Starting /dee2/code/volunteer_pipeline.sh SRR11701753 current disk space = 3052252164096 free memory = 1417404420 SRR11701753 SRAfilesize e92b4e5c9a6f9cbb42f8edccb4ae26cc SRR11701753.sra SRR11701753.sra file validated SRR11701753 is paired end SRR11701753 is conventional basespace SRR11701753 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701753_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76875 32.0 32.0 32.0 32.0 32.0 2 31.79125 32.0 32.0 32.0 32.0 32.0 3 36.0875 37.0 37.0 37.0 32.0 37.0 4 36.39375 37.0 37.0 37.0 37.0 37.0 5 36.3975 37.0 37.0 37.0 37.0 37.0 6 39.77025 41.0 41.0 41.0 37.0 41.0 7 39.83625 41.0 41.0 41.0 37.0 41.0 8 39.82425 41.0 41.0 41.0 37.0 41.0 9 40.11 41.0 41.0 41.0 37.0 41.0 10-14 39.92215 41.0 41.0 41.0 37.0 41.0 15-19 39.71685 41.0 41.0 41.0 37.0 41.0 20-24 39.805499999999995 41.0 41.0 41.0 37.0 41.0 25-29 39.43755 41.0 41.0 41.0 37.0 41.0 30-34 39.22515 41.0 41.0 41.0 37.0 41.0 35-39 39.76115 41.0 41.0 41.0 37.0 41.0 40-44 39.9421 41.0 41.0 41.0 37.8 41.0 45-49 40.119749999999996 41.0 41.0 41.0 39.4 41.0 50-54 40.199 41.0 41.0 41.0 37.8 41.0 55-59 40.15665 41.0 41.0 41.0 37.8 41.0 60-64 40.070550000000004 41.0 41.0 41.0 37.0 41.0 65-69 39.977549999999994 41.0 41.0 41.0 37.0 41.0 70-74 40.115050000000004 41.0 41.0 41.0 37.0 41.0 75-79 39.63175 41.0 41.0 41.0 37.0 41.0 80-84 39.5032 41.0 41.0 41.0 37.0 41.0 85-89 39.7161 41.0 41.0 41.0 37.0 41.0 90-94 39.6355 41.0 41.0 41.0 37.0 41.0 95-99 39.726749999999996 41.0 41.0 41.0 37.0 41.0 100-104 39.471199999999996 41.0 41.0 41.0 37.0 41.0 105-109 39.60075 41.0 41.0 41.0 37.0 41.0 110-114 39.3938 41.0 41.0 41.0 36.0 41.0 115-119 39.6299 41.0 41.0 41.0 37.0 41.0 120-124 39.66245 41.0 41.0 41.0 37.0 41.0 125-129 39.288650000000004 41.0 41.0 41.0 36.0 41.0 130-134 39.2336 41.0 41.0 41.0 36.0 41.0 135-139 38.966499999999996 41.0 40.2 41.0 36.0 41.0 140-144 38.721900000000005 41.0 38.6 41.0 33.0 41.0 145-149 38.2648 41.0 37.0 41.0 32.0 41.0 150 38.3665 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 3.0 28 3.0 29 5.0 30 24.0 31 32.0 32 32.0 33 58.0 34 69.0 35 110.0 36 141.0 37 190.0 38 317.0 39 535.0 40 2481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.35 16.5 15.45 35.699999999999996 2 26.35 24.4 29.025000000000002 20.225 3 22.225 29.825000000000003 25.1 22.85 4 24.474999999999998 35.925000000000004 20.125 19.475 5 22.900000000000002 38.35 21.0 17.75 6 17.025000000000002 38.45 25.074999999999996 19.45 7 17.325 18.275 42.725 21.675 8 18.725 22.125 29.849999999999998 29.299999999999997 9 18.975 21.05 33.525 26.450000000000003 10-14 20.669999999999998 29.709999999999997 26.919999999999998 22.7 15-19 21.27 28.01 28.575 22.145 20-24 20.84 29.549999999999997 27.595 22.015 25-29 21.54 28.365000000000002 27.61 22.485 30-34 21.55 28.785 27.884999999999998 21.78 35-39 21.45 29.160000000000004 27.465 21.925 40-44 21.42 28.305000000000003 28.134999999999998 22.14 45-49 21.525 28.645 27.339999999999996 22.49 50-54 21.135 29.025000000000002 27.52 22.32 55-59 22.405 28.084999999999997 27.084999999999997 