Starting /dee2/code/volunteer_pipeline.sh SRR11701752 current disk space = 3052041891840 free memory = 1575299364 SRR11701752 SRAfilesize be348750af151025161295fcd971b906 SRR11701752.sra SRR11701752.sra file validated SRR11701752 is paired end SRR11701752 is conventional basespace SRR11701752 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701752_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7925 32.0 32.0 32.0 32.0 32.0 2 31.75625 32.0 32.0 32.0 32.0 32.0 3 36.00625 37.0 37.0 37.0 32.0 37.0 4 36.36 37.0 37.0 37.0 37.0 37.0 5 36.38375 37.0 37.0 37.0 37.0 37.0 6 39.61625 41.0 41.0 41.0 37.0 41.0 7 39.65675 41.0 41.0 41.0 37.0 41.0 8 39.60325 41.0 41.0 41.0 37.0 41.0 9 39.86725 41.0 41.0 41.0 37.0 41.0 10-14 39.66685 41.0 41.0 41.0 37.0 41.0 15-19 39.550650000000005 41.0 41.0 41.0 37.0 41.0 20-24 39.60185 41.0 41.0 41.0 37.0 41.0 25-29 39.2697 41.0 41.0 41.0 37.0 41.0 30-34 39.0078 41.0 41.0 41.0 36.0 41.0 35-39 39.642849999999996 41.0 41.0 41.0 37.0 41.0 40-44 39.791900000000005 41.0 41.0 41.0 37.0 41.0 45-49 40.1355 41.0 41.0 41.0 37.8 41.0 50-54 39.999700000000004 41.0 41.0 41.0 37.0 41.0 55-59 40.095200000000006 41.0 41.0 41.0 37.0 41.0 60-64 39.90560000000001 41.0 41.0 41.0 37.0 41.0 65-69 39.8241 41.0 41.0 41.0 37.0 41.0 70-74 39.93645 41.0 41.0 41.0 37.0 41.0 75-79 39.5156 41.0 41.0 41.0 37.0 41.0 80-84 39.38615 41.0 41.0 41.0 36.0 41.0 85-89 39.594649999999994 41.0 41.0 41.0 37.0 41.0 90-94 39.568149999999996 41.0 41.0 41.0 37.0 41.0 95-99 39.61525 41.0 41.0 41.0 37.0 41.0 100-104 39.48825 41.0 41.0 41.0 37.0 41.0 105-109 39.45205 41.0 41.0 41.0 37.0 41.0 110-114 39.19975000000001 41.0 41.0 41.0 36.0 41.0 115-119 39.4139 41.0 41.0 41.0 37.0 41.0 120-124 39.50645 41.0 41.0 41.0 37.0 41.0 125-129 38.992599999999996 41.0 41.0 41.0 35.0 41.0 130-134 39.048049999999996 41.0 41.0 41.0 36.0 41.0 135-139 38.63484999999999 41.0 38.6 41.0 34.0 41.0 140-144 38.56375 41.0 38.6 41.0 33.0 41.0 145-149 37.9501 41.0 37.0 41.0 32.0 41.0 150 38.21 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 2.0 28 5.0 29 18.0 30 22.0 31 38.0 32 51.0 33 46.0 34 105.0 35 101.0 36 145.0 37 226.0 38 322.0 39 606.0 40 2313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.725 16.6 15.35 35.325 2 25.124999999999996 24.975 30.85 19.05 3 20.724999999999998 30.825000000000003 25.324999999999996 23.125 4 23.474999999999998 36.775000000000006 20.349999999999998 19.400000000000002 5 22.275 37.5 21.0 19.225 6 16.05 39.875 23.549999999999997 20.525 7 16.075 18.35 43.125 22.45 8 19.075 22.025 28.449999999999996 30.45 9 17.7 21.825 32.7 27.775 10-14 21.055 29.020000000000003 27.700000000000003 22.225 15-19 21.59 27.79 27.99 22.63 20-24 21.465 29.099999999999998 27.02 22.415 25-29 21.355 28.895 27.755000000000003 21.995 30-34 21.645 28.835 27.24 22.28 35-39 21.445 29.235 27.115000000000002 22.205 40-44 21.01 29.465000000000003 27.61 21.915000000000003 45-49 21.490000000000002 28.365000000000002 