-49 39.8382 41.0 41.0 41.0 37.0 41.0 50-54 39.82225 41.0 41.0 41.0 37.0 41.0 55-59 39.818 41.0 41.0 41.0 37.0 41.0 60-64 39.657650000000004 41.0 41.0 41.0 37.0 41.0 65-69 39.42355 41.0 41.0 41.0 37.0 41.0 70-74 38.8398 41.0 40.2 41.0 34.0 41.0 75-79 38.484500000000004 41.0 37.8 41.0 32.0 41.0 80-84 38.7329 41.0 40.2 41.0 32.0 41.0 85-89 38.3502 41.0 39.4 41.0 32.0 41.0 90-94 39.1391 41.0 41.0 41.0 36.0 41.0 95-99 38.99765 41.0 40.2 41.0 35.0 41.0 100-104 38.6914 41.0 39.4 41.0 34.0 41.0 105-109 37.97805 41.0 37.0 41.0 30.0 41.0 110-114 37.85535 41.0 37.0 41.0 30.0 41.0 115-119 38.2306 41.0 37.8 41.0 32.0 41.0 120-124 38.6085 41.0 37.8 41.0 33.0 41.0 125-129 37.3146 41.0 37.0 41.0 28.0 41.0 130-134 37.11955 41.0 37.0 41.0 27.0 41.0 135-139 37.0639 41.0 37.0 41.0 27.0 41.0 140-144 37.0542 41.0 37.0 41.0 27.0 41.0 145-149 36.07885 41.0 33.0 41.0 23.0 41.0 150 36.269 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 10.0 29 33.0 30 66.0 31 67.0 32 77.0 33 115.0 34 123.0 35 170.0 36 207.0 37 279.0 38 352.0 39 591.0 40 1909.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.653653653653656 16.566566566566568 16.016016016016017 38.76376376376376 2 25.275275275275277 27.27727727727728 29.52952952952953 17.917917917917915 3 22.15 33.0 23.400000000000002 21.45 4 24.6 34.949999999999996 20.175 20.275000000000002 5 24.025 39.2 20.325 16.45 6 15.925 40.475 23.65 19.950000000000003 7 17.599999999999998 19.650000000000002 40.75 22.0 8 18.025 23.674999999999997 29.475 28.825 9 19.2 22.900000000000002 31.45 26.450000000000003 10-14 20.755000000000003 29.439999999999998 27.689999999999998 22.115000000000002 15-19 21.04 27.905 28.945 22.11 20-24 21.58 29.425 27.43 21.565 25-29 21.435000000000002 29.255 27.810000000000002 21.5 30-34 20.695 29.84 27.725 21.740000000000002 35-39 21.22 29.62 27.62 21.54 40-44 21.58 29.37 27.750000000000004 21.3 45-49 21.61 29.115000000000002 27.87 21.404999999999998 50-54 21.185000000000002 29.34 27.91 21.565 55-59 22.07 28.535 28.04 21.355 60-64 21.15 29.525000000000002 26.889999999999997 22.435 65-69 21.01 29.315 27.52 22.155 70-74 21.04 28.95 27.905 22.105 75-79 21.675 29.095 27.48 21.75 80-84 21.195 28.825 27.62 22.36 85-89 21.785 28.749999999999996 27.47 21.995 90-94 21.7 28.59 27.48 22.23 95-99 21.759999999999998 28.84 27.54 21.86 100-104 21.465 28.575 28.144999999999996 21.815 105-109 21.485000000000003 28.799999999999997 27.47 22.245 110-114 21.365000000000002 28.87 28.02 21.745 115-119 21.91 28.315 28.105000000000004 21.67 120-124 21.709999999999997 28.73 27.445000000000004 22.115000000000002 125-129 22.439999999999998 27.815 27.544999999999998 22.2 130-134 21.815 27.67 28.499999999999996 22.015 135-139 21.855 28.015 28.27 21.86 140-144 21.61 28.060000000000002 28.27 22.06 145-149 22.185 28.134999999999998 28.18 21.5 150 24.4 28.65 26.75 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.5 19 2.5 20 4.5 21 5.0 22 5.5 23 4.5 24 2.5 25 9.0 26 14.0 27 13.0 28 14.0 29 18.5 30 20.5 31 35.0 32 59.0 33 59.0 34 64.5 35 85.0 36 112.0 37 133.5 38 153.0 39 174.0 40 183.0 41 206.0 42 236.5 43 235.0 44 236.5 45 257.5 46 251.0 47 238.5 48 226.5 49 195.5 50 158.5 51 119.5 52 97.0 53 84.5 54 65.0 55 49.5 56 33.5 57 22.5 58 19.0 59 15.5 60 12.5 61 16.5 62 14.0 63 7.5 64 5.0 65 5.0 66 6.0 67 4.0 68 2.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16298633017875 90.5 2 4.574132492113565 8.7 3 0.23659305993690852 0.675 4 0.0 0.0 5 0.026288117770767613 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.0625 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAATC 10 0.006973645 144.0 2 >>END_MODULE Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950515 spots for SRR11701744.sra Written 950515 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra Read 950509 spots for SRR11701744.sra Written 950509 spots for SRR11701744.sra SRR ids: ['SRR11701744.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kj437tar SRR11701744.sra spots: 19010186 blocks: [[1, 950509], [950510, 1901018], [1901019, 2851527], [2851528, 3802036], [3802037, 4752545], [4752546, 5703054], [5703055, 6653563], [6653564, 7604072], [7604073, 8554581], [8554582, 9505090], [9505091, 10455599], [10455600, 11406108], [11406109, 12356617], [12356618, 13307126], [13307127, 14257635], [14257636, 15208144], [15208145, 16158653], [16158654, 17109162], [17109163, 18059671], [18059672, 19010186]] SRR11701744 file size 6401663 SRR11701744 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701744 SRR11701744_1.fastq SRR11701744_2.fastq Input file: SRR11701744_1.fastq Paired file: SRR11701744_2.fastq trimmed: SRR11701744-trimmed-pair1.fastq, SRR11701744-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:31:36 2025 >> started Thu Feb 13 01:32:08 2025 >> done (32.646s) 19010186 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 19010177 (100.00%) read pairs available; of these: 567895 ( 2.99%) trimmed read pairs available after processing 18442282 (97.