Starting /dee2/code/volunteer_pipeline.sh SRR11701750 current disk space = 3052012716032 free memory = 1574515436 SRR11701750 SRAfilesize 7d7bc587493b81582da7354f253643cd SRR11701750.sra SRR11701750.sra file validated SRR11701750 is paired end SRR11701750 is conventional basespace SRR11701750 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701750_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7475 32.0 32.0 32.0 32.0 32.0 2 31.7625 32.0 32.0 32.0 32.0 32.0 3 36.0 37.0 37.0 37.0 32.0 37.0 4 36.38375 37.0 37.0 37.0 37.0 37.0 5 36.28375 37.0 37.0 37.0 37.0 37.0 6 39.63675 41.0 41.0 41.0 37.0 41.0 7 39.61975 41.0 41.0 41.0 37.0 41.0 8 39.593 41.0 41.0 41.0 37.0 41.0 9 40.018 41.0 41.0 41.0 37.0 41.0 10-14 39.65905 41.0 41.0 41.0 37.0 41.0 15-19 39.38085 41.0 41.0 41.0 36.0 41.0 20-24 39.4493 41.0 41.0 41.0 37.0 41.0 25-29 39.183150000000005 41.0 41.0 41.0 37.0 41.0 30-34 38.734399999999994 41.0 41.0 41.0 33.0 41.0 35-39 39.56025 41.0 41.0 41.0 37.0 41.0 40-44 39.78125 41.0 41.0 41.0 37.8 41.0 45-49 40.14475 41.0 41.0 41.0 37.0 41.0 50-54 40.1324 41.0 41.0 41.0 37.0 41.0 55-59 40.14895 41.0 41.0 41.0 37.8 41.0 60-64 39.9557 41.0 41.0 41.0 37.0 41.0 65-69 39.85165 41.0 41.0 41.0 37.0 41.0 70-74 40.0413 41.0 41.0 41.0 37.0 41.0 75-79 39.51295 41.0 41.0 41.0 37.0 41.0 80-84 39.327749999999995 41.0 41.0 41.0 36.0 41.0 85-89 39.65305 41.0 41.0 41.0 37.0 41.0 90-94 39.5143 41.0 41.0 41.0 37.0 41.0 95-99 39.70755 41.0 41.0 41.0 37.0 41.0 100-104 39.46295 41.0 41.0 41.0 37.0 41.0 105-109 39.4806 41.0 41.0 41.0 37.0 41.0 110-114 39.19475 41.0 41.0 41.0 36.0 41.0 115-119 39.52645 41.0 41.0 41.0 37.0 41.0 120-124 39.4968 41.0 41.0 41.0 37.0 41.0 125-129 38.866499999999995 41.0 41.0 41.0 34.0 41.0 130-134 39.03060000000001 41.0 40.2 41.0 35.0 41.0 135-139 38.62755 41.0 38.6 41.0 34.0 41.0 140-144 38.4736 41.0 37.8 41.0 33.0 41.0 145-149 37.8438 41.0 37.0 41.0 31.0 41.0 150 38.0645 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 6.0 29 15.0 30 20.0 31 27.0 32 43.0 33 59.0 34 88.0 35 124.0 36 157.0 37 238.0 38 361.0 39 635.0 40 2227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.025 17.05 15.0 35.925000000000004 2 25.025 25.15 30.9 18.925 3 21.525 30.7 24.95 22.825 4 24.275 36.225 19.650000000000002 19.85 5 24.65 36.775000000000006 21.55 17.025000000000002 6 17.424999999999997 39.425 22.975 20.175 7 16.85 19.775000000000002 41.925000000000004 21.45 8 17.675 23.225 30.025000000000002 29.075 9 19.325 23.5 31.25 25.924999999999997 10-14 20.715 30.505 27.185 21.595 15-19 21.57 28.88 27.825 21.725 20-24 21.505 30.009999999999998 26.884999999999998 21.6 25-29 21.205 29.98 27.415 21.4 30-34 21.185000000000002 29.815 27.63 21.37 35-39 20.915 30.014999999999997 27.750000000000004 21.32 40-44 21.545 29.445 27.365000000000002 21.645 45-49 20.815 29.435 28.155 21.595 50-54 21.105 29.104999999999997 28.134999999999998 21.654999999999998 55-59 21.01 29.12 27.810000000000002 22.06 60-64 21.33 28.675 28.07 21.925 65-69 21.555 28.965000000000003 