Starting /dee2/code/volunteer_pipeline.sh SRR11701749 current disk space = 3052060999680 free memory = 1574674204 SRR11701749 SRAfilesize 7e6e3c1fd38239dac497dee5fb74bb0c SRR11701749.sra SRR11701749.sra file validated SRR11701749 is paired end SRR11701749 is conventional basespace SRR11701749 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701749_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.825 32.0 32.0 32.0 32.0 32.0 2 31.8025 32.0 32.0 32.0 32.0 32.0 3 36.015 37.0 37.0 37.0 32.0 37.0 4 36.41875 37.0 37.0 37.0 37.0 37.0 5 36.3975 37.0 37.0 37.0 37.0 37.0 6 39.62925 41.0 41.0 41.0 37.0 41.0 7 39.837 41.0 41.0 41.0 37.0 41.0 8 39.79375 41.0 41.0 41.0 37.0 41.0 9 40.05425 41.0 41.0 41.0 37.0 41.0 10-14 39.7132 41.0 41.0 41.0 37.0 41.0 15-19 39.60235 41.0 41.0 41.0 37.0 41.0 20-24 39.65260000000001 41.0 41.0 41.0 37.0 41.0 25-29 39.36704999999999 41.0 41.0 41.0 37.0 41.0 30-34 39.0972 41.0 41.0 41.0 37.0 41.0 35-39 39.7259 41.0 41.0 41.0 37.0 41.0 40-44 39.864149999999995 41.0 41.0 41.0 37.8 41.0 45-49 40.2013 41.0 41.0 41.0 37.8 41.0 50-54 40.058749999999996 41.0 41.0 41.0 37.0 41.0 55-59 40.10005 41.0 41.0 41.0 37.0 41.0 60-64 39.9631 41.0 41.0 41.0 37.0 41.0 65-69 39.9089 41.0 41.0 41.0 37.0 41.0 70-74 40.06 41.0 41.0 41.0 37.0 41.0 75-79 39.5611 41.0 41.0 41.0 37.0 41.0 80-84 39.425799999999995 41.0 41.0 41.0 36.0 41.0 85-89 39.69975000000001 41.0 41.0 41.0 37.0 41.0 90-94 39.6425 41.0 41.0 41.0 37.0 41.0 95-99 39.596050000000005 41.0 41.0 41.0 37.0 41.0 100-104 39.53965000000001 41.0 41.0 41.0 37.0 41.0 105-109 39.5241 41.0 41.0 41.0 37.0 41.0 110-114 39.38375 41.0 41.0 41.0 36.0 41.0 115-119 39.56320000000001 41.0 41.0 41.0 37.0 41.0 120-124 39.648450000000004 41.0 41.0 41.0 37.0 41.0 125-129 39.121449999999996 41.0 41.0 41.0 35.0 41.0 130-134 39.21035 41.0 41.0 41.0 36.0 41.0 135-139 38.77980000000001 41.0 39.4 41.0 34.0 41.0 140-144 38.68535000000001 41.0 38.6 41.0 33.0 41.0 145-149 38.028800000000004 41.0 37.0 41.0 31.0 41.0 150 38.31575 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 5.0 29 6.0 30 18.0 31 40.0 32 39.0 33 66.0 34 74.0 35 96.0 36 159.0 37 208.0 38 325.0 39 594.0 40 2370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.2 15.299999999999999 17.25 34.25 2 25.324999999999996 25.6 29.2 19.875 3 21.2 30.2 24.825 23.775 4 23.45 36.15 20.025000000000002 20.375 5 22.900000000000002 38.675 20.974999999999998 17.45 6 15.55 39.225 24.4 20.825 7 17.2 18.25 42.525 22.025 8 18.775 23.724999999999998 28.499999999999996 28.999999999999996 9 17.974999999999998 22.175 31.900000000000002 27.950000000000003 10-14 20.419999999999998 29.26 27.400000000000002 22.919999999999998 15-19 21.43 27.775 28.21 22.585 20-24 21.185000000000002 29.25 27.185 22.38 25-29 21.785 28.675 27.43 22.11 30-34 21.310000000000002 28.84 27.435 22.415 35-39 21.575 28.51 27.32 22.595000000000002 40-44 21.685 28.79 27.33 22.195 45-49 21.6 27.965 28.09 22.345000000000002 50-54 21.675 28.835 27.26 22.23 55-59 22.175 28.275 27.425 22.125 60-64 22.075 27.98 27.57 22.375 65-69 22.125 28.499999999999996 27.265 22.11 70-74 22.384999999999998 28.7 26.889999999999997 22.025 75-79 21.705 27.92 28.13 22.245 80-84 22.045 27.700000000000003 27.345000000000002 22.91 85-89 21.935 28.13 27.37 22.564999999999998 90-94 21.69 27.77 28.03 22.509999999999998 95-99 21.795 28.470000000000002 27.685 22.05 100-104 22.225 28.575 26.865 22.335 105-109 21.6 28.050000000000004 28.439999999999998 21.91 110-114 21.93 27.73 28.315 22.025 115-119 22.314999999999998 28.02 27.794999999999998 21.87 120-124 21.87 27.889999999999997 28.060000000000002 