Starting /dee2/code/volunteer_pipeline.sh SRR11701746 current disk space = 3052007895040 free memory = 1580731380 SRR11701746 SRAfilesize ed22d90da874e1bee59df138b25c85db SRR11701746.sra SRR11701746.sra file validated SRR11701746 is paired end SRR11701746 is conventional basespace SRR11701746 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701746_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25 32.0 32.0 32.0 32.0 32.0 2 31.72625 32.0 32.0 32.0 32.0 32.0 3 36.04625 37.0 37.0 37.0 32.0 37.0 4 36.40125 37.0 37.0 37.0 37.0 37.0 5 36.33625 37.0 37.0 37.0 37.0 37.0 6 39.6335 41.0 41.0 41.0 37.0 41.0 7 39.547 41.0 41.0 41.0 37.0 41.0 8 39.521 41.0 41.0 41.0 37.0 41.0 9 39.89075 41.0 41.0 41.0 37.0 41.0 10-14 39.6036 41.0 41.0 41.0 37.0 41.0 15-19 39.41105 41.0 41.0 41.0 37.0 41.0 20-24 39.57975 41.0 41.0 41.0 37.0 41.0 25-29 39.297250000000005 41.0 41.0 41.0 37.0 41.0 30-34 38.9237 41.0 41.0 41.0 35.0 41.0 35-39 39.6877 41.0 41.0 41.0 37.0 41.0 40-44 39.820049999999995 41.0 41.0 41.0 37.8 41.0 45-49 40.18085 41.0 41.0 41.0 37.8 41.0 50-54 40.0736 41.0 41.0 41.0 37.8 41.0 55-59 40.07705 41.0 41.0 41.0 37.0 41.0 60-64 40.015699999999995 41.0 41.0 41.0 37.0 41.0 65-69 39.8589 41.0 41.0 41.0 37.0 41.0 70-74 39.91055 41.0 41.0 41.0 37.0 41.0 75-79 39.536699999999996 41.0 41.0 41.0 37.0 41.0 80-84 39.2936 41.0 41.0 41.0 36.0 41.0 85-89 39.599000000000004 41.0 41.0 41.0 37.0 41.0 90-94 39.4815 41.0 41.0 41.0 37.0 41.0 95-99 39.70295 41.0 41.0 41.0 37.0 41.0 100-104 39.54255 41.0 41.0 41.0 37.0 41.0 105-109 39.52759999999999 41.0 41.0 41.0 37.0 41.0 110-114 39.21175000000001 41.0 40.2 41.0 36.0 41.0 115-119 39.534299999999995 41.0 41.0 41.0 37.0 41.0 120-124 39.54535 41.0 41.0 41.0 37.0 41.0 125-129 38.992599999999996 41.0 41.0 41.0 35.0 41.0 130-134 39.13245 41.0 41.0 41.0 36.0 41.0 135-139 38.607000000000006 41.0 38.6 41.0 33.0 41.0 140-144 38.4627 41.0 37.8 41.0 33.0 41.0 145-149 37.716950000000004 41.0 37.0 41.0 30.0 41.0 150 37.8795 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 1.0 29 12.0 30 26.0 31 28.0 32 41.0 33 59.0 34 84.0 35 124.0 36 151.0 37 226.0 38 378.0 39 650.0 40 2220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.574999999999996 18.099999999999998 16.55 33.775 2 25.15 25.85 31.05 17.95 3 22.05 29.225 24.85 23.875 4 23.7 37.25 19.35 19.7 5 23.1 36.225 22.375 18.3 6 16.275000000000002 40.875 22.55 20.3 7 16.825000000000003 19.5 42.9 20.775 8 19.775000000000002 22.5 29.299999999999997 28.425 9 18.6 23.474999999999998 31.45 26.474999999999998 10-14 19.950000000000003 30.36 27.46 22.23 15-19 21.265 28.744999999999997 28.294999999999998 21.695 20-24 21.575 29.185 27.24 22.0 25-29 21.044999999999998 30.4 26.93 21.625 30-34 21.055 29.755 27.365000000000002 21.825 35-39 21.425 29.235 27.860000000000003 21.48 40-44 20.915 29.654999999999998 27.445000000000004 21.985 45-49 21.2 29.505 27.515 21.78 50-54 21.765 28.93 27.71 21.595 55-59 21.775 29.255 27.279999999999998 21.69 60-64 20.78 29.134999999999998 