22.425 60-64 21.72 28.525 27.755000000000003 22.0 65-69 21.54 29.044999999999998 27.38 22.035 70-74 21.4 29.349999999999998 27.575 21.675 75-79 22.13 27.72 27.68 22.470000000000002 80-84 21.13 29.29 27.235 22.345000000000002 85-89 21.945 28.115000000000002 27.884999999999998 22.055 90-94 22.02 27.98 27.62 22.38 95-99 21.91 28.42 27.875 21.795 100-104 21.845 28.675 27.384999999999998 22.095000000000002 105-109 21.935 27.915 27.750000000000004 22.400000000000002 110-114 22.259999999999998 28.860000000000003 27.015 21.865000000000002 115-119 21.93 28.660000000000004 27.794999999999998 21.615000000000002 120-124 22.134999999999998 27.47 28.384999999999998 22.009999999999998 125-129 21.915000000000003 27.67 28.025 22.39 130-134 21.795 28.005000000000003 28.27 21.93 135-139 22.66 27.925 28.205000000000002 21.21 140-144 22.795 28.21 27.534999999999997 21.46 145-149 22.06 28.599999999999998 27.189999999999998 22.15 150 21.45 29.275000000000002 28.65 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 4.0 26 6.5 27 13.0 28 20.0 29 19.5 30 19.0 31 26.0 32 29.5 33 35.5 34 53.5 35 82.0 36 105.0 37 107.5 38 129.0 39 162.0 40 192.5 41 228.5 42 245.0 43 251.5 44 257.0 45 260.5 46 257.5 47 241.0 48 231.5 49 216.0 50 168.5 51 139.5 52 117.5 53 91.0 54 71.5 55 50.0 56 42.0 57 38.0 58 27.0 59 13.0 60 6.5 61 7.5 62 8.0 63 5.0 64 4.0 65 2.0 66 1.5 67 3.0 68 2.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.375 #Duplication Level Percentage of deduplicated Percentage of total 1 96.31647211413748 92.825 2 3.631647211413749 7.000000000000001 3 0.02594033722438392 0.075 4 0.02594033722438392 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.48750000000000004 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAA 10 0.006973645 144.0 1 GGAAAGC 10 0.006973645 144.0 1 >>END_MODULE SRR11701753 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11701753_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5775 32.0 32.0 32.0 32.0 32.0 2 31.435 32.0 32.0 32.0 32.0 32.0 3 35.015 37.0 32.0 37.0 32.0 37.0 4 36.345 37.0 37.0 37.0 37.0 37.0 5 36.46 37.0 37.0 37.0 37.0 37.0 6 40.042 41.0 41.0 41.0 37.0 41.0 7 39.9235 41.0 41.0 41.0 37.0 41.0 8 40.132 41.0 41.0 41.0 37.0 41.0 9 40.11275 41.0 41.0 41.0 37.0 41.0 10-14 40.111200000000004 41.0 41.0 41.0 37.0 41.0 15-19 39.7467 41.0 41.0 41.0 37.0 41.0 20-24 39.94349999999999 41.0 41.0 41.0 37.0 41.0 25-29 39.87785 41.0 41.0 41.0 37.0 41.0 30-34 39.822050000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.9013 41.0 41.0 41.0 37.0 41.0 40-44 39.868849999999995 41.0 41.0 41.0 37.0 41.0 45-49 39.768950000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.83454999999999 41.0 41.0 41.0 37.0 41.0 55-59 39.81865 41.0 41.0 41.0 37.0 41.0 60-64 39.734899999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.62245 41.0 41.0 41.0 37.0 41.0 70-74 39.02675000000001 41.0 41.0 41.0 34.0 41.0 75-79 38.44165 41.0 37.8 41.0 32.0 41.0 80-84 38.922450000000005 41.0 41.0 41.0 33.0 41.0 85-89 38.4501 41.0 39.4 41.0 32.0 41.0 90-94 39.0493 41.0 41.0 41.0 