Starting /dee2/code/volunteer_pipeline.sh SRR11701747 current disk space = 3052099629056 free memory = 1580088112 SRR11701747 SRAfilesize c8b3389742e72f64a5a7757de7046e52 SRR11701747.sra SRR11701747.sra file validated SRR11701747 is paired end SRR11701747 is conventional basespace SRR11701747 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701747_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4775 32.0 32.0 32.0 32.0 32.0 2 31.78 32.0 32.0 32.0 32.0 32.0 3 35.995 37.0 37.0 37.0 32.0 37.0 4 36.3725 37.0 37.0 37.0 37.0 37.0 5 36.3475 37.0 37.0 37.0 37.0 37.0 6 39.61675 41.0 41.0 41.0 37.0 41.0 7 39.64025 41.0 41.0 41.0 37.0 41.0 8 39.62375 41.0 41.0 41.0 37.0 41.0 9 39.935 41.0 41.0 41.0 37.0 41.0 10-14 39.63440000000001 41.0 41.0 41.0 37.0 41.0 15-19 39.42265 41.0 41.0 41.0 37.0 41.0 20-24 39.50675 41.0 41.0 41.0 37.0 41.0 25-29 39.1845 41.0 41.0 41.0 37.0 41.0 30-34 38.91315 41.0 41.0 41.0 35.0 41.0 35-39 39.565149999999996 41.0 41.0 41.0 37.0 41.0 40-44 39.767399999999995 41.0 41.0 41.0 37.0 41.0 45-49 40.134 41.0 41.0 41.0 37.0 41.0 50-54 39.940000000000005 41.0 41.0 41.0 37.0 41.0 55-59 40.08005 41.0 41.0 41.0 37.0 41.0 60-64 39.915749999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.6896 41.0 41.0 41.0 37.0 41.0 70-74 39.88674999999999 41.0 41.0 41.0 37.0 41.0 75-79 39.4996 41.0 40.2 41.0 37.0 41.0 80-84 39.25215000000001 41.0 41.0 41.0 36.0 41.0 85-89 39.50405 41.0 41.0 41.0 37.0 41.0 90-94 39.493550000000006 41.0 41.0 41.0 37.0 41.0 95-99 39.501850000000005 41.0 41.0 41.0 37.0 41.0 100-104 39.383 41.0 41.0 41.0 37.0 41.0 105-109 39.406549999999996 41.0 41.0 41.0 37.0 41.0 110-114 39.12545 41.0 40.2 41.0 36.0 41.0 115-119 39.4516 41.0 41.0 41.0 37.0 41.0 120-124 39.4572 41.0 41.0 41.0 37.0 41.0 125-129 38.81455 41.0 41.0 41.0 33.0 41.0 130-134 38.9928 41.0 41.0 41.0 35.0 41.0 135-139 38.53305 41.0 38.6 41.0 33.0 41.0 140-144 38.35905 41.0 37.8 41.0 33.0 41.0 145-149 37.7154 41.0 37.0 41.0 31.0 41.0 150 37.80275 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 4.0 29 13.0 30 27.0 31 26.0 32 57.0 33 61.0 34 98.0 35 124.0 36 139.0 37 235.0 38 380.0 39 646.0 40 2190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.050000000000004 17.925 15.1 33.925 2 25.624999999999996 24.7 31.15 18.525 3 21.875 29.775000000000002 26.174999999999997 22.175 4 24.525 35.725 19.650000000000002 20.1 5 24.575 37.475 20.825 17.125 6 17.224999999999998 39.25 22.875 20.65 7 16.950000000000003 18.575 42.475 22.0 8 19.975 22.3 28.599999999999998 29.125 9 19.0 22.725 32.225 26.05 10-14 20.94 29.720000000000002 27.565 21.775 15-19 21.099999999999998 28.720000000000002 28.29 21.89 20-24 21.404999999999998 29.485 27.01 22.1 25-29 21.375 29.75 27.415 21.46 30-34 21.19 29.01 27.525 22.275 35-39 21.0 29.365000000000002 27.650000000000002 21.985 40-44 21.27 29.45 27.465 21.815 45-49 21.62 29.2 27.089999999999996 22.09 50-54 22.015 29.715000000000003 26.640000000000004 21.63 55-59 21.475 28.675 27.54 22.31 60-64 21.715 28.62 27.994999999999997 21.67 65-69 21.255 