Starting /dee2/code/volunteer_pipeline.sh SRR11701745 current disk space = 3052082143232 free memory = 1580862240 SRR11701745 SRAfilesize 7e1630f27b73f4d3b59fa814408d4c42 SRR11701745.sra SRR11701745.sra file validated SRR11701745 is paired end SRR11701745 is conventional basespace SRR11701745 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701745_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66 32.0 32.0 32.0 32.0 32.0 2 31.80125 32.0 32.0 32.0 32.0 32.0 3 36.0775 37.0 37.0 37.0 32.0 37.0 4 36.3875 37.0 37.0 37.0 37.0 37.0 5 36.32625 37.0 37.0 37.0 37.0 37.0 6 39.6225 41.0 41.0 41.0 37.0 41.0 7 39.75325 41.0 41.0 41.0 37.0 41.0 8 39.74725 41.0 41.0 41.0 37.0 41.0 9 40.05975 41.0 41.0 41.0 37.0 41.0 10-14 39.759699999999995 41.0 41.0 41.0 37.0 41.0 15-19 39.61665000000001 41.0 41.0 41.0 37.0 41.0 20-24 39.6706 41.0 41.0 41.0 37.0 41.0 25-29 39.4731 41.0 41.0 41.0 37.0 41.0 30-34 39.17295 41.0 41.0 41.0 37.0 41.0 35-39 39.6959 41.0 41.0 41.0 37.0 41.0 40-44 39.865899999999996 41.0 41.0 41.0 37.0 41.0 45-49 40.2232 41.0 41.0 41.0 37.8 41.0 50-54 40.054899999999996 41.0 41.0 41.0 37.0 41.0 55-59 40.16420000000001 41.0 41.0 41.0 37.0 41.0 60-64 39.95625 41.0 41.0 41.0 37.0 41.0 65-69 39.90125 41.0 41.0 41.0 37.0 41.0 70-74 39.951649999999994 41.0 41.0 41.0 37.0 41.0 75-79 39.56955000000001 41.0 41.0 41.0 37.0 41.0 80-84 39.444 41.0 41.0 41.0 37.0 41.0 85-89 39.69245 41.0 41.0 41.0 37.0 41.0 90-94 39.6309 41.0 41.0 41.0 37.0 41.0 95-99 39.706900000000005 41.0 41.0 41.0 37.0 41.0 100-104 39.56535 41.0 41.0 41.0 37.0 41.0 105-109 39.577600000000004 41.0 41.0 41.0 37.0 41.0 110-114 39.280199999999994 41.0 41.0 41.0 36.0 41.0 115-119 39.517649999999996 41.0 41.0 41.0 37.0 41.0 120-124 39.59935 41.0 41.0 41.0 37.0 41.0 125-129 39.061600000000006 41.0 41.0 41.0 35.0 41.0 130-134 39.16615 41.0 41.0 41.0 36.0 41.0 135-139 38.7676 41.0 38.6 41.0 34.0 41.0 140-144 38.62175 41.0 37.8 41.0 33.0 41.0 145-149 38.068799999999996 41.0 37.0 41.0 32.0 41.0 150 38.37325 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 2.0 28 3.0 29 11.0 30 18.0 31 34.0 32 35.0 33 60.0 34 95.0 35 109.0 36 137.0 37 197.0 38 320.0 39 616.0 40 2363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.35 17.575 15.875 33.2 2 25.85 25.1 31.075000000000003 17.974999999999998 3 21.4 29.975 24.925 23.7 4 23.474999999999998 35.925000000000004 21.025 19.575 5 25.174999999999997 37.525 20.974999999999998 16.325 6 15.875 39.25 24.325 20.549999999999997 7 17.825 18.6 43.225 20.349999999999998 8 17.925 23.474999999999998 29.799999999999997 28.799999999999997 9 19.05 23.5 31.624999999999996 25.825 10-14 20.974999999999998 29.185 27.655 22.185 15-19 21.195 28.055000000000003 28.854999999999997 21.895 20-24 21.375 29.544999999999998 27.279999999999998 21.8 25-29 21.349999999999998 29.54 27.605 21.505 30-34 21.385 29.37 27.33 21.915000000000003 35-39 21.66 28.99 27.634999999999998 21.715 40-44 21.759999999999998 29.080000000000002 27.339999999999996 21.82 45-49 21.785 29.86 27.11 21.245 50-54 21.48 29.310000000000002 27.639999999999997 21.57 55-59 21.34 28.095 28.105000000000004 22.46 60-64 21.33 28.555000000000003 27.51 22.605 65-69 21.310000000000002 29.13 27.55 22.009999999999998 70-74 21.355 29.445 27.665 21.535 75-79 21.97 28.775000000000002 27.250000000000004 22.005 80-84 21.715 29.549999999999997 27.224999999999998 21.51 85-89 22.11 28.599999999999998 27.800000000000004 21.490000000000002 90-94 22.645 28.985 27.384999999999998 20.985 95-99 22.015 28.565 27.415 22.005 100-104 21.82 28.645 28.03 21.505 105-109 21.959999999999997 28.21 28.275 21.555 110-114 21.86 28.435 27.985 21.72 115-119 22.0 28.615000000000002 27.785 21.6 120-124 21.955 28.46 28.08 21.505 125-129 21.565 28.455000000000002 28.17 21.81 130-134 21.93 27.63 28.48 21.959999999999997 135-139 21.490000000000002 28.175 28.615000000000002 21.72 140-144 23.09 27.54 28.105000000000004 21.265 145-149 21.54 28.205000000000002 28.115000000000002 22.14 150 21.95 29.225 26.3 22.