28.4 21.08 70-74 21.52 28.875 27.900000000000002 21.705 75-79 21.245 29.654999999999998 27.689999999999998 21.41 80-84 21.78 29.325000000000003 27.47 21.425 85-89 21.665 28.799999999999997 27.689999999999998 21.845 90-94 21.67 29.075 27.3 21.955 95-99 21.11 28.765 28.249999999999996 21.875 100-104 21.665 28.449999999999996 28.084999999999997 21.8 105-109 21.305 28.694999999999997 28.415000000000003 21.584999999999997 110-114 21.97 28.705000000000002 28.02 21.305 115-119 22.66 27.83 27.700000000000003 21.81 120-124 21.515 27.839999999999996 28.92 21.725 125-129 21.695 28.110000000000003 28.49 21.705 130-134 21.154999999999998 28.355000000000004 28.265 22.225 135-139 21.584999999999997 28.83 28.375 21.21 140-144 21.735 28.499999999999996 27.96 21.805 145-149 22.145 27.975 28.22 21.66 150 21.75 29.549999999999997 28.050000000000004 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 4.0 18 3.5 19 2.0 20 3.0 21 3.5 22 3.0 23 3.0 24 6.5 25 9.5 26 12.0 27 14.5 28 15.5 29 25.5 30 30.5 31 38.0 32 51.0 33 58.0 34 73.0 35 96.0 36 123.5 37 139.0 38 160.0 39 179.0 40 191.0 41 219.0 42 225.0 43 232.5 44 246.0 45 234.0 46 235.5 47 226.0 48 193.5 49 166.0 50 143.0 51 121.5 52 112.0 53 93.0 54 66.0 55 58.0 56 48.0 57 31.0 58 22.0 59 16.5 60 10.5 61 13.0 62 11.0 63 7.0 64 6.5 65 3.0 66 1.0 67 3.0 68 2.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.11979166666667 92.27499999999999 2 3.619791666666667 6.950000000000001 3 0.234375 0.675 4 0.026041666666666668 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1125 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGAG 10 0.006973645 144.0 3 CCCAGAT 10 0.006973645 144.0 1 TTTTTTT 160 0.004330816 8.099999 115-119 >>END_MODULE SRR11701750 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701750_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6475 32.0 32.0 32.0 32.0 32.0 2 31.49125 32.0 32.0 32.0 32.0 32.0 3 34.87375 37.0 32.0 37.0 32.0 37.0 4 36.34625 37.0 37.0 37.0 37.0 37.0 5 36.53125 37.0 37.0 37.0 37.0 37.0 6 40.077 41.0 41.0 41.0 37.0 41.0 7 39.8495 41.0 41.0 41.0 37.0 41.0 8 40.215 41.0 41.0 41.0 37.0 41.0 9 40.096 41.0 41.0 41.0 37.0 41.0 10-14 40.251099999999994 41.0 41.0 41.0 40.2 41.0 15-19 39.78335 41.0 41.0 41.0 37.0 41.0 20-24 39.9945 41.0 41.0 41.0 37.0 41.0 25-29 39.94885 41.0 41.0 41.0 37.0 41.0 30-34 39.93805 41.0 41.0 41.0 37.0 41.0 35-39 39.946600000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.85865 41.0 41.0 41.0 37.0 41.0 45-49 39.875350000000005 41.0 41.0 41.0 37.0 41.0 50-54 39.903150000000004 41.0 41.0 41.0 37.0 41.0 55-59 39.9721 41.0 41.0 41.0 37.0 41.0 60-64 39.847449999999995 41.0 41.0 41.0 37.0 41.0 65-69 39.60845 41.0 41.0 41.0 37.0 41.0 70-74 38.8955 41.0 41.0 41.0 34.0 41.0 75-79 38.31305 41.0 37.8 41.0 32.0 41.0 80-84 38.76585 41.0 40.2 41.0 33.0 41.0 85-89 38.40345 41.0 39.4 41.0 32.0 41.0 90-94 39.196999999999996 41.0 41.0 41.0 36.0 41.0 95-99 39.04905 41.0 40.2 41.0 35.0 41.0 100-104 38.654650000000004 41.0 39.4 41.0 32.0 