29.054999999999996 27.965 21.725 70-74 21.115000000000002 28.535 28.37 21.98 75-79 21.595 28.455000000000002 28.360000000000003 21.59 80-84 21.285 28.360000000000003 28.655 21.7 85-89 21.645 28.060000000000002 28.255000000000003 22.040000000000003 90-94 21.42 28.325 28.12 22.134999999999998 95-99 21.58 28.775000000000002 27.825 21.82 100-104 21.78 29.104999999999997 27.365000000000002 21.75 105-109 21.535 28.78 28.16 21.525 110-114 21.95 27.765 28.565 21.72 115-119 21.665 28.685 27.88 21.77 120-124 21.97 27.865000000000002 27.935 22.23 125-129 22.23 27.815 27.855 22.1 130-134 22.28 27.534999999999997 28.199999999999996 21.985 135-139 21.235 28.225 28.660000000000004 21.88 140-144 21.995 27.815 28.435 21.755 145-149 22.58 28.54 27.634999999999998 21.245 150 20.925 29.325000000000003 27.6 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.0 17 0.5 18 2.5 19 2.5 20 2.5 21 3.0 22 1.5 23 6.0 24 9.0 25 7.5 26 7.0 27 9.0 28 13.0 29 23.0 30 35.5 31 41.5 32 49.0 33 57.5 34 67.5 35 81.0 36 100.5 37 129.5 38 158.0 39 175.0 40 177.0 41 208.5 42 235.5 43 239.5 44 254.0 45 253.5 46 232.0 47 216.5 48 200.5 49 176.0 50 159.5 51 137.0 52 111.5 53 85.0 54 65.0 55 55.5 56 44.5 57 31.5 58 24.5 59 19.0 60 17.0 61 15.0 62 10.5 63 9.0 64 10.0 65 8.0 66 5.5 67 4.0 68 2.5 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7691303212327 91.675 2 3.9958213632802297 7.6499999999999995 3 0.23504831548707233 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1375 0.0 0.0 0.0 0.0 136-137 0.5125 0.0 0.0 0.0 0.0 138 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCACC 10 0.006973645 144.0 7 CACAAGC 10 0.006973645 144.0 2 ACAAGCC 10 0.006973645 144.0 3 CAAGCCC 10 0.006973645 144.0 4 >>END_MODULE SRR11701747 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701747_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6475 32.0 32.0 32.0 32.0 32.0 2 31.46 32.0 32.0 32.0 32.0 32.0 3 34.92875 37.0 32.0 37.0 32.0 37.0 4 36.21875 37.0 37.0 37.0 32.0 37.0 5 36.375 37.0 37.0 37.0 37.0 37.0 6 39.981 41.0 41.0 41.0 37.0 41.0 7 39.8025 41.0 41.0 41.0 37.0 41.0 8 40.1045 41.0 41.0 41.0 37.0 41.0 9 40.00575 41.0 41.0 41.0 37.0 41.0 10-14 40.2068 41.0 41.0 41.0 37.8 41.0 15-19 39.7264 41.0 41.0 41.0 37.0 41.0 20-24 39.89104999999999 41.0 41.0 41.0 37.0 41.0 25-29 39.77650000000001 41.0 41.0 41.0 37.0 41.0 30-34 39.8279 41.0 41.0 41.0 37.0 41.0 35-39 39.9153 41.0 41.0 41.0 37.0 41.0 40-44 39.79254999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.8902 41.0 41.0 41.0 37.0 41.0 50-54 39.902150000000006 41.0 41.0 41.0 37.0 41.0 55-59 39.9409 41.0 41.0 41.0 37.0 41.0 60-64 39.7675 41.0 41.0 41.0 37.0 41.0 65-69 39.547900000000006 41.0 41.0 41.0 37.0 41.0 70-74 38.8671 41.0 41.0 41.0 33.0 41.0 75-79 38.4346 41.0 37.8 41.0 32.0 41.0 80-84 38.65219999999999 41.0 39.4 41.0 32.0 41.0 85-89 38.44035 41.0 39.4 41.0 32.0 41.0 90-94 39.10905 41.0 41.0 41.0 35.0 41.0 95-99 39.01925 41.0 40.2 41.0 35.0 41.0 100-104 38.61765 41.0 40.2 41.0 32.0 41.0 105-109 37.91605 41.0 37.0 41.0 30.0 41.0 110-114 