27.884999999999998 22.259999999999998 50-54 22.134999999999998 28.87 27.425 21.57 55-59 21.125 28.725 27.54 22.61 60-64 21.11 29.160000000000004 27.605 22.125 65-69 20.78 28.915000000000003 27.785 22.52 70-74 21.16 29.080000000000002 28.060000000000002 21.7 75-79 21.85 28.18 27.765 22.205 80-84 21.66 28.720000000000002 27.455000000000002 22.165000000000003 85-89 21.895 28.355000000000004 28.015 21.735 90-94 21.9 28.060000000000002 27.500000000000004 22.54 95-99 22.37 28.23 27.49 21.91 100-104 21.65 28.410000000000004 27.855 22.085 105-109 22.13 27.955000000000002 27.77 22.145 110-114 21.445 28.549999999999997 27.944999999999997 22.06 115-119 21.745 27.825 28.37 22.06 120-124 22.005 27.750000000000004 28.405 21.84 125-129 22.545 27.779999999999998 27.689999999999998 21.985 130-134 22.49 27.884999999999998 27.644999999999996 21.98 135-139 22.12 27.76 28.470000000000002 21.65 140-144 22.095000000000002 27.794999999999998 28.28 21.83 145-149 22.015 28.435 27.425 22.125 150 21.45 28.525 27.175 22.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 3.0 22 4.5 23 3.0 24 2.5 25 4.0 26 5.0 27 9.0 28 14.5 29 21.0 30 26.0 31 25.0 32 32.5 33 51.5 34 64.0 35 77.0 36 94.5 37 109.0 38 131.0 39 174.5 40 206.5 41 218.0 42 239.5 43 245.0 44 253.5 45 268.0 46 248.5 47 237.5 48 226.0 49 197.0 50 161.0 51 140.0 52 124.0 53 95.0 54 76.0 55 47.0 56 32.0 57 31.5 58 24.0 59 18.0 60 15.5 61 10.5 62 7.5 63 6.0 64 5.5 65 5.5 66 4.0 67 2.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.44502617801047 91.14999999999999 2 4.397905759162303 8.4 3 0.15706806282722513 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0125 0.0 0.0 0.0 0.0 136-137 0.125 0.0 0.0 0.0 0.0 138 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCCT 10 0.006973645 144.0 2 GAGTTTA 10 0.006973645 144.0 9 CTCAGCA 10 0.006973645 144.0 1 >>END_MODULE SRR11701752 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701752_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6325 32.0 32.0 32.0 32.0 32.0 2 31.59625 32.0 32.0 32.0 32.0 32.0 3 35.20625 37.0 37.0 37.0 32.0 37.0 4 36.38625 37.0 37.0 37.0 37.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 40.24025 41.0 41.0 41.0 37.0 41.0 7 39.871 41.0 41.0 41.0 37.0 41.0 8 40.22475 41.0 41.0 41.0 37.0 41.0 9 40.1495 41.0 41.0 41.0 37.0 41.0 10-14 40.3399 41.0 41.0 41.0 40.2 41.0 15-19 39.818400000000004 41.0 41.0 41.0 37.0 41.0 20-24 40.05555 41.0 41.0 41.0 37.0 41.0 25-29 40.0096 41.0 41.0 41.0 37.0 41.0 30-34 39.95604999999999 41.0 41.0 41.0 37.0 41.0 35-39 40.0062 41.0 41.0 41.0 37.0 41.0 40-44 39.9384 41.0 41.0 41.0 37.0 41.0 45-49 39.9584 41.0 41.0 41.0 37.0 41.0 50-54 40.03725000000001 41.0 41.0 41.0 37.0 41.0 55-59 40.10745 41.0 41.0 41.0 37.0 41.0 60-64 39.88615 41.0 41.0 41.0 37.0 41.0 65-69 39.7095 41.0 41.0 41.0 37.0 41.0 70-74 39.234 41.0 41.0 41.0 35.0 41.0 75-79 38.71169999999999 41.0 39.4 41.0 33.0 41.0 80-84 38.9726 41.0 41.0 41.0 35.0 41.0 85-89 38.7256 41.0 40.2 41.0 