Starting /dee2/code/volunteer_pipeline.sh SRR11701748 current disk space = 3052087853056 free memory = 1582143468 SRR11701748 SRAfilesize 942274e05f7753b9577acbb479f20cb7 SRR11701748.sra SRR11701748.sra file validated SRR11701748 is paired end SRR11701748 is conventional basespace SRR11701748 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701748_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.255 32.0 32.0 32.0 32.0 32.0 2 31.79125 32.0 32.0 32.0 32.0 32.0 3 36.0875 37.0 37.0 37.0 32.0 37.0 4 36.37625 37.0 37.0 37.0 37.0 37.0 5 36.2825 37.0 37.0 37.0 37.0 37.0 6 39.61175 41.0 41.0 41.0 37.0 41.0 7 39.63925 41.0 41.0 41.0 37.0 41.0 8 39.67 41.0 41.0 41.0 37.0 41.0 9 40.02675 41.0 41.0 41.0 37.0 41.0 10-14 39.6175 41.0 41.0 41.0 37.0 41.0 15-19 39.46535 41.0 41.0 41.0 37.0 41.0 20-24 39.533 41.0 41.0 41.0 37.0 41.0 25-29 39.25295 41.0 41.0 41.0 37.0 41.0 30-34 38.87065 41.0 41.0 41.0 34.0 41.0 35-39 39.58795 41.0 41.0 41.0 37.0 41.0 40-44 39.8283 41.0 41.0 41.0 37.8 41.0 45-49 40.1791 41.0 41.0 41.0 37.8 41.0 50-54 40.02025 41.0 41.0 41.0 37.0 41.0 55-59 40.0593 41.0 41.0 41.0 37.0 41.0 60-64 39.9188 41.0 41.0 41.0 37.0 41.0 65-69 39.7821 41.0 41.0 41.0 37.0 41.0 70-74 39.907 41.0 41.0 41.0 37.0 41.0 75-79 39.56495 41.0 41.0 41.0 37.0 41.0 80-84 39.3269 41.0 41.0 41.0 36.0 41.0 85-89 39.581849999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.4587 41.0 41.0 41.0 37.0 41.0 95-99 39.626149999999996 41.0 41.0 41.0 37.0 41.0 100-104 39.5064 41.0 41.0 41.0 37.0 41.0 105-109 39.4889 41.0 41.0 41.0 37.0 41.0 110-114 39.18879999999999 41.0 40.2 41.0 36.0 41.0 115-119 39.53295 41.0 41.0 41.0 37.0 41.0 120-124 39.59705 41.0 41.0 41.0 37.0 41.0 125-129 38.92355 41.0 41.0 41.0 35.0 41.0 130-134 39.02925 41.0 41.0 41.0 35.0 41.0 135-139 38.6382 41.0 38.6 41.0 34.0 41.0 140-144 38.48530000000001 41.0 37.8 41.0 33.0 41.0 145-149 37.751250000000006 41.0 37.0 41.0 30.0 41.0 150 38.09 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 3.0 29 10.0 30 26.0 31 29.0 32 60.0 33 61.0 34 73.0 35 124.0 36 164.0 37 219.0 38 346.0 39 642.0 40 2243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.550000000000004 16.075 14.825 35.55 2 24.5 25.1 30.95 19.45 3 22.5 29.675 25.575 22.25 4 23.474999999999998 35.9 21.425 19.2 5 23.375 37.225 22.225 17.175 6 17.275 38.7 24.15 19.875 7 18.15 18.2 41.825 21.825 8 19.875 22.825 28.799999999999997 28.499999999999996 9 19.2 22.1 31.474999999999998 27.224999999999998 10-14 21.075 28.74 27.845 22.34 15-19 21.615000000000002 28.71 27.755000000000003 21.92 20-24 22.14 29.34 26.41 22.11 25-29 21.959999999999997 29.04 26.900000000000002 22.1 30-34 21.22 28.825 27.32 22.634999999999998 35-39 21.54 29.485 27.21 21.765 40-44 21.89 28.87 27.465 21.775 45-49 21.47 28.74 27.495000000000005 22.295 50-54 21.759999999999998 28.449999999999996 27.01 22.78 55-59 21.73 28.155 27.605 22.509999999999998 60-64 22.06 28.24 27.76 21.94 65-69 21.595 28.375 27.71 22.32 70-74 22.07 28.4 27.43 22.1 75-79 21.884999999999998 28.52 27.825 21.77 80-84 22.375 28.685 27.325 21.615000000000002 85-89 22.31 28.285 27.694999999999997 21.709999999999997 90-94 22.285 28.02 28.294999999999998 21.4 95-99 22.08 28.199999999999996 27.555000000000003 22.165000000000003 100-104 22.07 28.525 26.979999999999997 22.425 105-109 21.975 28.585 27.584999999999997 21.855 110-114 21.695 28.34 27.295 22.67 115-119 22.15 27.865000000000002 27.38 22.605 120-124 22.57 27.439999999999998 28.189999999999998 21.8 125-129 21.68 27.735 28.28 22.305 130-134 22.075 27.779999999999998 28.325 21.82 135-139 21.91 28.444999999999997 27.565 22.08 140-144 22.865 27.450000000000003 27.91 21.775 145-149 22.58 28.57 27.255000000000003 21.595 150 23.45 27.224999999999998 27.675 21.