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.5 20 1.5 21 3.0 22 3.5 23 2.0 24 6.0 25 7.5 26 9.0 27 16.0 28 20.0 29 24.0 30 28.5 31 38.5 32 45.5 33 47.0 34 64.0 35 89.5 36 104.5 37 123.5 38 155.5 39 175.5 40 197.0 41 219.0 42 232.0 43 240.0 44 237.5 45 237.5 46 234.0 47 231.5 48 227.0 49 181.0 50 143.5 51 133.5 52 106.0 53 81.5 54 66.5 55 52.5 56 41.5 57 33.0 58 25.0 59 23.0 60 24.5 61 18.5 62 9.0 63 9.0 64 8.5 65 4.5 66 4.0 67 2.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.20483493631401 92.525 2 3.6132050948791266 6.950000000000001 3 0.1819599688068625 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.3375 0.0 0.0 0.0 0.0 138 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11701745 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701745_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.695 32.0 32.0 32.0 32.0 32.0 2 31.59625 32.0 32.0 32.0 32.0 32.0 3 35.18125 37.0 37.0 37.0 32.0 37.0 4 36.215 37.0 37.0 37.0 37.0 37.0 5 36.405 37.0 37.0 37.0 37.0 37.0 6 39.93 41.0 41.0 41.0 37.0 41.0 7 39.8685 41.0 41.0 41.0 37.0 41.0 8 40.17025 41.0 41.0 41.0 37.0 41.0 9 40.114 41.0 41.0 41.0 37.0 41.0 10-14 40.20125 41.0 41.0 41.0 37.8 41.0 15-19 39.7837 41.0 41.0 41.0 37.0 41.0 20-24 40.02055 41.0 41.0 41.0 37.0 41.0 25-29 39.9077 41.0 41.0 41.0 37.0 41.0 30-34 39.89905 41.0 41.0 41.0 37.0 41.0 35-39 39.90835 41.0 41.0 41.0 37.0 41.0 40-44 39.81805 41.0 41.0 41.0 37.0 41.0 45-49 39.9598 41.0 41.0 41.0 37.0 41.0 50-54 39.89265 41.0 41.0 41.0 37.0 41.0 55-59 39.948899999999995 41.0 41.0 41.0 37.0 41.0 60-64 39.7823 41.0 41.0 41.0 37.0 41.0 65-69 39.69064999999999 41.0 41.0 41.0 37.0 41.0 70-74 39.15845 41.0 41.0 41.0 34.0 41.0 75-79 38.68695 41.0 39.4 41.0 33.0 41.0 80-84 38.97915 41.0 41.0 41.0 35.0 41.0 85-89 38.6495 41.0 40.2 41.0 34.0 41.0 90-94 39.28035 41.0 41.0 41.0 37.0 41.0 95-99 39.2087 41.0 41.0 41.0 36.0 41.0 100-104 38.847950000000004 41.0 40.2 41.0 35.0 41.0 105-109 38.2936 41.0 37.0 41.0 31.0 41.0 110-114 38.25485 41.0 37.0 41.0 32.0 41.0 115-119 38.32395 41.0 37.0 41.0 31.0 41.0 120-124 38.62925 41.0 39.4 41.0 32.0 41.0 125-129 37.61815 41.0 37.0 41.0 29.0 41.0 130-134 37.502449999999996 41.0 37.0 41.0 28.0 41.0 135-139 37.305550000000004 41.0 37.0 41.0 27.0 41.0 140-144 37.214600000000004 41.0 37.0 41.0 27.0 41.0 145-149 36.6194 41.0 37.0 41.0 27.0 41.0 150 36.8135 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 10.0 29 26.0 30 52.0 31 75.0 32 62.0 33 88.0 34 109.0 35 146.0 36 189.0 37 257.0 38 365.0 39 569.0 40 2051.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.1351689612015 17.471839799749684 14.468085106382977 39.92490613266583 2 24.59344508381286 26.26970227670753 30.64798598949212 18.48886664998749 3 23.9 30.825000000000003 24.474999999999998 20.8 4 25.825 35.025 19.275000000000002 19.875 5 25.6 37.5 19.5 17.4 6 15.4 41.099999999999994 23.375 20.125 7 17.8 18.075 41.475 22.650000000000002 8 19.775000000000002 22.3 28.799999999999997 29.125 9 18.4 24.45 32.824999999999996 24.325 10-14 20.64 30.330000000000002 27.02 22.009999999999998 15-19 21.32 28.63 27.905 22.145 20-24 21.325 29.520000000000003 27.04 22.115000000000002 25-29 21.025 29.57 27.305 22.1 30-34 20.97 29.54 27.735 21.755 35-39 21.65 29.15 27.255000000000003 21.945 40-44 21.404999999999998 29.015 28.005000000000003 21.575 45-49 21.375 29.04 27.834999999999997 