33.0 41.0 90-94 39.384550000000004 41.0 41.0 41.0 36.0 41.0 95-99 39.3503 41.0 41.0 41.0 36.0 41.0 100-104 38.984249999999996 41.0 40.2 41.0 36.0 41.0 105-109 38.31825 41.0 37.8 41.0 32.0 41.0 110-114 38.454699999999995 41.0 37.0 41.0 32.0 41.0 115-119 38.575 41.0 38.6 41.0 32.0 41.0 120-124 38.8894 41.0 39.4 41.0 34.0 41.0 125-129 37.7337 41.0 37.0 41.0 30.0 41.0 130-134 37.686800000000005 41.0 37.0 41.0 30.0 41.0 135-139 37.438900000000004 41.0 37.0 41.0 27.0 41.0 140-144 37.4582 41.0 37.0 41.0 28.0 41.0 145-149 36.71695 41.0 37.0 41.0 27.0 41.0 150 36.854 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 9.0 29 22.0 30 37.0 31 52.0 32 70.0 33 82.0 34 120.0 35 132.0 36 192.0 37 242.0 38 335.0 39 616.0 40 2090.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.863431715857928 15.657828914457228 14.982491245622812 42.49624812406203 2 24.524524524524523 26.75175175175175 30.005005005005003 18.71871871871872 3 22.175 31.900000000000002 24.375 21.55 4 24.9 36.7 17.5 20.9 5 23.45 39.5 19.925 17.125 6 15.375 40.525 24.474999999999998 19.625 7 17.424999999999997 16.425 42.375 23.775 8 19.125 22.725 27.975 30.175 9 18.575 23.474999999999998 31.025000000000002 26.924999999999997 10-14 20.705000000000002 29.799999999999997 27.485 22.009999999999998 15-19 21.465 28.58 27.650000000000002 22.305 20-24 21.4 29.515 27.375 21.709999999999997 25-29 21.645 28.63 27.625 22.1 30-34 20.865000000000002 29.220000000000002 27.529999999999998 22.384999999999998 35-39 21.175 28.505000000000003 27.915 22.405 40-44 21.265 28.144999999999996 28.28 22.31 45-49 21.66 28.655 27.800000000000004 21.884999999999998 50-54 21.285 29.335 27.49 21.89 55-59 21.72 28.67 27.305 22.305 60-64 21.61 28.585 27.525 22.28 65-69 21.884999999999998 28.17 27.855 22.09 70-74 21.975 28.575 27.445000000000004 22.005 75-79 21.855 28.000000000000004 27.985 22.16 80-84 21.765 28.7 26.93 22.605 85-89 22.025 28.49 27.33 22.155 90-94 22.33 28.425 27.195000000000004 22.05 95-99 21.58 28.360000000000003 28.189999999999998 21.87 100-104 21.57 28.555000000000003 27.55 22.325 105-109 22.09 27.875 27.76 22.275 110-114 22.03 28.384999999999998 27.92 21.665 115-119 21.86 28.470000000000002 27.615000000000002 22.055 120-124 21.595 27.625 27.985 22.795 125-129 22.0 28.050000000000004 27.92 22.03 130-134 22.220000000000002 28.17 27.474999999999998 22.134999999999998 135-139 21.95 27.715 28.355000000000004 21.98 140-144 22.23 28.084999999999997 27.794999999999998 21.89 145-149 21.995 28.12 28.215 21.67 150 22.775000000000002 27.975 26.724999999999998 22.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 3.5 24 4.0 25 3.5 26 7.0 27 12.0 28 11.5 29 10.5 30 18.5 31 26.0 32 36.5 33 45.5 34 55.5 35 79.0 36 95.5 37 113.0 38 138.5 39 160.5 40 193.0 41 233.0 42 246.0 43 242.0 44 264.5 45 268.0 46 258.5 47 249.5 48 223.0 49 189.0 50 157.5 51 150.0 52 130.0 53 96.0 54 74.5 55 53.0 56 32.5 57 25.5 58 22.0 59 15.0 60 10.5 61 9.0 62 7.5 63 6.0 64 4.0 65 2.0 66 2.5 67 4.5 68 3.