35.0 41.0 95-99 39.06955 41.0 41.0 41.0 35.0 41.0 100-104 38.691500000000005 41.0 40.2 41.0 32.0 41.0 105-109 38.345150000000004 41.0 38.6 41.0 32.0 41.0 110-114 38.24974999999999 41.0 37.0 41.0 32.0 41.0 115-119 38.548100000000005 41.0 38.6 41.0 33.0 41.0 120-124 38.61795 41.0 37.8 41.0 33.0 41.0 125-129 37.79325 41.0 37.0 41.0 31.0 41.0 130-134 37.55195 41.0 37.0 41.0 27.0 41.0 135-139 37.24235 41.0 37.0 41.0 28.0 41.0 140-144 37.00235 41.0 37.0 41.0 27.0 41.0 145-149 36.78375 41.0 37.0 41.0 27.0 41.0 150 36.79775 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 2.0 28 16.0 29 29.0 30 48.0 31 71.0 32 82.0 33 113.0 34 123.0 35 128.0 36 186.0 37 239.0 38 317.0 39 576.0 40 2070.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.463731865932967 16.208104052026012 14.432216108054027 41.89594797398699 2 25.031320471059885 27.38661989476322 28.664495114006517 18.917564520170384 3 22.475 32.300000000000004 23.974999999999998 21.25 4 24.275 36.75 19.275000000000002 19.7 5 23.150000000000002 39.125 19.75 17.974999999999998 6 16.475 39.45 23.95 20.125 7 16.425 17.375 42.85 23.35 8 19.575 22.85 29.525000000000002 28.050000000000004 9 18.7 22.2 32.45 26.650000000000002 10-14 21.45 29.904999999999998 26.784999999999997 21.86 15-19 21.815 28.51 27.529999999999998 22.145 20-24 21.88 28.555000000000003 27.700000000000003 21.865000000000002 25-29 21.15 28.265 27.794999999999998 22.79 30-34 21.285 29.270000000000003 27.88 21.565 35-39 21.535 28.575 27.544999999999998 22.345000000000002 40-44 21.310000000000002 28.485 27.500000000000004 22.705000000000002 45-49 21.12 28.449999999999996 27.725 22.705000000000002 50-54 21.07 28.65 28.095 22.185 55-59 21.57 28.685 27.534999999999997 22.21 60-64 21.029999999999998 28.92 27.229999999999997 22.82 65-69 22.134999999999998 28.98 27.165 21.72 70-74 22.235 29.025000000000002 27.16 21.58 75-79 21.8 28.26 27.439999999999998 22.5 80-84 22.08 28.105000000000004 27.72 22.095000000000002 85-89 22.675 28.055000000000003 27.634999999999998 21.634999999999998 90-94 21.855 27.975 27.889999999999997 22.28 95-99 22.0 28.345 27.675 21.98 100-104 21.665 27.735 28.62 21.98 105-109 21.87 27.73 28.360000000000003 22.040000000000003 110-114 21.755 27.589999999999996 28.53 22.125 115-119 22.41 27.605 27.47 22.515 120-124 21.2 28.155 28.035 22.61 125-129 21.95 28.615000000000002 27.474999999999998 21.959999999999997 130-134 22.13 27.655 27.894999999999996 22.32 135-139 22.515 27.534999999999997 28.189999999999998 21.759999999999998 140-144 22.055 27.01 28.73 22.205 145-149 22.645 27.66 27.41 22.285 150 22.125 29.175 27.825 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.5 24 2.5 25 5.0 26 7.5 27 9.5 28 10.5 29 14.0 30 22.0 31 27.5 32 34.0 33 43.0 34 55.5 35 75.0 36 101.5 37 111.0 38 127.5 39 156.0 40 181.0 41 215.5 42 248.5 43 265.0 44 273.0 45 270.0 46 256.0 47 243.0 48 223.0 49 206.5 50 177.5 51 133.5 52 115.0 53 99.0 54 69.0 55 51.0 56 37.5 57 32.0 58 26.0 59 17.0 60 12.0 61 10.5 62 7.0 63 5.5 64 5.0 65 3.0 66 2.5 67 1.0 68 1.5 69 2.