22.18 125-129 21.84 27.325 28.015 22.82 130-134 22.345000000000002 27.779999999999998 28.075 21.8 135-139 21.875 27.865000000000002 28.444999999999997 21.815 140-144 22.195 28.095 27.525 22.185 145-149 21.935 28.64 27.334999999999997 22.09 150 22.25 28.925 27.950000000000003 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 3.0 25 3.5 26 3.0 27 5.5 28 10.0 29 16.5 30 18.5 31 23.5 32 38.0 33 46.0 34 55.5 35 67.0 36 82.5 37 105.0 38 129.0 39 152.0 40 183.5 41 205.5 42 231.5 43 255.0 44 271.5 45 271.5 46 258.5 47 259.5 48 232.0 49 202.5 50 172.0 51 138.5 52 126.5 53 109.0 54 86.5 55 62.5 56 39.5 57 33.5 58 25.0 59 20.0 60 17.5 61 9.5 62 6.0 63 4.5 64 2.5 65 1.5 66 2.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.47120418848168 91.175 2 4.345549738219896 8.3 3 0.18324607329842932 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.42500000000000004 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACTA 10 0.006973645 144.0 2 TATTTGA 10 0.006973645 144.0 7 >>END_MODULE SRR11701749 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701749_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61875 32.0 32.0 32.0 32.0 32.0 2 31.5325 32.0 32.0 32.0 32.0 32.0 3 35.1275 37.0 37.0 37.0 32.0 37.0 4 36.34375 37.0 37.0 37.0 37.0 37.0 5 36.5625 37.0 37.0 37.0 37.0 37.0 6 40.003 41.0 41.0 41.0 37.0 41.0 7 39.877 41.0 41.0 41.0 37.0 41.0 8 40.20825 41.0 41.0 41.0 37.0 41.0 9 40.04375 41.0 41.0 41.0 37.0 41.0 10-14 40.29335 41.0 41.0 41.0 40.2 41.0 15-19 39.810900000000004 41.0 41.0 41.0 37.0 41.0 20-24 40.03745 41.0 41.0 41.0 37.0 41.0 25-29 39.92295 41.0 41.0 41.0 37.0 41.0 30-34 39.974399999999996 41.0 41.0 41.0 37.0 41.0 35-39 39.951 41.0 41.0 41.0 37.0 41.0 40-44 39.89165 41.0 41.0 41.0 37.0 41.0 45-49 39.9271 41.0 41.0 41.0 37.0 41.0 50-54 39.9474 41.0 41.0 41.0 37.0 41.0 55-59 39.92955 41.0 41.0 41.0 37.0 41.0 60-64 39.84165 41.0 41.0 41.0 37.0 41.0 65-69 39.66615 41.0 41.0 41.0 37.0 41.0 70-74 39.1376 41.0 41.0 41.0 34.0 41.0 75-79 38.62235 41.0 39.4 41.0 32.0 41.0 80-84 38.9064 41.0 41.0 41.0 34.0 41.0 85-89 38.5147 41.0 39.4 41.0 33.0 41.0 90-94 39.32299999999999 41.0 41.0 41.0 37.0 41.0 95-99 39.26965 41.0 41.0 41.0 36.0 41.0 100-104 38.98995000000001 41.0 40.2 41.0 35.0 41.0 105-109 38.25404999999999 41.0 37.8 41.0 31.0 41.0 110-114 38.2855 41.0 37.0 41.0 32.0 41.0 115-119 38.4865 41.0 37.8 41.0 32.0 41.0 120-124 38.9524 41.0 41.0 41.0 34.0 41.0 125-129 37.69475 41.0 37.0 41.0 29.0 41.0 130-134 37.58820000000001 41.0 37.0 41.0 28.0 41.0 135-139 37.5305 41.0 37.0 41.0 28.0 41.0 140-144 37.29465 41.0 37.0 41.0 27.0 41.0 145-149 36.740750000000006 41.0 37.0 41.0 26.0 41.0 150 36.9375 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 7.0 29 19.0 30 39.0 31 63.0 32 89.0 33 99.0 34 115.0 35 132.0 36 178.0 37 234.0 38 370.0 39 575.0 40 2079.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.353353353353356 14.48948948948949 16.19119119119119 40.965965965965964 2 26.26970227670753 27.47060295221416 28.021015761821367 18.23867900925694 3 23.825 30.425 22.675 23.075000000000003 4 23.974999999999998 37.025000000000006 18.75 20.25 5 24.575 39.125 19.05 17.25 6 16.125 38.85 23.925 21.099999999999998 7 17.65 17.45 41.099999999999994 23.799999999999997 8 17.599999999999998 22.1 30.275000000000002 30.025000000000002 9 19.825 20.825 32.9 26.450000000000003 10-14 20.785 29.549999999999997 27.185 22.48 15-19 21.275 28.395 27.595 22.735 20-24 21.805 29.985 26.465 21.745 25-29 21.279999999999998 29.125 27.389999999999997 22.205 30-34 21.55 29.095 27.425 21.93 35-39 21.68 28.799999999999997 27.13 22.39 40-44 21.845 28.93 