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52590266875981 91.27499999999999 2 4.290947148090005 8.200000000000001 3 0.18315018315018314 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0125 0.0 0.0 0.0 0.0 136-137 0.125 0.0 0.0 0.0 0.0 138 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAGA 10 0.006973645 144.0 6 GTATCAC 10 0.006973645 144.0 4 TTCCTGA 10 0.006973645 144.0 6 TGCTTAT 10 0.006973645 144.0 5 >>END_MODULE Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra Read 870460 spots for SRR11701752.sra Written 870460 spots for SRR11701752.sra SRR ids: ['SRR11701752.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5dz_lfia SRR11701752.sra spots: 17409200 blocks: [[1, 870460], [870461, 1740920], [1740921, 2611380], [2611381, 3481840], [3481841, 4352300], [4352301, 5222760], [5222761, 6093220], [6093221, 6963680], [6963681, 7834140], [7834141, 8704600], [8704601, 9575060], [9575061, 10445520], [10445521, 11315980], [11315981, 12186440], [12186441, 13056900], [13056901, 13927360], [13927361, 14797820], [14797821, 15668280], [15668281, 16538740], [16538741, 17409200]] SRR11701752 file size 5860705 SRR11701752 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701752 SRR11701752_1.fastq SRR11701752_2.fastq Input file: SRR11701752_1.fastq Paired file: SRR11701752_2.fastq trimmed: SRR11701752-trimmed-pair1.fastq, SRR11701752-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:26:25 2025 >> started Thu Feb 13 04:31:06 2025 >> done (280.866s) 17409200 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 17409196 (100.00%) read pairs available; of these: 501761 ( 2.88%) trimmed read pairs available after processing 16907435 (97.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 0 0.00% 26 6 0.00% 27 5 0.00% 28 7 0.00% 29 2 0.00% 30 3 0.00% 31 4 0.00% 32 2 0.00% 33 6 0.00% 34 5 0.00% 35 10 0.00% 36 5 0.00% 37 6 0.00% 38 4 0.00% 39 2 0.00% 40 5 0.00% 41 6 0.00% 42 10 0.00% 43 3 0.00% 44 8 0.00% 45 6 0.00% 46 5 0.00% 47 8 0.00% 48 5 0.00% 49 3 0.00% 50 3 0.00% 51 5 0.00% 52 2 0.00% 53 9 0.00% 54 3 0.00% 55 4 0.00% 56 5 0.00% 57 6 0.00% 58 5 0.00% 59 2 0.00% 60 3 0.00% 61 5 0.00% 62 4 0.00% 63 2 0.00% 64 6 0.00% 65 2 0.00% 66 3 0.00% 67 4 0.00% 68 1 0.00% 69 1 0.00% 70 3 0.00% 71 2 0.00% 72 3 0.00% 73 4 0.00% 74 3 0.00% 75 2 0.00% 76 1 0.00% 77 1 0.00% 78 5 0.00% 79 2 0.00% 80 3 0.00% 81 1 0.00% 82 2 0.00% 83 4 0.00% 84 2 0.00% 85 3 0.00% 86 2 0.00% 87 2 0.00% 88 6 0.00% 89 3 0.00% 90 6 0.00% 91 7 0.00% 92 14 0.00% 93 3 0.00% 94 10 0.00% 95 15 0.00% 96 12 0.00% 97 17 0.00% 98 24 0.00% 99 25 0.00% 100 34 0.00% 101 29 0.00% 102 40 0.00% 103 40 0.00% 104 38 0.00% 105 41 0.00% 106 47 0.00% 107 59 0.00% 108 50 0.00% 109 55 0.00% 110 57 0.00% 111 63 0.00% 112 67 0.00% 113 64 0.00% 114 65 0.00% 115 72 0.00% 116 72 0.00% 117 80 0.00% 118 70 0.00% 119 73 0.00% 120 86 0.00% 121 70 0.00% 122 79 0.00% 123 78 0.00% 124 73 0.00% 125 67 0.00% 126 