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.39709694142043 92.975 2 3.551062726801452 6.8500000000000005 3 0.02592016588906169 0.075 4 0.02592016588906169 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.5 0.0 0.0 0.0 0.0 138 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044812 spots for SRR11701753.sra Written 1044812 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra Read 1044793 spots for SRR11701753.sra Written 1044793 spots for SRR11701753.sra SRR ids: ['SRR11701753.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k5p7v_p8 SRR11701753.sra spots: 20895879 blocks: [[1, 1044793], [1044794, 2089586], [2089587, 3134379], [3134380, 4179172], [4179173, 5223965], [5223966, 6268758], [6268759, 7313551], [7313552, 8358344], [8358345, 9403137], [9403138, 10447930], [10447931, 11492723], [11492724, 12537516], [12537517, 13582309], [13582310, 14627102], [14627103, 15671895], [15671896, 16716688], [16716689, 17761481], [17761482, 18806274], [18806275, 19851067], [19851068, 20895879]] SRR11701753 file size 7038821 SRR11701753 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11701753 SRR11701753_1.fastq SRR11701753_2.fastq Input file: SRR11701753_1.fastq Paired file: SRR11701753_2.fastq trimmed: SRR11701753-trimmed-pair1.fastq, SRR11701753-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 02:36:48 2025 >> started Thu Feb 13 02:44:41 2025 >> done (473.644s) 20895879 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 20895876 (100.00%) read pairs available; of these: 759322 ( 3.63%) trimmed read pairs available after processing 20136554 (96.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 6 0.00% 23 3 0.00% 24 1 0.00% 25 4 0.00% 26 8 0.00% 27 3 0.00% 28 2 0.00% 29 9 0.00% 30 3 0.00% 31 7 0.00% 32 6 0.00% 33 2 0.00% 34 4 0.00% 35 2 0.00% 36 2 0.00% 37 5 0.00% 38 9 0.00% 39 7 0.00% 40 6 0.00% 41 5 0.00% 42 5 0.00% 43 9 0.00% 44 2 0.00% 45 2 0.00% 46 7 0.00% 47 5 0.00% 48 3 0.00% 49 5 0.00% 50 2 0.00% 51 5 0.00% 52 4 0.00% 53 7 0.00% 54 4 0.00% 55 9 0.00% 56 6 0.00% 57 3 0.00% 58 6 0.00% 59 4 0.00% 60 7 0.00% 61 5 0.00% 62 4 0.00% 63 5 0.00% 64 3 0.00% 65 10 0.00% 66 1 0.00% 67 2 0.00% 68 8 0.00% 69 4 0.00% 70 4 0.00% 71 6 0.00% 72 4 0.00% 73 4 0.00% 74 8 0.00% 75 3 0.00% 76 3 0.00% 77 3 0.00% 78 2 0.00% 79 2 0.00% 80 4 0.00% 81 3 0.00% 82 1 0.00% 83 2 0.00% 84 5 0.00% 85 2 0.00% 86 3 0.00% 87 2 0.00% 88 8 0.00% 89 7 0.00% 90 6 0.00% 91 12 0.00% 92 7 0.00% 93 13 0.00% 94 13 0.00% 95 21 0.00% 96 21 0.00% 97 15 0.00% 98 20 0.00% 99 28 0.00% 100 43 0.00% 101 36 0.00% 102 45 0.00% 103 36 0.00% 104 64 0.00% 105 54 0.00% 106 55 0.00% 107 65 0.00% 108 54 0.00% 109 74 0.00% 110 73 0.00% 111 74 0.00% 112 82 0.00% 113 83 0.00% 114 65 0.00% 115 68 0.00% 116 92 0.00% 117 93 0.00% 118 86 0.00% 119 96 0.00% 120 94 0.00% 121 93 0.00% 122 122 0.00% 123 89 0.00% 124 103 0.00% 125 103 0.00% 126 100 0.00% 127 106 0.00% 128 110 0.00% 129 94 0.00% 130 87 0.00% 131 107 0.00% 132 80 0.00% 133 98 0.00% 134 37049 0.18% 135 36963 0.18% 136 35282 0.17% 137 34601 0.17% 138 33773 0.16% 