Starting /dee2/code/volunteer_pipeline.sh SRR11701751 current disk space = 3051987296256 free memory = 1582101464 SRR11701751 SRAfilesize a4a2bda8b9de478f5fbc15d1a5963217 SRR11701751.sra SRR11701751.sra file validated SRR11701751 is paired end SRR11701751 is conventional basespace SRR11701751 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701751_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.815 32.0 32.0 32.0 32.0 32.0 2 31.80625 32.0 32.0 32.0 32.0 32.0 3 35.99375 37.0 37.0 37.0 32.0 37.0 4 36.28625 37.0 37.0 37.0 37.0 37.0 5 36.3375 37.0 37.0 37.0 37.0 37.0 6 39.50075 41.0 41.0 41.0 37.0 41.0 7 39.71275 41.0 41.0 41.0 37.0 41.0 8 39.603 41.0 41.0 41.0 37.0 41.0 9 40.016 41.0 41.0 41.0 37.0 41.0 10-14 39.68055 41.0 41.0 41.0 37.0 41.0 15-19 39.52315 41.0 41.0 41.0 37.0 41.0 20-24 39.574799999999996 41.0 41.0 41.0 37.0 41.0 25-29 39.366200000000006 41.0 41.0 41.0 37.0 41.0 30-34 39.05835 41.0 41.0 41.0 36.0 41.0 35-39 39.73335000000001 41.0 41.0 41.0 37.0 41.0 40-44 39.8007 41.0 41.0 41.0 37.8 41.0 45-49 40.1511 41.0 41.0 41.0 37.0 41.0 50-54 40.03515 41.0 41.0 41.0 37.0 41.0 55-59 40.12445 41.0 41.0 41.0 37.0 41.0 60-64 39.8998 41.0 41.0 41.0 37.0 41.0 65-69 39.87755 41.0 41.0 41.0 37.0 41.0 70-74 39.8908 41.0 41.0 41.0 37.0 41.0 75-79 39.53455 41.0 41.0 41.0 37.0 41.0 80-84 39.40145 41.0 41.0 41.0 36.0 41.0 85-89 39.59635 41.0 41.0 41.0 37.0 41.0 90-94 39.5527 41.0 41.0 41.0 37.0 41.0 95-99 39.63045 41.0 41.0 41.0 37.0 41.0 100-104 39.5693 41.0 41.0 41.0 37.0 41.0 105-109 39.460699999999996 41.0 41.0 41.0 37.0 41.0 110-114 39.269400000000005 41.0 40.2 41.0 36.0 41.0 115-119 39.4223 41.0 41.0 41.0 37.0 41.0 120-124 39.50455 41.0 41.0 41.0 37.0 41.0 125-129 39.0035 41.0 41.0 41.0 35.0 41.0 130-134 39.0927 41.0 41.0 41.0 35.0 41.0 135-139 38.60385 41.0 38.6 41.0 34.0 41.0 140-144 38.5616 41.0 37.8 41.0 33.0 41.0 145-149 37.93065 41.0 37.0 41.0 31.0 41.0 150 38.12375 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 2.0 29 8.0 30 27.0 31 34.0 32 46.0 33 60.0 34 84.0 35 109.0 36 160.0 37 221.0 38 327.0 39 594.0 40 2328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.425 17.825 15.024999999999999 34.725 2 26.950000000000003 24.05 31.2 17.8 3 22.525000000000002 29.625 24.575 23.275000000000002 4 24.775 35.175 20.849999999999998 19.2 5 25.174999999999997 36.35 21.8 16.675 6 18.075 38.175 22.575 21.175 7 17.849999999999998 17.75 42.725 21.675 8 18.475 23.400000000000002 29.5 28.625 9 19.675 23.0 31.474999999999998 25.85 10-14 20.865000000000002 28.994999999999997 27.85 22.29 15-19 21.73 27.889999999999997 27.88 22.5 20-24 21.72 28.9 27.735 21.645 25-29 20.97 28.92 27.139999999999997 22.97 30-34 21.275 28.660000000000004 27.474999999999998 22.59 35-39 21.584999999999997 28.605000000000004 27.26 22.55 40-44 21.52 28.7 27.605 22.175 45-49 21.654999999999998 28.310000000000002 27.72 22.314999999999998 50-54 21.565 28.67 27.450000000000003 22.314999999999998 55-59 21.935 28.04 27.22 22.805 60-64 21.560000000000002 28.720000000000002 27.115000000000002 22.605 65-69 22.245 28.084999999999997 27.58 22.09 70-74 21.959999999999997 28.29 27.37 22.38 75-79 21.385 28.155 27.76 22.7 80-84 21.83 28.345 27.46 22.365 85-89 21.87 28.07 27.325 22.735 90-94 21.790000000000003 28.655 27.425 22.13 95-99 21.959999999999997 28.315 27.334999999999997 22.39 100-104 22.1 28.315 27.655 21.93 105-109 22.650000000000002 27.305 27.72 22.325 110-114 22.15 27.284999999999997 27.744999999999997 22.82 115-119 22.39 27.67 28.000000000000004 21.94 120-124 21.965 27.565 28.175 22.295 125-129 22.125 27.47 28.055000000000003 22.35 130-134 22.46 27.355 28.845 21.34 135-139 21.67 27.615000000000002 28.63 22.085 140-144 22.615 27.805000000000003 27.889999999999997 21.69 145-149 22.595000000000002 27.810000000000002 28.1 21.495 150 22.5 28.65 27.1 21.