27.495000000000005 21.73 45-49 21.41 28.52 28.435 21.634999999999998 50-54 21.395 28.439999999999998 28.189999999999998 21.975 55-59 22.38 28.54 27.16 21.92 60-64 21.845 27.900000000000002 28.060000000000002 22.195 65-69 21.765 28.485 27.455000000000002 22.295 70-74 22.045 28.765 27.295 21.895 75-79 21.965 28.605000000000004 27.115000000000002 22.314999999999998 80-84 22.38 28.705000000000002 27.055 21.86 85-89 22.02 27.834999999999997 28.050000000000004 22.095000000000002 90-94 21.759999999999998 28.315 27.37 22.555 95-99 21.93 27.634999999999998 28.22 22.215 100-104 21.875 28.18 27.200000000000003 22.745 105-109 22.03 28.49 27.925 21.555 110-114 21.790000000000003 28.32 27.6 22.29 115-119 21.709999999999997 27.765 28.335 22.189999999999998 120-124 21.959999999999997 28.155 27.79 22.095000000000002 125-129 22.25 27.389999999999997 28.1 22.259999999999998 130-134 22.12 27.839999999999996 27.939999999999998 22.1 135-139 22.13 28.335 28.025 21.51 140-144 22.355 27.905 27.815 21.925 145-149 22.91 28.449999999999996 27.21 21.43 150 22.75 27.325 28.375 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 3.5 26 4.0 27 8.5 28 14.0 29 18.5 30 20.0 31 24.5 32 29.5 33 36.5 34 55.5 35 72.5 36 86.5 37 108.0 38 133.0 39 160.5 40 196.0 41 220.0 42 231.0 43 256.0 44 269.0 45 256.0 46 260.5 47 256.0 48 222.0 49 203.5 50 196.0 51 164.0 52 121.0 53 87.0 54 65.5 55 49.5 56 37.0 57 28.0 58 22.0 59 20.5 60 15.5 61 8.5 62 5.5 63 7.0 64 6.5 65 5.0 66 2.0 67 1.5 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.44383346425765 91.125 2 4.3728724797067295 8.35 3 0.1832940560356114 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.4 0.0 0.0 0.0 0.0 138 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822713 spots for SRR11701749.sra Written 822713 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra Read 822710 spots for SRR11701749.sra Written 822710 spots for SRR11701749.sra SRR ids: ['SRR11701749.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g7m28k2x SRR11701749.sra spots: 16454203 blocks: [[1, 822710], [822711, 1645420], [1645421, 2468130], [2468131, 3290840], [3290841, 4113550], [4113551, 4936260], [4936261, 5758970], [5758971, 6581680], [6581681, 7404390], [7404391, 8227100], [8227101, 9049810], [9049811, 9872520], [9872521, 10695230], [10695231, 11517940], [11517941, 12340650], [12340651, 13163360], [13163361, 13986070], [13986071, 14808780], [14808781, 15631490], [15631491, 16454203]] SRR11701749 file size 5538020 SRR11701749 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701749 SRR11701749_1.fastq SRR11701749_2.fastq Input file: SRR11701749_1.fastq Paired file: SRR11701749_2.fastq trimmed: SRR11701749-trimmed-pair1.fastq, SRR11701749-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:27:36 2025 >> started Thu Feb 13 04:34:37 2025 >> done (420.327s) 16454203 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 16454197 (100.00%) read pairs available; of these: 508282 ( 3.09%) trimmed read pairs available after processing 15945915 (96.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 6 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 6 0.00% 28 3 0.00% 29 5 0.00% 30 2 0.00% 31 4 0.00% 32 1 0.00% 33 3 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 6 0.00% 38 3 0.00% 39 5 0.00% 40 4 0.00% 41 6 0.00% 42 4 0.00% 43 3 0.00% 44 3 0.00% 45 3 0.00% 46 0 0.00% 47 3 0.00% 48 7 0.00% 49 9 0.00% 50 2 0.00% 51 8 0.00% 52 7 0.00% 53 4 0.00% 54 2 0.00% 55 10 0.00% 56 2 0.00% 57 4 0.00% 58 3 0.00% 59 3 0.00% 60 2 0.00% 61 8 0.00% 62 8 0.00% 63 6 0.00% 64 6 0.00% 65 6 0.00% 66 5 0.00% 67 4 0.00% 68 