27.465 22.62 65-69 21.36 29.315 27.139999999999997 22.185 70-74 21.55 29.294999999999998 27.744999999999997 21.41 75-79 21.555 28.71 28.17 21.565 80-84 21.755 28.884999999999998 27.994999999999997 21.365000000000002 85-89 21.27 29.425 27.58 21.725 90-94 21.615000000000002 29.09 27.82 21.475 95-99 21.605 28.799999999999997 27.785 21.81 100-104 21.505 28.09 28.125 22.28 105-109 21.275 28.58 28.485 21.66 110-114 21.34 28.87 28.610000000000003 21.18 115-119 21.82 28.08 28.165000000000003 21.935 120-124 21.73 28.615000000000002 27.625 22.03 125-129 21.224999999999998 29.175 27.925 21.675 130-134 21.785 28.23 28.04 21.945 135-139 21.555 28.355000000000004 28.865000000000002 21.224999999999998 140-144 21.865000000000002 28.194999999999997 27.939999999999998 22.0 145-149 22.384999999999998 28.455000000000002 27.224999999999998 21.935 150 22.175 29.475 27.3 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 2.0 18 3.0 19 2.0 20 2.5 21 2.5 22 1.5 23 4.5 24 8.0 25 9.0 26 11.0 27 14.0 28 13.5 29 14.5 30 29.0 31 43.5 32 52.0 33 62.5 34 70.0 35 81.5 36 101.5 37 124.5 38 148.0 39 173.5 40 198.0 41 216.5 42 234.5 43 265.0 44 264.0 45 241.0 46 238.5 47 235.0 48 215.5 49 180.5 50 139.0 51 123.0 52 99.0 53 76.0 54 67.5 55 53.0 56 43.5 57 29.0 58 25.0 59 17.5 60 14.0 61 12.0 62 7.0 63 7.5 64 5.0 65 3.0 66 3.0 67 2.0 68 1.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40561827251247 90.85 2 4.305592018902599 8.200000000000001 3 0.2362824888422158 0.675 4 0.026253609871357313 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026253609871357313 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.325 0.0 0.0 0.0 0.0 138 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTATCC 10 0.006973645 144.0 3 >>END_MODULE SRR11701746 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701746_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53625 32.0 32.0 32.0 32.0 32.0 2 31.47375 32.0 32.0 32.0 32.0 32.0 3 34.88 37.0 32.0 37.0 32.0 37.0 4 36.33875 37.0 37.0 37.0 37.0 37.0 5 36.53375 37.0 37.0 37.0 37.0 37.0 6 40.04125 41.0 41.0 41.0 37.0 41.0 7 39.78375 41.0 41.0 41.0 37.0 41.0 8 40.255 41.0 41.0 41.0 37.0 41.0 9 40.13525 41.0 41.0 41.0 37.0 41.0 10-14 40.282 41.0 41.0 41.0 40.2 41.0 15-19 39.80155 41.0 41.0 41.0 37.0 41.0 20-24 40.0113 41.0 41.0 41.0 37.0 41.0 25-29 39.8584 41.0 41.0 41.0 37.0 41.0 30-34 39.87525 41.0 41.0 41.0 37.0 41.0 35-39 39.8827 41.0 41.0 41.0 37.0 41.0 40-44 39.837399999999995 41.0 41.0 41.0 37.0 41.0 45-49 39.89515 41.0 41.0 41.0 37.0 41.0 50-54 39.91175 41.0 41.0 41.0 37.0 41.0 55-59 39.949349999999995 41.0 41.0 41.0 37.0 41.0 60-64 39.7701 41.0 41.0 41.0 37.0 41.0 65-69 39.5696 41.0 41.0 41.0 37.0 41.0 70-74 38.95345 41.0 41.0 41.0 34.0 41.0 75-79 38.43 41.0 37.8 41.0 32.0 41.0 80-84 38.78555 41.0 40.2 41.0 33.0 41.0 85-89 38.412099999999995 41.0 39.4 41.0 32.0 41.0 90-94 39.14875000000001 41.0 41.0 41.0 36.0 41.0 95-99 39.063300000000005 41.0 40.2 41.0 35.0 41.0 100-104 38.725199999999994 41.0 40.2 