41.0 105-109 37.9182 41.0 37.0 41.0 30.0 41.0 110-114 38.00055 41.0 37.0 41.0 31.0 41.0 115-119 38.35045 41.0 37.0 41.0 31.0 41.0 120-124 38.67965000000001 41.0 38.6 41.0 34.0 41.0 125-129 37.389 41.0 37.0 41.0 28.0 41.0 130-134 37.138 41.0 37.0 41.0 27.0 41.0 135-139 37.09855 41.0 37.0 41.0 27.0 41.0 140-144 36.93945 41.0 37.0 41.0 27.0 41.0 145-149 36.2322 41.0 33.0 41.0 23.0 41.0 150 36.20125 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 3.0 29 25.0 30 46.0 31 51.0 32 86.0 33 119.0 34 131.0 35 164.0 36 207.0 37 284.0 38 404.0 39 556.0 40 1924.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.021015761821367 16.487365524143108 15.836877658243683 39.654741055791845 2 26.3013013013013 26.226226226226224 30.58058058058058 16.89189189189189 3 23.849999999999998 32.975 22.675 20.5 4 25.6 35.85 19.225 19.325 5 23.549999999999997 39.0 20.424999999999997 17.025000000000002 6 16.650000000000002 39.625 24.125 19.6 7 17.925 17.724999999999998 42.125 22.225 8 19.05 22.1 29.375 29.475 9 18.55 23.075000000000003 32.5 25.874999999999996 10-14 20.585 30.380000000000003 27.365000000000002 21.67 15-19 21.19 29.25 27.700000000000003 21.86 20-24 21.355 29.95 27.529999999999998 21.165 25-29 20.705000000000002 30.080000000000002 27.395000000000003 21.82 30-34 21.05 29.425 27.74 21.785 35-39 21.23 29.725 27.425 21.62 40-44 21.4 30.445 27.200000000000003 20.955 45-49 21.47 28.15 28.634999999999998 21.745 50-54 21.58 29.37 27.474999999999998 21.575 55-59 21.645 28.294999999999998 28.255000000000003 21.805 60-64 21.215 29.544999999999998 27.334999999999997 21.905 65-69 21.22 28.595 28.215 21.97 70-74 21.2 28.815 27.63 22.355 75-79 21.445 28.43 28.435 21.69 80-84 21.94 28.799999999999997 27.79 21.47 85-89 21.154999999999998 28.99 28.03 21.825 90-94 21.485000000000003 28.970000000000002 28.110000000000003 21.435000000000002 95-99 21.62 28.499999999999996 28.275 21.605 100-104 21.475 28.59 28.04 21.895 105-109 21.310000000000002 28.415000000000003 28.42 21.855 110-114 21.23 28.965000000000003 28.410000000000004 21.395 115-119 21.654999999999998 28.595 27.894999999999996 21.855 120-124 21.78 27.860000000000003 28.549999999999997 21.81 125-129 21.98 28.095 28.744999999999997 21.18 130-134 21.785 28.065 28.415000000000003 21.735 135-139 21.575 28.99 28.470000000000002 20.965 140-144 21.505 27.54 29.345 21.61 145-149 22.16 28.48 28.23 21.13 150 22.3 26.450000000000003 28.749999999999996 22.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.5 16 2.0 17 3.0 18 2.5 19 1.5 20 1.5 21 2.5 22 7.0 23 9.5 24 9.0 25 10.0 26 10.0 27 12.0 28 17.0 29 27.0 30 33.0 31 38.5 32 50.0 33 67.0 34 90.0 35 102.0 36 104.5 37 120.5 38 154.5 39 175.0 40 193.5 41 202.5 42 209.0 43 229.5 44 243.0 45 239.0 46 230.0 47 230.0 48 209.0 49 176.0 50 144.0 51 124.5 52 112.0 53 88.5 54 71.0 55 51.5 56 36.5 57 34.5 58 30.0 59 25.5 60 18.5 61 12.0 62 8.0 63 4.5 64 4.5 65 5.5 66 4.0 67 1.5 68 2.0 69 2.