21.75 50-54 21.0 29.294999999999998 27.705000000000002 22.0 55-59 21.584999999999997 29.38 27.27 21.765 60-64 21.044999999999998 28.744999999999997 27.560000000000002 22.650000000000002 65-69 21.245 28.854999999999997 27.834999999999997 22.065 70-74 21.355 28.605000000000004 27.785 22.255 75-79 21.745 28.595 27.38 22.28 80-84 21.815 28.425 27.779999999999998 21.98 85-89 21.240000000000002 28.24 28.62 21.9 90-94 21.38 28.84 27.57 22.21 95-99 21.75 28.175 27.82 22.255 100-104 21.775 28.345 27.439999999999998 22.439999999999998 105-109 21.5 28.99 27.584999999999997 21.925 110-114 22.125 27.560000000000002 28.04 22.275 115-119 21.09 28.360000000000003 28.595 21.955 120-124 21.709999999999997 27.395000000000003 28.425 22.470000000000002 125-129 21.455 28.21 28.09 22.245 130-134 21.715 28.15 27.96 22.175 135-139 21.09 28.139999999999997 28.7 22.07 140-144 21.735 28.325 28.38 21.560000000000002 145-149 22.935 28.255000000000003 27.200000000000003 21.61 150 22.975 28.249999999999996 26.625 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.5 19 2.5 20 3.0 21 3.0 22 4.0 23 4.0 24 4.5 25 6.0 26 6.5 27 7.5 28 11.5 29 17.5 30 24.0 31 30.5 32 37.5 33 54.5 34 78.5 35 79.5 36 92.5 37 123.5 38 148.5 39 174.0 40 201.0 41 215.0 42 239.0 43 259.5 44 251.0 45 258.0 46 241.0 47 229.0 48 220.5 49 198.5 50 163.0 51 127.0 52 101.5 53 77.0 54 71.5 55 58.0 56 42.5 57 29.5 58 20.5 59 17.0 60 14.0 61 11.0 62 9.0 63 6.5 64 3.0 65 2.0 66 2.5 67 2.5 68 3.5 69 4.0 70 2.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.9332638164755 92.0 2 3.8581856100104277 7.3999999999999995 3 0.20855057351407716 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.3375 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940540 spots for SRR11701745.sra Written 940540 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra Read 940536 spots for SRR11701745.sra Written 940536 spots for SRR11701745.sra SRR ids: ['SRR11701745.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cuyseq7f SRR11701745.sra spots: 18810724 blocks: [[1, 940536], [940537, 1881072], [1881073, 2821608], [2821609, 3762144], [3762145, 4702680], [4702681, 5643216], [5643217, 6583752], [6583753, 7524288], [7524289, 8464824], [8464825, 9405360], [9405361, 10345896], [10345897, 11286432], [11286433, 12226968], [12226969, 13167504], [13167505, 14108040], [14108041, 15048576], [15048577, 15989112], [15989113, 16929648], [16929649, 17870184], [17870185, 18810724]] SRR11701745 file size 6334266 SRR11701745 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701745 SRR11701745_1.fastq SRR11701745_2.fastq Input file: SRR11701745_1.fastq Paired file: SRR11701745_2.fastq trimmed: SRR11701745-trimmed-pair1.fastq, SRR11701745-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:34:34 2025 >> started Thu Feb 13 04:39:11 2025 >> done (276.358s) 18810724 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 18810718 (100.00%) read pairs available; of these: 557033 ( 2.96%) trimmed read pairs available after processing 18253685 (97.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 8 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 7 0.00% 29 2 0.00% 30 4 0.00% 31 7 0.00% 32 8 0.00% 33 10 0.00% 34 8 0.00% 35 7 0.00% 36 4 0.00% 37 7 0.00% 38 14 0.00% 39 5 0.00% 40 6 0.00% 41 8 0.00% 42 5 0.00% 43 4 0.00% 44 3 0.00% 45 7 0.00% 46 4 0.00% 47 5 0.00% 48 7 0.00% 49 2 0.00% 50 3 0.00% 51 6 0.00% 52 7 0.00% 53 5 0.00% 54 4 0.00% 55 6 0.00% 56 9 0.00% 57 3 0.00% 58 8 0.00% 59 8 0.00% 60 3 0.00% 61 3 0.00% 62 5 0.00% 63 6 0.00% 64 5 0.00% 65 4 0.00% 66 4 0.00% 67 5 0.00% 68 4 0.00% 69 4 0.00% 70 4 0.00% 71 1 0.00% 72 4 0.00% 73 3 0.00% 74 5 0.00% 75 2 0.00% 76 5 0.00% 77 