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 4.5 23 5.5 24 6.0 25 6.5 26 3.0 27 6.0 28 13.0 29 17.5 30 25.5 31 30.5 32 43.5 33 51.5 34 54.5 35 69.0 36 83.5 37 115.5 38 146.5 39 167.5 40 189.5 41 203.0 42 210.5 43 232.0 44 252.0 45 251.5 46 258.0 47 252.0 48 237.5 49 205.5 50 166.5 51 143.0 52 118.0 53 97.5 54 78.0 55 57.0 56 37.0 57 30.5 58 28.5 59 21.0 60 11.0 61 11.0 62 15.5 63 11.5 64 7.5 65 5.0 66 2.5 67 1.5 68 2.5 69 3.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 95.87575045679979 91.825 2 3.86322109109893 7.3999999999999995 3 0.23492560689115116 0.675 4 0.026102845210127904 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1125 0.0 0.0 0.0 0.0 136-137 0.4625 0.0 0.0 0.0 0.0 138 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11701748 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701748_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.55875 32.0 32.0 32.0 32.0 32.0 2 31.48125 32.0 32.0 32.0 32.0 32.0 3 34.84875 37.0 32.0 37.0 32.0 37.0 4 36.30875 37.0 37.0 37.0 37.0 37.0 5 36.44125 37.0 37.0 37.0 37.0 37.0 6 39.91475 41.0 41.0 41.0 37.0 41.0 7 39.80925 41.0 41.0 41.0 37.0 41.0 8 40.1455 41.0 41.0 41.0 37.0 41.0 9 39.971 41.0 41.0 41.0 37.0 41.0 10-14 40.204449999999994 41.0 41.0 41.0 38.6 41.0 15-19 39.7368 41.0 41.0 41.0 37.0 41.0 20-24 39.98285 41.0 41.0 41.0 37.0 41.0 25-29 39.8096 41.0 41.0 41.0 37.0 41.0 30-34 39.8257 41.0 41.0 41.0 37.0 41.0 35-39 39.856950000000005 41.0 41.0 41.0 37.0 41.0 40-44 39.77875 41.0 41.0 41.0 37.0 41.0 45-49 39.8601 41.0 41.0 41.0 37.0 41.0 50-54 39.88075 41.0 41.0 41.0 37.0 41.0 55-59 39.86110000000001 41.0 41.0 41.0 37.0 41.0 60-64 39.78625 41.0 41.0 41.0 37.0 41.0 65-69 39.5505 41.0 41.0 41.0 37.0 41.0 70-74 38.8758 41.0 41.0 41.0 34.0 41.0 75-79 38.51665 41.0 38.6 41.0 33.0 41.0 80-84 38.86605 41.0 41.0 41.0 33.0 41.0 85-89 38.5214 41.0 39.4 41.0 33.0 41.0 90-94 39.21575 41.0 41.0 41.0 36.0 41.0 95-99 39.1417 41.0 40.2 41.0 35.0 41.0 100-104 38.8448 41.0 40.2 41.0 35.0 41.0 105-109 37.9519 41.0 37.0 41.0 30.0 41.0 110-114 37.96295 41.0 37.0 41.0 30.0 41.0 115-119 38.18525 41.0 37.0 41.0 31.0 41.0 120-124 38.71775 41.0 38.6 41.0 34.0 41.0 125-129 37.387649999999994 41.0 37.0 41.0 28.0 41.0 130-134 37.175599999999996 41.0 37.0 41.0 27.0 41.0 135-139 37.1404 41.0 37.0 41.0 27.0 41.0 140-144 37.0092 41.0 37.0 41.0 26.0 41.0 145-149 36.256 41.0 34.0 41.0 23.0 41.0 150 36.53575 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 6.0 29 29.0 30 52.0 31 72.0 32 81.0 33 117.0 34 118.0 35 174.0 36 181.0 37 239.0 38 363.0 39 642.0 40 1926.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.526526526526528 15.04004004004004 15.615615615615615 42.81781781781782 2 26.120711244678184 25.169045830202858 29.626846982218886 19.083395942900076 3 22.5 31.75 24.175 21.575 4 25.474999999999998 35.6 18.975 19.950000000000003 5 23.425 37.625 21.325 17.625 6 15.275 39.525 23.9 21.3 7 17.05 17.675 41.625 23.65 8 18.775 22.85 27.775 30.599999999999998 9 20.05 22.7 31.225 26.025 10-14 20.78 29.959999999999997 26.82 22.439999999999998 15-19 21.36 27.310000000000002 28.610000000000003 22.720000000000002 20-24 21.895 28.249999999999996 27.534999999999997 22.32 25-29 20.955 29.005 27.515 22.525000000000002 30-34 20.78 29.21 27.61 22.400000000000002 35-39 21.43 28.4 27.615000000000002 22.555 40-44 21.245 28.749999999999996 27.395000000000003 22.61 45-49 21.240000000000002 28.349999999999998 27.785 22.625 50-54 21.605 28.505000000000003 27.700000000000003 22.189999999999998 55-59 21.845 28.139999999999997 