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 5 0.00% 35 10 0.00% 36 3 0.00% 37 7 0.00% 38 4 0.00% 39 3 0.00% 40 3 0.00% 41 5 0.00% 42 3 0.00% 43 11 0.00% 44 7 0.00% 45 5 0.00% 46 2 0.00% 47 6 0.00% 48 7 0.00% 49 4 0.00% 50 7 0.00% 51 6 0.00% 52 11 0.00% 53 4 0.00% 54 8 0.00% 55 3 0.00% 56 3 0.00% 57 8 0.00% 58 9 0.00% 59 9 0.00% 60 6 0.00% 61 1 0.00% 62 5 0.00% 63 2 0.00% 64 6 0.00% 65 5 0.00% 66 4 0.00% 67 8 0.00% 68 2 0.00% 69 3 0.00% 70 4 0.00% 71 3 0.00% 72 3 0.00% 73 6 0.00% 74 2 0.00% 75 1 0.00% 76 2 0.00% 77 5 0.00% 78 1 0.00% 79 2 0.00% 80 3 0.00% 81 3 0.00% 82 2 0.00% 83 4 0.00% 84 2 0.00% 85 0 0.00% 86 5 0.00% 87 2 0.00% 88 0 0.00% 89 6 0.00% 90 8 0.00% 91 5 0.00% 92 11 0.00% 93 6 0.00% 94 13 0.00% 95 23 0.00% 96 15 0.00% 97 31 0.00% 98 23 0.00% 99 27 0.00% 100 35 0.00% 101 33 0.00% 102 59 0.00% 103 40 0.00% 104 50 0.00% 105 63 0.00% 106 60 0.00% 107 74 0.00% 108 77 0.00% 109 78 0.00% 110 68 0.00% 111 90 0.00% 112 78 0.00% 113 101 0.00% 114 103 0.00% 115 97 0.00% 116 83 0.00% 117 94 0.00% 118 75 0.00% 119 77 0.00% 120 98 0.00% 121 100 0.00% 122 100 0.00% 123 94 0.00% 124 73 0.00% 125 99 0.00% 126 86 0.00% 127 88 0.00% 128 105 0.00% 129 108 0.00% 130 105 0.00% 131 102 0.00% 132 72 0.00% 133 71 0.00% 134 24656 0.13% 135 24355 0.13% 136 23560 0.12% 137 23417 0.12% 138 23203 0.12% 139 23081 0.12% 140 24669 0.13% 141 25551 0.13% 142 27264 0.14% 143 28780 0.15% 144 29000 0.15% 145 29603 0.16% 146 28866 0.15% 147 28872 0.15% 148 31968 0.17% 149 167859 0.88% 150 18442282 97.01% 19010177 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=37 prefix-density=0.15 prefix-fanout=2.1 sequence=GCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGAGCCCAGCAATGCTGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=181.15 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=22.4 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=2.2 sequence=GCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGAGCCCAGCAATGCTGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=179.33 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=21.8 sequence=GCTGCTGCTGCT SRR11701744 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:33:05 Started mapping on | Feb 13 01:33:05 Finished on | Feb 13 01:35:02 Mapping speed, Million of reads per hour | 584.93 Number of input reads | 19010177 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17347308 Uniquely mapped reads % | 91.25% Average mapped length | 297.72 Number of splices: Total | 13540287 Number of splices: Annotated (sjdb) | 13238341 Number of splices: GT/AG | 13310442 Number of splices: GC/AG | 175760 Number of splices: AT/AC | 16594 Number of splices: Non-canonical | 37491 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407590 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 3203 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.56% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1255279 1255279 1255279 N_multimapping 407590 407590 407590 N_noFeature 1136028 9123063 9248663 N_ambiguous 239225 64785 63541 UnstrandedReadsAssigned:15972055 PositiveStrandReadsAssigned:8159460 NegativeStrandReadsAssigned:8035104 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701744 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701744-trimmed-pair1.fastq SRR11701744-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,010,177 reads, 16,329,575 reads pseudoaligned [quant] estimated average fragment length: 259.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR11701744.ke.tsv 34699 SRR11701744.se.tsv 87100 total ==> SRR11701744.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.86 1841 47.9361 Potri.005G024800.1.v4.1 1035 776.86 626 36.9249 Potri.004G059700.1.v4.1 961 702.86 29 1.89067 Potri.007G009000.2.v4.1 1416 1157.86 1 0.0395759 Potri.003G141000.2.v4.1 2943 2684.86 465.393 7.94302 Potri.016G087400.1.v4.1 270 59.4819 889 684.864 Potri.015G069301.1.v4.1 564 306.415 0 0 Potri.010G195200.1.v4.1 1773 1514.86 80 2.41994 Potri.012G127500.1.v4.1 977 718.86 7682 489.686 ==> SRR11701744.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 215 Potri.001G233950.v4.1 8 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 17 Potri.001G452600.v4.1 17 SRR11701744 completed mapping pipeline successfully