41.0 33.0 41.0 105-109 37.9782 41.0 37.0 41.0 30.0 41.0 110-114 37.90335 41.0 37.0 41.0 30.0 41.0 115-119 38.132099999999994 41.0 37.0 41.0 31.0 41.0 120-124 38.5546 41.0 38.6 41.0 33.0 41.0 125-129 37.3363 41.0 37.0 41.0 28.0 41.0 130-134 37.18305 41.0 37.0 41.0 27.0 41.0 135-139 37.150600000000004 41.0 37.0 41.0 27.0 41.0 140-144 36.957899999999995 41.0 37.0 41.0 27.0 41.0 145-149 36.2535 41.0 34.0 41.0 24.0 41.0 150 36.5245 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 7.0 29 13.0 30 57.0 31 70.0 32 81.0 33 116.0 34 138.0 35 150.0 36 207.0 37 248.0 38 376.0 39 602.0 40 1935.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.998998246932132 16.87953919358878 16.20335587277736 38.91810668670173 2 23.321643286573146 27.880761523046093 29.559118236472948 19.238476953907817 3 23.175 32.525 24.05 20.25 4 24.525 35.475 19.5 20.5 5 23.625 38.05 20.849999999999998 17.474999999999998 6 16.55 38.5 23.75 21.2 7 17.549999999999997 18.825 39.775 23.849999999999998 8 17.75 23.150000000000002 28.549999999999997 30.55 9 19.45 23.549999999999997 31.374999999999996 25.624999999999996 10-14 20.955 30.45 27.065 21.529999999999998 15-19 21.27 28.595 28.095 22.040000000000003 20-24 21.73 28.945 27.49 21.834999999999997 25-29 21.57 29.470000000000002 27.250000000000004 21.709999999999997 30-34 21.19 28.68 28.315 21.815 35-39 20.965 29.755 27.439999999999998 21.84 40-44 21.63 29.054999999999996 28.125 21.19 45-49 21.6 29.215000000000003 27.61 21.575 50-54 21.165 29.5 27.68 21.654999999999998 55-59 21.529999999999998 28.860000000000003 27.97 21.64 60-64 21.295 28.57 28.08 22.055 65-69 21.665 28.910000000000004 27.495000000000005 21.93 70-74 21.59 28.910000000000004 27.485 22.015 75-79 21.905 28.689999999999998 27.845 21.560000000000002 80-84 21.81 28.29 28.005000000000003 21.895 85-89 21.634999999999998 28.439999999999998 27.779999999999998 22.145 90-94 21.89 27.884999999999998 27.955000000000002 22.27 95-99 21.425 28.494999999999997 28.345 21.735 100-104 21.535 28.24 28.33 21.895 105-109 21.34 28.194999999999997 28.51 21.955 110-114 21.805 27.650000000000002 28.34 22.205 115-119 21.65 28.265 27.88 22.205 120-124 21.41 27.915 28.720000000000002 21.955 125-129 21.59 28.38 28.349999999999998 21.68 130-134 22.07 28.13 28.37 21.43 135-139 21.9 28.255000000000003 28.71 21.135 140-144 22.415 28.599999999999998 28.060000000000002 20.925 145-149 22.509999999999998 28.815 27.584999999999997 21.09 150 21.475 28.075 29.675 20.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.5 14 2.5 15 2.0 16 2.0 17 2.5 18 3.5 19 3.0 20 1.5 21 0.5 22 4.5 23 9.0 24 6.5 25 5.0 26 8.5 27 11.5 28 13.5 29 15.5 30 23.5 31 30.5 32 41.5 33 63.5 34 71.5 35 85.0 36 99.5 37 105.5 38 138.5 39 173.5 40 186.5 41 218.5 42 264.0 43 266.5 44 228.5 45 229.5 46 254.0 47 229.0 48 202.0 49 187.0 50 163.5 51 136.0 52 113.0 53 93.5 54 76.5 55 62.0 56 43.0 57 29.5 58 23.5 59 17.0 60 14.0 61 10.0 62 4.5 63 4.0 64 4.5 65 4.0 66 2.5 67 2.0 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.29936974789915 