56 0.00% 127 79 0.00% 128 65 0.00% 129 80 0.00% 130 94 0.00% 131 69 0.00% 132 63 0.00% 133 59 0.00% 134 21400 0.12% 135 21108 0.12% 136 20708 0.12% 137 20373 0.12% 138 20237 0.12% 139 20941 0.12% 140 21626 0.12% 141 22822 0.13% 142 24624 0.14% 143 25828 0.15% 144 26920 0.15% 145 27028 0.16% 146 26406 0.15% 147 26371 0.15% 148 29662 0.17% 149 143168 0.82% 150 16907435 97.12% 17409196 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.3 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=91.38 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.4 sequence=GTGGTGGTGCTTTCTCAGGGAAGGACCCAACTAAGGTGGATAGGAGTGGTGCTTACATTGTTAGGCA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.5 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=44.40 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.7 sequence=TGGTGGTGATCTCTCCAAAGACCATGACCATGTT SRR11701752 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 04:57:32 Started mapping on | Feb 13 04:57:56 Finished on | Feb 13 05:55:12 Mapping speed, Million of reads per hour | 18.24 Number of input reads | 17409196 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16000350 Uniquely mapped reads % | 91.91% Average mapped length | 297.79 Number of splices: Total | 13414159 Number of splices: Annotated (sjdb) | 13151460 Number of splices: GT/AG | 13213815 Number of splices: GC/AG | 156734 Number of splices: AT/AC | 14443 Number of splices: Non-canonical | 29167 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286865 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 759 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1121981 1121981 1121981 N_multimapping 286865 286865 286865 N_noFeature 503998 8119135 8235196 N_ambiguous 225997 38513 37901 UnstrandedReadsAssigned:15270355 PositiveStrandReadsAssigned:7842702 NegativeStrandReadsAssigned:7727253 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701752 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701752-trimmed-pair1.fastq SRR11701752-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,409,196 reads, 15,514,610 reads pseudoaligned [quant] estimated average fragment length: 249.883 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR11701752.ke.tsv 34699 SRR11701752.se.tsv 87100 total ==> SRR11701752.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.12 649 22.0077 Potri.005G024800.1.v4.1 1035 786.117 139 10.6075 Potri.004G059700.1.v4.1 961 712.123 50 4.21213 Potri.007G009000.2.v4.1 1416 1167.12 0 0 Potri.003G141000.2.v4.1 2943 2694.12 258.067 5.74651 Potri.016G087400.1.v4.1 270 59.8888 931 932.59 Potri.015G069301.1.v4.1 564 315.445 0 0 Potri.010G195200.1.v4.1 1773 1524.12 44 1.73189 Potri.012G127500.1.v4.1 977 728.123 2707 223.034 ==> SRR11701752.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1291 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 62 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR11701752 completed mapping pipeline successfully