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 4.5 26 5.5 27 6.5 28 7.5 29 11.5 30 17.5 31 27.5 32 39.5 33 51.0 34 69.5 35 83.5 36 92.5 37 100.5 38 127.0 39 162.0 40 188.0 41 220.0 42 234.0 43 232.0 44 235.0 45 246.5 46 265.5 47 250.0 48 219.0 49 199.0 50 167.0 51 141.0 52 125.5 53 112.0 54 83.5 55 57.0 56 49.5 57 35.0 58 23.5 59 22.0 60 20.0 61 14.0 62 8.0 63 6.5 64 6.0 65 5.5 66 4.5 67 2.5 68 1.5 69 1.5 70 2.0 71 2.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40682414698163 90.875 2 4.251968503937007 8.1 3 0.2887139107611548 0.8250000000000001 4 0.05249343832020997 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1125 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGATA 10 0.006973645 144.0 8 TCGGAAG 20 0.006139246 28.8 140-144 >>END_MODULE SRR11701751 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701751_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65 32.0 32.0 32.0 32.0 32.0 2 31.53875 32.0 32.0 32.0 32.0 32.0 3 35.105 37.0 32.0 37.0 32.0 37.0 4 36.315 37.0 37.0 37.0 37.0 37.0 5 36.5275 37.0 37.0 37.0 37.0 37.0 6 40.05025 41.0 41.0 41.0 37.0 41.0 7 39.82425 41.0 41.0 41.0 37.0 41.0 8 40.19925 41.0 41.0 41.0 37.0 41.0 9 40.0005 41.0 41.0 41.0 37.0 41.0 10-14 40.253750000000004 41.0 41.0 41.0 38.6 41.0 15-19 39.59205 41.0 41.0 41.0 37.0 41.0 20-24 39.91055 41.0 41.0 41.0 37.0 41.0 25-29 39.8112 41.0 41.0 41.0 37.0 41.0 30-34 39.74735 41.0 41.0 41.0 37.0 41.0 35-39 39.79615 41.0 41.0 41.0 37.0 41.0 40-44 39.73055000000001 41.0 41.0 41.0 37.0 41.0 45-49 39.8154 41.0 41.0 41.0 37.0 41.0 50-54 39.81295 41.0 41.0 41.0 37.0 41.0 55-59 39.80535 41.0 41.0 41.0 37.0 41.0 60-64 39.6289 41.0 41.0 41.0 37.0 41.0 65-69 39.5702 41.0 41.0 41.0 37.0 41.0 70-74 38.9305 41.0 41.0 41.0 34.0 41.0 75-79 38.40575 41.0 37.8 41.0 32.0 41.0 80-84 38.6853 41.0 40.2 41.0 33.0 41.0 85-89 38.3898 41.0 37.8 41.0 32.0 41.0 90-94 39.21685 41.0 41.0 41.0 36.0 41.0 95-99 39.163399999999996 41.0 40.2 41.0 36.0 41.0 100-104 38.709599999999995 41.0 39.4 41.0 34.0 41.0 105-109 38.03685 41.0 37.0 41.0 30.0 41.0 110-114 38.044 41.0 37.0 41.0 31.0 41.0 115-119 38.2818 41.0 37.0 41.0 31.0 41.0 120-124 38.6922 41.0 39.4 41.0 34.0 41.0 125-129 37.32805 41.0 37.0 41.0 28.0 41.0 130-134 37.3053 41.0 37.0 41.0 28.0 41.0 135-139 37.24565 41.0 37.0 41.0 27.0 41.0 140-144 36.96045 41.0 37.0 41.0 27.0 41.0 145-149 36.281349999999996 41.0 34.0 41.0 23.0 41.0 150 36.54825 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 4.0 29 22.0 30 58.0 31 88.0 32 82.0 33 102.0 34 130.0 35 149.0 36 202.0 37 266.0 38 339.0 39 606.0 40 1952.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.11013767209011 16.07008760951189 14.743429286608261 41.07634543178973 2 24.480600750938674 26.032540675844807 30.91364205256571 18.573216520650814 3 21.725 31.424999999999997 24.5 22.35 4 23.724999999999998 37.15 19.125 20.0 5 23.65 38.675 20.775 16.900000000000002 6 17.75 38.125 22.425 21.7 7 17.974999999999998 18.4 41.05 22.575 8 19.1 23.625 28.575 28.7 9 18.975 22.575 31.674999999999997 26.775 10-14 21.135 30.125 26.35 22.39 15-19 21.61 28.08 27.794999999999998 22.515 20-24 21.7 29.455 26.765 22.08 25-29 22.025 28.96 27.224999999999998 21.790000000000003 30-34 21.83 28.655 27.815 21.7 35-39 21.665 28.595 27.63 22.11 40-44 21.55 29.075 27.089999999999996 22.285 45-49 21.595 28.815 26.905 22.685 50-54 21.325 29.04 27.18 22.455 55-59 21.7 28.595 26.889999999999997 22.814999999999998 60-64 21.325 28.970000000000002 26.805 22.900000000000002 65-69 