90.725 2 4.438025210084033 8.450000000000001 3 0.1838235294117647 0.525 4 0.07878151260504201 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGCA 10 0.006973645 144.0 5 CTGGAAC 10 0.006973645 144.0 1 >>END_MODULE Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971275 spots for SRR11701746.sra Written 971275 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra Read 971270 spots for SRR11701746.sra Written 971270 spots for SRR11701746.sra SRR ids: ['SRR11701746.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xc8veuzz SRR11701746.sra spots: 19425405 blocks: [[1, 971270], [971271, 1942540], [1942541, 2913810], [2913811, 3885080], [3885081, 4856350], [4856351, 5827620], [5827621, 6798890], [6798891, 7770160], [7770161, 8741430], [8741431, 9712700], [9712701, 10683970], [10683971, 11655240], [11655241, 12626510], [12626511, 13597780], [13597781, 14569050], [14569051, 15540320], [15540321, 16511590], [16511591, 17482860], [17482861, 18454130], [18454131, 19425405]] SRR11701746 file size 6541961 SRR11701746 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701746 SRR11701746_1.fastq SRR11701746_2.fastq Input file: SRR11701746_1.fastq Paired file: SRR11701746_2.fastq trimmed: SRR11701746-trimmed-pair1.fastq, SRR11701746-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:50:20 2025 >> started Thu Feb 13 04:55:55 2025 >> done (334.880s) 19425405 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 19425400 (100.00%) read pairs available; of these: 682699 ( 3.51%) trimmed read pairs available after processing 18742701 (96.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 2 0.00% 32 3 0.00% 33 8 0.00% 34 6 0.00% 35 7 0.00% 36 6 0.00% 37 9 0.00% 38 5 0.00% 39 7 0.00% 40 7 0.00% 41 5 0.00% 42 6 0.00% 43 8 0.00% 44 4 0.00% 45 8 0.00% 46 7 0.00% 47 4 0.00% 48 3 0.00% 49 7 0.00% 50 5 0.00% 51 6 0.00% 52 6 0.00% 53 6 0.00% 54 4 0.00% 55 7 0.00% 56 3 0.00% 57 6 0.00% 58 3 0.00% 59 1 0.00% 60 6 0.00% 61 8 0.00% 62 7 0.00% 63 1 0.00% 64 5 0.00% 65 7 0.00% 66 8 0.00% 67 4 0.00% 68 3 0.00% 69 5 0.00% 70 6 0.00% 71 3 0.00% 72 1 0.00% 73 2 0.00% 74 0 0.00% 75 3 0.00% 76 3 0.00% 77 5 0.00% 78 2 0.00% 79 1 0.00% 80 3 0.00% 81 2 0.00% 82 1 0.00% 83 4 0.00% 84 1 0.00% 85 3 0.00% 86 2 0.00% 87 3 0.00% 88 7 0.00% 89 1 0.00% 90 4 0.00% 91 4 0.00% 92 10 0.00% 93 10 0.00% 94 12 0.00% 95 16 0.00% 96 13 0.00% 97 21 0.00% 98 28 0.00% 99 29 0.00% 100 30 0.00% 101 45 0.00% 102 35 0.00% 103 55 0.00% 104 46 0.00% 105 55 0.00% 106 56 0.00% 107 62 0.00% 108 98 0.00% 109 71 0.00% 110 101 0.00% 111 61 0.00% 112 85 0.00% 113 64 0.00% 114 80 0.00% 115 86 0.00% 116 92 0.00% 117 94 0.00% 118 99 0.00% 119 87 0.00% 120 99 0.00% 121 97 0.00% 122 108 0.00% 123 116 0.00% 124 101 0.00% 125 106 0.00% 126 106 0.00% 127 114 0.00% 128 110 0.00% 129 108 0.00% 130 86 0.00% 131 89 0.00% 132 79 0.00% 133 83 0.00% 134 30635 0.16% 135 30887 0.16% 136 29827 0.15% 137 29635 0.15% 138 29573 0.15% 139 30346 0.16% 140 31769 0.16% 141 33008 0.17% 142 35853 0.18% 143 36757 0.19% 144 37196 0.19% 145 37569 0.19% 146 37856 0.19% 147 37395 0.19% 148 40681 0.21% 149 170458 0.88% 150 18742701 96.49% 19425400 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.73 fanout-score-rank=37 prefix-density=0.41 prefix-fanout=1.0 sequence=GTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=23.