1 0.00% 69 0 0.00% 70 6 0.00% 71 2 0.00% 72 2 0.00% 73 2 0.00% 74 0 0.00% 75 4 0.00% 76 1 0.00% 77 1 0.00% 78 2 0.00% 79 2 0.00% 80 1 0.00% 81 1 0.00% 82 3 0.00% 83 5 0.00% 84 3 0.00% 85 3 0.00% 86 1 0.00% 87 5 0.00% 88 2 0.00% 89 7 0.00% 90 3 0.00% 91 8 0.00% 92 14 0.00% 93 13 0.00% 94 6 0.00% 95 10 0.00% 96 16 0.00% 97 15 0.00% 98 25 0.00% 99 24 0.00% 100 27 0.00% 101 28 0.00% 102 37 0.00% 103 35 0.00% 104 32 0.00% 105 45 0.00% 106 36 0.00% 107 57 0.00% 108 61 0.00% 109 50 0.00% 110 63 0.00% 111 78 0.00% 112 57 0.00% 113 64 0.00% 114 53 0.00% 115 61 0.00% 116 68 0.00% 117 83 0.00% 118 84 0.00% 119 81 0.00% 120 65 0.00% 121 60 0.00% 122 77 0.00% 123 81 0.00% 124 86 0.00% 125 89 0.00% 126 88 0.00% 127 92 0.00% 128 76 0.00% 129 86 0.00% 130 81 0.00% 131 83 0.00% 132 68 0.00% 133 83 0.00% 134 24215 0.15% 135 23948 0.15% 136 22968 0.14% 137 22409 0.14% 138 21585 0.13% 139 21757 0.13% 140 22515 0.14% 141 23839 0.14% 142 25059 0.15% 143 25647 0.16% 144 26265 0.16% 145 25799 0.16% 146 24973 0.15% 147 24777 0.15% 148 27854 0.17% 149 142061 0.86% 150 15945915 96.91% 16454197 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.5 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=31.09 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.2 sequence=CTGCAGCTGCAG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.5 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=41.16 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.0 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT SRR11701749 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:55:12 Started mapping on | Feb 13 05:55:12 Finished on | Feb 13 05:58:36 Mapping speed, Million of reads per hour | 290.37 Number of input reads | 16454197 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14762131 Uniquely mapped reads % | 89.72% Average mapped length | 297.64 Number of splices: Total | 12371128 Number of splices: Annotated (sjdb) | 12126302 Number of splices: GT/AG | 12186121 Number of splices: GC/AG | 145523 Number of splices: AT/AC | 12585 Number of splices: Non-canonical | 26899 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271773 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 832 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.61% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1420293 1420293 1420293 N_multimapping 271773 271773 271773 N_noFeature 467241 7499752 7591396 N_ambiguous 209336 35996 35525 UnstrandedReadsAssigned:14085554 PositiveStrandReadsAssigned:7226383 NegativeStrandReadsAssigned:7135210 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701749 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701749-trimmed-pair1.fastq SRR11701749-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,454,197 reads, 14,301,635 reads pseudoaligned [quant] estimated average fragment length: 260.39 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR11701749.ke.tsv 34699 SRR11701749.se.tsv 87100 total ==> SRR11701749.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.61 504 18.8623 Potri.005G024800.1.v4.1 1035 775.61 137 11.6255 Potri.004G059700.1.v4.1 961 701.61 61 5.72226 Potri.007G009000.2.v4.1 1416 1156.61 0 0 Potri.003G141000.2.v4.1 2943 2683.61 272.23 6.67651 Potri.016G087400.1.v4.1 270 58.8138 837 936.656 Potri.015G069301.1.v4.1 564 305.139 0 0 Potri.010G195200.1.v4.1 1773 1513.61 40 1.73932 Potri.012G127500.1.v4.1 977 717.61 2828 259.373 ==> SRR11701749.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1448 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR11701749 completed mapping pipeline successfully