37.815349999999995 41.0 37.0 41.0 30.0 41.0 115-119 38.178650000000005 41.0 37.0 41.0 31.0 41.0 120-124 38.603049999999996 41.0 38.6 41.0 33.0 41.0 125-129 37.35334999999999 41.0 37.0 41.0 28.0 41.0 130-134 37.17355 41.0 37.0 41.0 27.0 41.0 135-139 37.0108 41.0 37.0 41.0 27.0 41.0 140-144 37.04735 41.0 37.0 41.0 27.0 41.0 145-149 36.2407 41.0 34.0 41.0 23.0 41.0 150 36.3865 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 8.0 29 16.0 30 50.0 31 75.0 32 88.0 33 120.0 34 113.0 35 157.0 36 214.0 37 279.0 38 404.0 39 610.0 40 1866.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.263631815907953 16.558279139569784 15.93296648324162 40.24512256128064 2 26.102204408817638 25.726452905811627 29.909819639278556 18.261523046092183 3 23.875 31.324999999999996 24.075 20.724999999999998 4 23.849999999999998 36.35 20.025000000000002 19.775000000000002 5 24.675 37.2 20.349999999999998 17.775 6 16.575 40.075 22.85 20.5 7 17.05 18.725 41.075 23.150000000000002 8 18.375 22.6 30.3 28.725 9 20.925 22.425 32.275 24.375 10-14 21.029999999999998 30.04 27.215 21.715 15-19 21.21 28.305000000000003 28.735 21.75 20-24 21.245 29.815 27.1 21.84 25-29 21.529999999999998 29.935000000000002 26.6 21.935 30-34 20.84 29.885 27.675 21.6 35-39 20.96 29.134999999999998 28.299999999999997 21.605 40-44 20.875 28.76 28.175 22.189999999999998 45-49 21.385 29.415000000000003 26.915 22.285 50-54 21.43 29.32 27.815 21.435000000000002 55-59 21.584999999999997 29.4 26.779999999999998 22.235 60-64 21.48 28.925 28.110000000000003 21.485000000000003 65-69 21.01 29.165000000000003 27.639999999999997 22.185 70-74 21.955 28.645 27.54 21.86 75-79 21.68 29.13 27.439999999999998 21.75 80-84 21.375 28.835 28.499999999999996 21.29 85-89 21.93 29.044999999999998 27.339999999999996 21.685 90-94 21.595 28.63 27.87 21.905 95-99 21.790000000000003 28.335 27.955000000000002 21.92 100-104 21.215 28.975 27.955000000000002 21.855 105-109 21.565 28.46 28.51 21.465 110-114 22.040000000000003 27.73 28.555000000000003 21.675 115-119 22.35 28.435 27.515 21.7 120-124 21.865000000000002 27.615000000000002 28.15 22.37 125-129 22.0 27.884999999999998 28.194999999999997 21.92 130-134 22.15 27.63 28.205000000000002 22.015 135-139 21.26 28.015 29.060000000000002 21.665 140-144 22.49 28.37 27.794999999999998 21.345 145-149 21.87 28.52 27.47 22.14 150 21.099999999999998 27.950000000000003 29.475 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 1.5 18 1.0 19 2.0 20 4.0 21 5.0 22 4.0 23 5.0 24 6.0 25 7.5 26 10.5 27 11.0 28 13.5 29 19.0 30 30.0 31 34.5 32 43.5 33 64.5 34 78.0 35 88.0 36 121.0 37 138.5 38 138.5 39 165.5 40 188.0 41 209.0 42 222.5 43 240.5 44 240.0 45 241.0 46 252.0 47 226.0 48 200.5 49 190.5 50 164.0 51 132.5 52 107.0 53 83.0 54 67.0 55 44.0 56 37.5 57 38.0 58 32.0 59 20.0 60 11.0 61 9.0 62 9.5 63 9.0 64 8.0 65 8.5 66 4.5 67 2.5 68 2.