21.915000000000003 28.595 26.345000000000002 23.145 70-74 21.485000000000003 28.535 27.3 22.68 75-79 21.349999999999998 28.935 27.55 22.165000000000003 80-84 22.08 28.08 27.355 22.485 85-89 21.775 28.375 27.05 22.8 90-94 21.23 28.720000000000002 27.52 22.53 95-99 22.17 28.645 27.105 22.08 100-104 22.225 27.48 28.025 22.27 105-109 21.375 27.900000000000002 27.235 23.49 110-114 22.38 27.615000000000002 27.689999999999998 22.314999999999998 115-119 22.28 28.09 27.6 22.03 120-124 21.709999999999997 27.279999999999998 28.884999999999998 22.125 125-129 21.785 28.189999999999998 27.744999999999997 22.28 130-134 21.955 27.860000000000003 28.249999999999996 21.935 135-139 21.89 28.01 27.794999999999998 22.305 140-144 22.355 27.73 27.900000000000002 22.015 145-149 22.365 27.93 28.065 21.64 150 22.775000000000002 27.025 27.775 22.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.5 26 5.0 27 5.5 28 6.5 29 13.5 30 24.5 31 26.0 32 33.5 33 49.5 34 51.5 35 67.5 36 92.5 37 101.5 38 122.5 39 158.0 40 192.5 41 225.5 42 260.0 43 266.0 44 257.0 45 243.0 46 235.5 47 260.5 48 242.0 49 198.5 50 175.0 51 137.0 52 117.5 53 101.5 54 75.0 55 54.0 56 39.0 57 36.0 58 26.5 59 19.0 60 13.5 61 9.0 62 8.5 63 9.0 64 9.0 65 8.0 66 4.0 67 1.5 68 2.5 69 2.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.57591623036649 91.27499999999999 2 4.18848167539267 8.0 3 0.18324607329842932 0.525 4 0.052356020942408384 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1125 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGAC 10 0.0067147487 145.81013 1 TTTGACC 10 0.0069754543 143.9875 2 AGTGTAC 10 0.0069754543 143.9875 6 AAGTGTA 10 0.0069754543 143.9875 5 TCGGAAG 20 0.006141849 28.797503 140-144 >>END_MODULE Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828488 spots for SRR11701751.sra Written 828488 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra Read 828485 spots for SRR11701751.sra Written 828485 spots for SRR11701751.sra SRR ids: ['SRR11701751.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_icz8ruwz SRR11701751.sra spots: 16569703 blocks: [[1, 828485], [828486, 1656970], [1656971, 2485455], [2485456, 3313940], [3313941, 4142425], [4142426, 4970910], [4970911, 5799395], [5799396, 6627880], [6627881, 7456365], [7456366, 8284850], [8284851, 9113335], [9113336, 9941820], [9941821, 10770305], [10770306, 11598790], [11598791, 12427275], [12427276, 13255760], [13255761, 14084245], [14084246, 14912730], [14912731, 15741215], [15741216, 16569703]] SRR11701751 file size 5577046 SRR11701751 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701751 SRR11701751_1.fastq SRR11701751_2.fastq Input file: SRR11701751_1.fastq Paired file: SRR11701751_2.fastq trimmed: SRR11701751-trimmed-pair1.fastq, SRR11701751-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:40:16 2025 >> started Thu Feb 13 04:51:51 2025 >> done (694.256s) 16569703 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 16569695 (100.00%) read pairs available; of these: 527386 ( 3.18%) trimmed read pairs available after processing 16042309 (96.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 6 0.00% 28 3 0.00% 29 7 0.00% 30 2 0.00% 31 5 0.00% 32 9 0.00% 33 5 0.00% 34 1 0.00% 35 2 0.00% 36 5 0.00% 37 2 0.00% 38 3 0.00% 39 5 0.00% 40 2 0.00% 41 4 0.00% 42 6 0.00% 43 3 0.00% 44 9 0.00% 45 11 0.00% 46 8 0.00% 47 1 0.00% 48 2 0.00% 49 8 0.00% 50 7 0.00% 51 0 0.00% 52 5 0.00% 53 9 0.00% 54 3 0.00% 55 7 0.00% 56 3 0.00% 57 3 0.00% 58 3 0.00% 59 4 0.00% 60 2 0.00% 61 5 0.00% 62 4 0.00% 63 2 0.00% 64 4 0.00% 65 4 0.00% 66 4 0.00% 67 5 0.00% 68 3 0.00% 69 1 0.00% 70 2 0.00% 71 3 0.00% 72 3 0.00% 73 1 0.00% 74 4 0.00% 75 3 0.00% 