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90185330200993 91.85 2 3.784912555468546 7.249999999999999 3 0.31323414252153486 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1125 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGATTC 10 0.006973645 144.0 3 TTTACTT 10 0.006973645 144.0 7 AAAAAAA 145 0.0017738148 8.937931 80-84 >>END_MODULE Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra Read 1124174 spots for SRR11701750.sra Written 1124174 spots for SRR11701750.sra Read 1124162 spots for SRR11701750.sra Written 1124162 spots for SRR11701750.sra SRR ids: ['SRR11701750.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_veqx8ykj SRR11701750.sra spots: 22483252 blocks: [[1, 1124162], [1124163, 2248324], [2248325, 3372486], [3372487, 4496648], [4496649, 5620810], [5620811, 6744972], [6744973, 7869134], [7869135, 8993296], [8993297, 10117458], [10117459, 11241620], [11241621, 12365782], [12365783, 13489944], [13489945, 14614106], [14614107, 15738268], [15738269, 16862430], [16862431, 17986592], [17986593, 19110754], [19110755, 20234916], [20234917, 21359078], [21359079, 22483252]] SRR11701750 file size 7575179 SRR11701750 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701750 SRR11701750_1.fastq SRR11701750_2.fastq Input file: SRR11701750_1.fastq Paired file: SRR11701750_2.fastq trimmed: SRR11701750-trimmed-pair1.fastq, SRR11701750-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 05:00:57 2025 >> started Thu Feb 13 05:08:20 2025 >> done (443.881s) 22483252 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 22483244 (100.00%) read pairs available; of these: 695136 ( 3.09%) trimmed read pairs available after processing 21788108 (96.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 8 0.00% 28 4 0.00% 29 2 0.00% 30 6 0.00% 31 9 0.00% 32 9 0.00% 33 4 0.00% 34 4 0.00% 35 5 0.00% 36 6 0.00% 37 6 0.00% 38 5 0.00% 39 6 0.00% 40 9 0.00% 41 5 0.00% 42 8 0.00% 43 7 0.00% 44 11 0.00% 45 6 0.00% 46 7 0.00% 47 7 0.00% 48 5 0.00% 49 9 0.00% 50 2 0.00% 51 8 0.00% 52 6 0.00% 53 3 0.00% 54 5 0.00% 55 7 0.00% 56 13 0.00% 57 5 0.00% 58 4 0.00% 59 6 0.00% 60 4 0.00% 61 7 0.00% 62 6 0.00% 63 3 0.00% 64 7 0.00% 65 3 0.00% 66 8 0.00% 67 3 0.00% 68 7 0.00% 69 7 0.00% 70 6 0.00% 71 7 0.00% 72 3 0.00% 73 4 0.00% 74 4 0.00% 75 5 0.00% 76 3 0.00% 77 4 0.00% 78 7 0.00% 79 2 0.00% 80 6 0.00% 81 7 0.00% 82 0 0.00% 83 4 0.00% 84 4 0.00% 85 3 0.00% 86 9 0.00% 87 9 0.00% 88 2 0.00% 89 7 0.00% 90 8 0.00% 91 10 0.00% 92 15 0.00% 93 18 0.00% 94 13 0.00% 95 19 0.00% 96 18 0.00% 97 33 0.00% 98 29 0.00% 99 33 0.00% 100 32 0.00% 101 51 0.00% 102 43 0.00% 103 64 0.00% 104 58 0.00% 105 61 0.00% 106 69 0.00% 107 95 0.00% 108 86 0.00% 109 81 0.00% 110 93 0.00% 111 92 0.00% 112 109 0.00% 113 86 0.00% 114 88 0.00% 115 107 0.00% 116 89 0.00% 117 106 0.00% 118 101 0.00% 119 114 0.00% 120 102 0.00% 121 105 0.00% 122 103 0.00% 123 137 0.00% 124 131 0.00% 125 108 0.00% 126 113 0.00% 127 112 0.00% 128 116 0.00% 129 91 0.00% 130 99 0.00% 131 123 0.00% 132 99 0.00% 133 98 0.00% 134 29615 0.13% 135 29959 0.13% 136 28841 