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.89649764767381 91.725 2 3.8159958180867743 7.3 3 0.20909566126502874 0.6 4 0.026136957658128592 0.1 5 0.026136957658128592 0.125 6 0.026136957658128592 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 6 0.15 No Hit CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0125 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.17500000000000002 0.0 0.0 0.0 0.0 136-137 0.5625 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGATCA 10 0.006973645 144.0 1 GGAGTCT 10 0.006973645 144.0 8 >>END_MODULE Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949138 spots for SRR11701747.sra Written 949138 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra Read 949119 spots for SRR11701747.sra Written 949119 spots for SRR11701747.sra SRR ids: ['SRR11701747.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e7vjqtyv SRR11701747.sra spots: 18982399 blocks: [[1, 949119], [949120, 1898238], [1898239, 2847357], [2847358, 3796476], [3796477, 4745595], [4745596, 5694714], [5694715, 6643833], [6643834, 7592952], [7592953, 8542071], [8542072, 9491190], [9491191, 10440309], [10440310, 11389428], [11389429, 12338547], [12338548, 13287666], [13287667, 14236785], [14236786, 15185904], [15185905, 16135023], [16135024, 17084142], [17084143, 18033261], [18033262, 18982399]] SRR11701747 file size 6392274 SRR11701747 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701747 SRR11701747_1.fastq SRR11701747_2.fastq Input file: SRR11701747_1.fastq Paired file: SRR11701747_2.fastq trimmed: SRR11701747-trimmed-pair1.fastq, SRR11701747-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:26:48 2025 >> started Thu Feb 13 04:37:28 2025 >> done (640.136s) 18982399 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 18982397 (100.00%) read pairs available; of these: 626776 ( 3.30%) trimmed read pairs available after processing 18355621 (96.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 9 0.00% 31 7 0.00% 32 6 0.00% 33 3 0.00% 34 9 0.00% 35 1 0.00% 36 9 0.00% 37 4 0.00% 38 2 0.00% 39 6 0.00% 40 3 0.00% 41 5 0.00% 42 5 0.00% 43 3 0.00% 44 7 0.00% 45 5 0.00% 46 8 0.00% 47 6 0.00% 48 10 0.00% 49 4 0.00% 50 4 0.00% 51 7 0.00% 52 4 0.00% 53 4 0.00% 54 6 0.00% 55 6 0.00% 56 4 0.00% 57 6 0.00% 58 3 0.00% 59 3 0.00% 60 7 0.00% 61 9 0.00% 62 7 0.00% 63 3 0.00% 64 4 0.00% 65 0 0.00% 66 2 0.00% 67 6 0.00% 68 1 0.00% 69 2 0.00% 70 3 0.00% 71 2 0.00% 72 2 0.00% 73 2 0.00% 74 3 0.00% 75 4 0.00% 76 3 0.00% 77 2 0.00% 78 1 0.00% 79 1 0.00% 80 4 0.00% 81 2 0.00% 82 3 0.00% 83 3 0.00% 84 1 0.00% 85 2 0.00% 86 6 0.00% 87 4 0.00% 88 5 0.00% 89 7 0.00% 90 5 0.00% 91 12 0.00% 92 13 0.00% 93 5 0.00% 94 20 0.00% 95 10 0.00% 96 13 0.00% 97 22 0.00% 98 28 0.00% 99 39 0.00% 100 29 0.00% 101 41 0.00% 102 39 0.00% 103 42 0.00% 104 47 0.00% 105 52 0.00% 106 57 0.00% 107 44 0.00% 108 64 0.00% 109 95 0.00% 110 73 0.00% 111 85 0.00% 112 73 0.00% 113 78 0.00% 114 87 0.00% 115 107 0.00% 116 103 0.00% 117 88 0.00% 118 83 0.00% 119 99 0.00% 120 100 0.00% 121 109 0.00% 122 95 0.00% 123 85 0.00% 124 91 0.00% 125 105 0.00% 126 142 0.00% 127 99 0.00% 128 114 0.00% 129 74 0.00% 130 94 0.00% 131 86 0.00% 132 85 0.00% 133 93 0.00% 