76 0 0.00% 77 1 0.00% 78 2 0.00% 79 5 0.00% 80 3 0.00% 81 2 0.00% 82 2 0.00% 83 1 0.00% 84 1 0.00% 85 3 0.00% 86 2 0.00% 87 5 0.00% 88 8 0.00% 89 6 0.00% 90 4 0.00% 91 6 0.00% 92 9 0.00% 93 2 0.00% 94 6 0.00% 95 10 0.00% 96 22 0.00% 97 17 0.00% 98 20 0.00% 99 20 0.00% 100 27 0.00% 101 39 0.00% 102 32 0.00% 103 34 0.00% 104 49 0.00% 105 56 0.00% 106 54 0.00% 107 47 0.00% 108 65 0.00% 109 69 0.00% 110 77 0.00% 111 76 0.00% 112 86 0.00% 113 87 0.00% 114 97 0.00% 115 85 0.00% 116 71 0.00% 117 67 0.00% 118 104 0.00% 119 91 0.00% 120 101 0.00% 121 81 0.00% 122 85 0.00% 123 61 0.00% 124 87 0.00% 125 87 0.00% 126 103 0.00% 127 84 0.00% 128 99 0.00% 129 79 0.00% 130 88 0.00% 131 93 0.00% 132 88 0.00% 133 117 0.00% 134 23583 0.14% 135 22954 0.14% 136 22548 0.14% 137 21845 0.13% 138 21447 0.13% 139 21903 0.13% 140 22955 0.14% 141 23740 0.14% 142 25603 0.15% 143 26670 0.16% 144 27830 0.17% 145 27437 0.17% 146 27458 0.17% 147 27297 0.16% 148 30652 0.18% 149 150526 0.91% 150 16042309 96.82% 16569695 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.2 sequence=GCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGAGCCCAGCAATGCTGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=141.36 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=23.2 sequence=CAGCAGCAGTGA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.3 sequence=GCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGAGCCCAGCAATGCTGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=132.21 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=18.9 sequence=GCAGCAGCAGCAA SRR11701751 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:05:03 Started mapping on | Feb 13 05:05:08 Finished on | Feb 13 05:35:48 Mapping speed, Million of reads per hour | 32.42 Number of input reads | 16569695 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15132172 Uniquely mapped reads % | 91.32% Average mapped length | 297.61 Number of splices: Total | 12699499 Number of splices: Annotated (sjdb) | 12457270 Number of splices: GT/AG | 12500434 Number of splices: GC/AG | 156162 Number of splices: AT/AC | 13594 Number of splices: Non-canonical | 29309 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317251 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 1850 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1120272 1120272 1120272 N_multimapping 317251 317251 317251 N_noFeature 468463 7684994 7825763 N_ambiguous 198785 55029 54381 UnstrandedReadsAssigned:14464924 PositiveStrandReadsAssigned:7392149 NegativeStrandReadsAssigned:7252028 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701751 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701751-trimmed-pair1.fastq SRR11701751-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,569,695 reads, 14,655,230 reads pseudoaligned [quant] estimated average fragment length: 255.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR11701751.ke.tsv 34699 SRR11701751.se.tsv 87100 total ==> SRR11701751.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.98 1302 36.5824 Potri.005G024800.1.v4.1 1035 780.979 433 27.4791 Potri.004G059700.1.v4.1 961 706.979 19 1.33199 Potri.007G009000.2.v4.1 1416 1161.98 0 0 Potri.003G141000.2.v4.1 2943 2688.98 339 6.24837 Potri.016G087400.1.v4.1 270 60.0661 869 717.042 Potri.015G069301.1.v4.1 564 310.532 0 0 Potri.010G195200.1.v4.1 1773 1518.98 92 3.00186 Potri.012G127500.1.v4.1 977 722.979 9785 670.794 ==> SRR11701751.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 238 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 407 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR11701751 completed mapping pipeline successfully