27.58 22.435 60-64 21.33 28.59 27.095000000000002 22.985 65-69 21.55 28.16 27.779999999999998 22.509999999999998 70-74 21.759999999999998 28.96 26.985 22.295 75-79 21.38 28.975 26.889999999999997 22.755 80-84 22.115000000000002 28.194999999999997 27.38 22.31 85-89 21.595 28.060000000000002 27.794999999999998 22.55 90-94 21.44 28.194999999999997 27.815 22.55 95-99 21.63 28.549999999999997 27.650000000000002 22.17 100-104 22.065 27.615000000000002 27.839999999999996 22.48 105-109 22.36 27.87 27.405 22.365 110-114 21.7 28.325 26.950000000000003 23.025000000000002 115-119 22.255 27.92 28.025 21.8 120-124 22.105 27.975 27.825 22.095000000000002 125-129 22.045 27.87 27.215 22.869999999999997 130-134 22.02 27.565 27.755000000000003 22.66 135-139 21.759999999999998 27.82 27.839999999999996 22.58 140-144 22.3 28.215 27.224999999999998 22.259999999999998 145-149 22.255 27.55 27.794999999999998 22.400000000000002 150 22.275 27.125 28.725 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 2.0 23 2.5 24 3.0 25 4.0 26 4.5 27 9.5 28 12.0 29 14.0 30 21.0 31 26.5 32 39.5 33 53.5 34 58.0 35 71.5 36 89.0 37 112.0 38 143.0 39 164.0 40 169.0 41 190.5 42 226.0 43 243.5 44 258.5 45 267.5 46 271.0 47 264.5 48 240.0 49 203.5 50 169.0 51 131.0 52 102.5 53 96.0 54 80.0 55 54.0 56 35.5 57 35.0 58 29.0 59 20.5 60 17.0 61 13.5 62 13.5 63 9.5 64 6.5 65 4.0 66 2.5 67 3.0 68 3.5 69 2.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7624901909495 91.525 2 3.949777661522365 7.55 3 0.23541721161391577 0.675 4 0.02615746795710175 0.1 5 0.0 0.0 6 0.02615746795710175 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0125 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.15000000000000002 0.0 0.0 0.0 0.0 136-137 0.525 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968415 spots for SRR11701748.sra Written 968415 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra Read 968399 spots for SRR11701748.sra Written 968399 spots for SRR11701748.sra SRR ids: ['SRR11701748.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hxjg0x6_ SRR11701748.sra spots: 19367996 blocks: [[1, 968399], [968400, 1936798], [1936799, 2905197], [2905198, 3873596], [3873597, 4841995], [4841996, 5810394], [5810395, 6778793], [6778794, 7747192], [7747193, 8715591], [8715592, 9683990], [9683991, 10652389], [10652390, 11620788], [11620789, 12589187], [12589188, 13557586], [13557587, 14525985], [14525986, 15494384], [15494385, 16462783], [16462784, 17431182], [17431183, 18399581], [18399582, 19367996]] SRR11701748 file size 6522563 SRR11701748 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701748 SRR11701748_1.fastq SRR11701748_2.fastq Input file: SRR11701748_1.fastq Paired file: SRR11701748_2.fastq trimmed: SRR11701748-trimmed-pair1.fastq, SRR11701748-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:38:54 2025 >> started Thu Feb 13 04:44:41 2025 >> done (347.014s) 19367996 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 19367992 (100.00%) read pairs available; of these: 609471 ( 3.15%) trimmed read pairs available after processing 18758521 (96.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 3 0.00% 21 0 0.00% 22 5 0.00% 23 3 0.00% 24 6 0.00% 25 0 0.00% 26 3 0.00% 27 1 0.00% 28 3 0.00% 29 2 0.00% 30 5 0.00% 31 4 0.00% 32 7 0.00% 33 3 0.00% 34 5 0.00% 35 3 0.00% 36 5 0.00% 37 5 0.00% 38 5 0.00% 39 7 0.00% 40 3 0.00% 41 3 0.00% 42 3 0.00% 43 7 0.00% 44 5 0.00% 45 3 0.00% 46 3 0.00% 47 3 0.00% 48 6 0.00% 49 6 0.00% 50 6 0.00% 51 5 0.00% 52 3 0.00% 53 9 0.00% 54 4 0.00% 55 7 0.00% 56 9 0.00% 57 4 0.00% 58 8 0.00% 59 4 0.00% 60 7 0.00% 61 8 0.00% 62 0 0.00% 63 5 0.00% 64 3 