134 27687 0.15% 135 27327 0.14% 136 26825 0.14% 137 26608 0.14% 138 26317 0.14% 139 27299 0.14% 140 28542 0.15% 141 29367 0.15% 142 31717 0.17% 143 32907 0.17% 144 33895 0.18% 145 34355 0.18% 146 33140 0.17% 147 33520 0.18% 148 36783 0.19% 149 167279 0.88% 150 18355621 96.70% 18982397 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=37 prefix-density=0.36 prefix-fanout=1.1 sequence=GTGACCAGACTACTTCTTTTTAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=170.93 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=13.8 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=37 prefix-density=0.15 prefix-fanout=2.1 sequence=GCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGAGCCCAGCAATGCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=164.18 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=20.9 sequence=GCAGCAGCAGCAA SRR11701747 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:38:24 Started mapping on | Feb 13 05:38:36 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 68.54 Number of input reads | 18982397 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17326522 Uniquely mapped reads % | 91.28% Average mapped length | 297.51 Number of splices: Total | 13087145 Number of splices: Annotated (sjdb) | 12794084 Number of splices: GT/AG | 12862380 Number of splices: GC/AG | 170014 Number of splices: AT/AC | 16614 Number of splices: Non-canonical | 38137 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410370 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 3795 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.52% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1245505 1245505 1245505 N_multimapping 410370 410370 410370 N_noFeature 1228772 9154368 9287897 N_ambiguous 227860 58004 57512 UnstrandedReadsAssigned:15869890 PositiveStrandReadsAssigned:8114150 NegativeStrandReadsAssigned:7981113 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701747 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701747-trimmed-pair1.fastq SRR11701747-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,982,397 reads, 16,205,847 reads pseudoaligned [quant] estimated average fragment length: 251.522 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR11701747.ke.tsv 34699 SRR11701747.se.tsv 87100 total ==> SRR11701747.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.48 1438 37.7145 Potri.005G024800.1.v4.1 1035 784.478 371 21.9228 Potri.004G059700.1.v4.1 961 710.484 51 3.32751 Potri.007G009000.2.v4.1 1416 1165.48 7 0.278418 Potri.003G141000.2.v4.1 2943 2692.48 361.305 6.2205 Potri.016G087400.1.v4.1 270 61.4689 1082 815.971 Potri.015G069301.1.v4.1 564 313.938 0 0 Potri.010G195200.1.v4.1 1773 1522.48 382.141 11.6352 Potri.012G127500.1.v4.1 977 726.484 6069 387.252 ==> SRR11701747.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 254 Potri.001G233950.v4.1 11 Potri.001G122700.v4.1 590 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 21 Potri.001G452600.v4.1 47 SRR11701747 completed mapping pipeline successfully