0.13% 137 28706 0.13% 138 27952 0.12% 139 28774 0.13% 140 30355 0.14% 141 31336 0.14% 142 34382 0.15% 143 36775 0.16% 144 36654 0.16% 145 37416 0.17% 146 36906 0.16% 147 36259 0.16% 148 40820 0.18% 149 196641 0.87% 150 21788108 96.91% 22483244 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=34 prefix-density=0.22 prefix-fanout=1.0 sequence=GTGACCAGACTACTTCTTTTTAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=224.12 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=18.8 sequence=AAGAAGAAGAAG criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=37 prefix-density=0.09 prefix-fanout=2.3 sequence=GCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=209.13 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=18.0 sequence=AAGAAGAAGAAA SRR11701750 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:44:16 Started mapping on | Feb 13 05:44:47 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 129.30 Number of input reads | 22483244 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20510823 Uniquely mapped reads % | 91.23% Average mapped length | 297.54 Number of splices: Total | 14822608 Number of splices: Annotated (sjdb) | 14499380 Number of splices: GT/AG | 14563043 Number of splices: GC/AG | 193890 Number of splices: AT/AC | 18953 Number of splices: Non-canonical | 46722 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510110 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 4248 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.46% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1462311 1462311 1462311 N_multimapping 510110 510110 510110 N_noFeature 1397393 10803294 10974221 N_ambiguous 271483 71466 70034 UnstrandedReadsAssigned:18841947 PositiveStrandReadsAssigned:9636063 NegativeStrandReadsAssigned:9466568 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701750 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701750-trimmed-pair1.fastq SRR11701750-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,483,244 reads, 19,298,830 reads pseudoaligned [quant] estimated average fragment length: 251.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR11701750.ke.tsv 34699 SRR11701750.se.tsv 87100 total ==> SRR11701750.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.09 3172 69.1612 Potri.005G024800.1.v4.1 1035 784.088 1284 63.094 Potri.004G059700.1.v4.1 961 710.088 80 4.34076 Potri.007G009000.2.v4.1 1416 1165.09 16 0.529114 Potri.003G141000.2.v4.1 2943 2692.09 729 10.4334 Potri.016G087400.1.v4.1 270 60.4514 1164 741.881 Potri.015G069301.1.v4.1 564 313.558 0 0 Potri.010G195200.1.v4.1 1773 1522.09 91 2.30351 Potri.012G127500.1.v4.1 977 726.088 12145 644.46 ==> SRR11701750.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 213 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 410 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 21 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 39 Potri.001G452600.v4.1 22 SRR11701750 completed mapping pipeline successfully