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.6 sequence=GAGAAGGCAATGAGAGATGCGATTGATGGAATGAACGGCCAAGACCTTGATGGGCGTAACATCACCGTGAATGAAGCACAATCCCGCGGAAGCGGCGGTGGTGGCGGAGGTGGGGGCTACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.75 fanout-score-rank=39 prefix-density=0.39 prefix-fanout=1.0 sequence=GTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=99.64 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.6 sequence=TTTTTCTTTTTTTTT SRR11701746 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:36:38 Started mapping on | Feb 13 05:36:40 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 62.83 Number of input reads | 19425400 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17733792 Uniquely mapped reads % | 91.29% Average mapped length | 297.44 Number of splices: Total | 13457539 Number of splices: Annotated (sjdb) | 13158530 Number of splices: GT/AG | 13231086 Number of splices: GC/AG | 170762 Number of splices: AT/AC | 17507 Number of splices: Non-canonical | 38184 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421876 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 3939 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1269732 1269732 1269732 N_multimapping 421876 421876 421876 N_noFeature 1247576 9358342 9506472 N_ambiguous 244390 64551 64022 UnstrandedReadsAssigned:16241826 PositiveStrandReadsAssigned:8310899 NegativeStrandReadsAssigned:8163298 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701746 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701746-trimmed-pair1.fastq SRR11701746-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,425,400 reads, 16,607,317 reads pseudoaligned [quant] estimated average fragment length: 248.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR11701746.ke.tsv 34699 SRR11701746.se.tsv 87100 total ==> SRR11701746.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.77 1194 29.868 Potri.005G024800.1.v4.1 1035 787.775 374 21.0298 Potri.004G059700.1.v4.1 961 713.785 39 2.42026 Potri.007G009000.2.v4.1 1416 1168.77 7 0.265297 Potri.003G141000.2.v4.1 2943 2695.77 333 5.47175 Potri.016G087400.1.v4.1 270 62.3281 1158 822.983 Potri.015G069301.1.v4.1 564 317.279 1 0.139612 Potri.010G195200.1.v4.1 1773 1525.77 219 6.35798 Potri.012G127500.1.v4.1 977 729.775 5633 341.914 ==> SRR11701746.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 351 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 567 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 10 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 29 Potri.001G452600.v4.1 20 SRR11701746 completed mapping pipeline successfully