0.00% 65 2 0.00% 66 1 0.00% 67 2 0.00% 68 2 0.00% 69 2 0.00% 70 2 0.00% 71 3 0.00% 72 5 0.00% 73 3 0.00% 74 2 0.00% 75 2 0.00% 76 5 0.00% 77 1 0.00% 78 3 0.00% 79 6 0.00% 80 5 0.00% 81 4 0.00% 82 4 0.00% 83 2 0.00% 84 9 0.00% 85 5 0.00% 86 3 0.00% 87 4 0.00% 88 3 0.00% 89 2 0.00% 90 14 0.00% 91 12 0.00% 92 5 0.00% 93 10 0.00% 94 12 0.00% 95 16 0.00% 96 14 0.00% 97 18 0.00% 98 33 0.00% 99 23 0.00% 100 26 0.00% 101 36 0.00% 102 53 0.00% 103 48 0.00% 104 64 0.00% 105 56 0.00% 106 64 0.00% 107 64 0.00% 108 71 0.00% 109 77 0.00% 110 120 0.00% 111 115 0.00% 112 105 0.00% 113 94 0.00% 114 99 0.00% 115 108 0.00% 116 108 0.00% 117 105 0.00% 118 91 0.00% 119 99 0.00% 120 110 0.00% 121 102 0.00% 122 108 0.00% 123 98 0.00% 124 94 0.00% 125 92 0.00% 126 110 0.00% 127 105 0.00% 128 104 0.00% 129 99 0.00% 130 100 0.00% 131 114 0.00% 132 85 0.00% 133 100 0.00% 134 26145 0.13% 135 25462 0.13% 136 25043 0.13% 137 24590 0.13% 138 24229 0.13% 139 25076 0.13% 140 26223 0.14% 141 27580 0.14% 142 30153 0.16% 143 32178 0.17% 144 32856 0.17% 145 32678 0.17% 146 31853 0.16% 147 32361 0.17% 148 35591 0.18% 149 173989 0.90% 150 18758521 96.85% 19367992 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.15 prefix-fanout=1.9 sequence=AGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=209.04 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=18.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=1.2 sequence=GTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=207.54 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=17.3 sequence=AAGAAGAAGAAA SRR11701748 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:17:51 Started mapping on | Feb 13 05:18:02 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 31.25 Number of input reads | 19367992 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17686963 Uniquely mapped reads % | 91.32% Average mapped length | 297.67 Number of splices: Total | 14678131 Number of splices: Annotated (sjdb) | 14416642 Number of splices: GT/AG | 14445327 Number of splices: GC/AG | 181794 Number of splices: AT/AC | 14227 Number of splices: Non-canonical | 36783 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398632 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 2620 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.58% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1282397 1282397 1282397 N_multimapping 398632 398632 398632 N_noFeature 486441 8971528 9106184 N_ambiguous 218289 61469 61671 UnstrandedReadsAssigned:16982233 PositiveStrandReadsAssigned:8653966 NegativeStrandReadsAssigned:8519108 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701748 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701748-trimmed-pair1.fastq SRR11701748-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,367,992 reads, 17,234,451 reads pseudoaligned [quant] estimated average fragment length: 250.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR11701748.ke.tsv 34699 SRR11701748.se.tsv 87100 total ==> SRR11701748.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.99 2156 51.703 Potri.005G024800.1.v4.1 1035 785.992 1403 75.7237 Potri.004G059700.1.v4.1 961 711.992 40 2.38329 Potri.007G009000.2.v4.1 1416 1166.99 0 0 Potri.003G141000.2.v4.1 2943 2693.99 919 14.4714 Potri.016G087400.1.v4.1 270 60.6895 1001 699.702 Potri.015G069301.1.v4.1 564 315.278 0 0 Potri.010G195200.1.v4.1 1773 1523.99 30 0.835086 Potri.012G127500.1.v4.1 977 727.992 8624 502.545 ==> SRR11701748.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 138 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR11701748 completed mapping pipeline successfully