2 0.00% 78 3 0.00% 79 4 0.00% 80 2 0.00% 81 3 0.00% 82 4 0.00% 83 3 0.00% 84 1 0.00% 85 0 0.00% 86 2 0.00% 87 4 0.00% 88 4 0.00% 89 8 0.00% 90 11 0.00% 91 10 0.00% 92 9 0.00% 93 13 0.00% 94 16 0.00% 95 14 0.00% 96 16 0.00% 97 14 0.00% 98 22 0.00% 99 31 0.00% 100 25 0.00% 101 35 0.00% 102 47 0.00% 103 43 0.00% 104 60 0.00% 105 53 0.00% 106 71 0.00% 107 79 0.00% 108 67 0.00% 109 92 0.00% 110 77 0.00% 111 85 0.00% 112 71 0.00% 113 98 0.00% 114 81 0.00% 115 99 0.00% 116 89 0.00% 117 87 0.00% 118 88 0.00% 119 95 0.00% 120 100 0.00% 121 95 0.00% 122 107 0.00% 123 114 0.00% 124 87 0.00% 125 131 0.00% 126 130 0.00% 127 116 0.00% 128 95 0.00% 129 86 0.00% 130 101 0.00% 131 76 0.00% 132 85 0.00% 133 101 0.00% 134 22580 0.12% 135 22910 0.12% 136 22216 0.12% 137 22206 0.12% 138 21366 0.11% 139 22498 0.12% 140 24015 0.13% 141 24838 0.13% 142 26709 0.14% 143 28447 0.15% 144 28567 0.15% 145 29308 0.16% 146 28922 0.15% 147 28794 0.15% 148 32739 0.17% 149 167570 0.89% 150 18253685 97.04% 18810718 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=5.10 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=3.6 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=139.93 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=18.2 sequence=GCAGCAGCAGCAA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.76 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=1.0 sequence=GTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=139.87 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=18.7 sequence=GCAGCAGCAGCAA SRR11701745 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:24:04 Started mapping on | Feb 13 05:24:15 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 36.45 Number of input reads | 18810718 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17302513 Uniquely mapped reads % | 91.98% Average mapped length | 297.78 Number of splices: Total | 13198526 Number of splices: Annotated (sjdb) | 12905455 Number of splices: GT/AG | 12971955 Number of splices: GC/AG | 171182 Number of splices: AT/AC | 16391 Number of splices: Non-canonical | 38998 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406412 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 3330 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1101793 1101793 1101793 N_multimapping 406412 406412 406412 N_noFeature 1052360 9038475 9194705 N_ambiguous 252033 65880 65118 UnstrandedReadsAssigned:15998120 PositiveStrandReadsAssigned:8198158 NegativeStrandReadsAssigned:8042690 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701745 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701745-trimmed-pair1.fastq SRR11701745-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,810,718 reads, 16,323,127 reads pseudoaligned [quant] estimated average fragment length: 256.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR11701745.ke.tsv 34699 SRR11701745.se.tsv 87100 total ==> SRR11701745.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.72 2308 57.1736 Potri.005G024800.1.v4.1 1035 779.721 931 52.1379 Potri.004G059700.1.v4.1 961 705.721 41 2.53685 Potri.007G009000.2.v4.1 1416 1160.72 7 0.263338 Potri.003G141000.2.v4.1 2943 2687.72 378.211 6.1446 Potri.016G087400.1.v4.1 270 59.3672 887 652.409 Potri.015G069301.1.v4.1 564 309.284 1 0.141184 Potri.010G195200.1.v4.1 1773 1517.72 57 1.63993 Potri.012G127500.1.v4.1 977 721.721 10729 649.132 ==> SRR11701745.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 191 Potri.001G233950.v4.1 12 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 8 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 30 Potri.001G452600.v4.1 17 SRR11701745 completed mapping pipeline successfully