139 34290 0.16% 140 34803 0.17% 141 36047 0.17% 142 38394 0.18% 143 38970 0.19% 144 40244 0.19% 145 40232 0.19% 146 39369 0.19% 147 37802 0.18% 148 42025 0.20% 149 196288 0.94% 150 20136554 96.37% 20895876 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.4 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=38.31 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.0 sequence=ATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=36 prefix-density=0.20 prefix-fanout=2.5 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=150.13 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=14.2 sequence=TGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGCTACTGATGCCAAGAGAAACGCTAGAGACTCTCATGTCCCTATTTTGGCTCCCCTTCCCATTGGATTTGCAGTCTTCTTGGTTCATTTGGCTACCATCCCCATAACTGGAACTGGCATTAACCCGGCAAGGAGTCTTGGAGCCGCCATCATCTTCAAC SRR11701753 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 03:20:06 Started mapping on | Feb 13 03:20:22 Finished on | Feb 13 04:42:01 Mapping speed, Million of reads per hour | 15.36 Number of input reads | 20895876 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18894834 Uniquely mapped reads % | 90.42% Average mapped length | 297.69 Number of splices: Total | 16047836 Number of splices: Annotated (sjdb) | 15740976 Number of splices: GT/AG | 15808932 Number of splices: GC/AG | 187502 Number of splices: AT/AC | 16293 Number of splices: Non-canonical | 35109 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343818 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 1246 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.91% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1657224 1657224 1657224 N_multimapping 343818 343818 343818 N_noFeature 589880 9593230 9716639 N_ambiguous 270957 48757 47855 UnstrandedReadsAssigned:18033997 PositiveStrandReadsAssigned:9252847 NegativeStrandReadsAssigned:9130340 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11701753 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR11701753-trimmed-pair1.fastq SRR11701753-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,895,876 reads, 18,334,022 reads pseudoaligned [quant] estimated average fragment length: 259.994 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR11701753.ke.tsv 34699 SRR11701753.se.tsv 87100 total ==> SRR11701753.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.01 877 25.3746 Potri.005G024800.1.v4.1 1035 776.006 184 12.0676 Potri.004G059700.1.v4.1 961 702.024 47 3.40732 Potri.007G009000.2.v4.1 1416 1157.01 0 0 Potri.003G141000.2.v4.1 2943 2684.01 280 5.30936 Potri.016G087400.1.v4.1 270 61.3761 939 778.635 Potri.015G069301.1.v4.1 564 305.872 0 0 Potri.010G195200.1.v4.1 1773 1514.01 93 3.12624 Potri.012G127500.1.v4.1 977 718.006 5027 356.327 ==> SRR11701753.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1976 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 413 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 48 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR11701753 completed mapping pipeline successfully