Starting /dee2/code/volunteer_pipeline.sh SRR1171652 current disk space = 3089043148800 free memory = 1398079068 SRR1171652 SRAfilesize 4290833c527115fe26517855aed72b92 SRR1171652.sra SRR1171652.sra file validated SRR1171652 is paired end SRR1171652 is conventional basespace SRR1171652 read1 length is 90 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1171652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.17025 39.0 2.0 39.0 2.0 39.0 2 33.61975 39.0 27.0 39.0 21.0 39.0 3 33.59975 39.0 27.0 39.0 21.0 39.0 4 33.52925 39.0 27.0 39.0 20.0 39.0 5 33.30975 39.0 27.0 39.0 18.0 39.0 6 34.4 39.0 29.0 39.0 24.0 39.0 7 34.34525 39.0 29.0 39.0 23.0 39.0 8 34.2875 39.0 29.0 39.0 23.0 39.0 9 34.261 39.0 28.0 39.0 23.0 39.0 10-11 35.411125 39.0 31.5 39.0 27.0 39.0 12-13 36.565250000000006 39.0 35.0 39.0 31.5 39.0 14-15 36.45125 39.0 35.0 39.0 31.0 39.0 16-17 36.373625000000004 39.0 35.0 39.0 31.0 39.0 18-19 36.336625 38.0 35.0 39.0 31.0 39.0 20-21 36.2585 38.0 35.0 39.0 31.0 39.0 22-23 36.19025 38.0 35.0 39.0 31.0 39.0 24-25 36.063625 38.0 35.0 39.0 31.0 39.0 26-27 35.848124999999996 38.0 35.0 39.0 30.0 39.0 28-29 35.681625 38.0 35.0 39.0 30.0 39.0 30-31 35.493624999999994 38.0 35.0 39.0 29.5 39.0 32-33 35.217875 37.0 35.0 39.0 28.0 39.0 34-35 35.133625 37.0 35.0 39.0 28.0 39.0 36-37 35.073625 37.5 35.0 39.0 28.0 39.0 38-39 35.0975 37.0 35.0 39.0 28.0 39.0 40-41 35.266125 37.5 35.0 39.0 29.0 39.0 42-43 35.320750000000004 37.0 35.0 39.0 29.5 39.0 44-45 35.056875 37.0 35.0 39.0 28.5 39.0 46-47 34.966875 37.0 35.0 39.0 28.5 39.0 48-49 34.8005 37.0 35.0 39.0 28.0 39.0 50-51 34.5475 37.0 35.0 39.0 27.0 39.0 52-53 34.500625 37.0 35.0 39.0 27.5 39.0 54-55 34.321 37.0 34.0 39.0 27.0 39.0 56-57 34.194 37.0 34.0 39.0 27.0 39.0 58-59 34.033375 36.0 33.5 39.0 27.0 39.0 60-61 33.693250000000006 36.0 33.0 39.0 25.5 39.0 62-63 33.480374999999995 36.0 32.5 39.0 25.0 39.0 64-65 33.258125 36.0 32.0 39.0 24.5 39.0 66-67 32.926249999999996 36.0 31.5 39.0 24.0 39.0 68-69 32.604875 36.0 31.0 39.0 22.5 39.0 70-71 32.133875 35.0 31.0 38.5 21.5 39.0 72-73 31.717624999999998 35.0 30.0 37.5 20.0 39.0 74-75 31.423125 35.0 30.0 37.0 19.0 39.0 76-77 31.668875 36.0 30.0 39.0 16.5 39.0 78-79 31.512999999999998 36.0 30.0 39.0 15.5 39.0 80-81 31.55025 36.0 30.5 39.0 7.5 39.0 82-83 31.443 36.0 30.5 39.0 2.0 39.0 84-85 31.096874999999997 35.5 30.0 39.0 2.0 39.0 86-87 30.707124999999998 35.0 29.5 39.0 2.0 39.0 88-89 30.409750000000003 35.0 29.0 38.0 2.0 39.0 90 30.16675 35.0 29.0 38.0 2.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 4.0 5 1.0 6 3.0 7 6.0 8 7.0 9 6.0 10 4.0 11 8.0 12 9.0 13 12.0 14 12.0 15 13.0 16 10.0 17 13.0 18 15.0 19 14.0 20 31.0 21 30.0 22 34.0 23 32.0 24 36.0 25 61.0 26 57.0 27 72.0 28 93.0 29 125.0 30 167.0 31 186.0 32 282.0 33 174.0 34 134.0 35 194.0 36 283.0 37 531.0 38 1326.0 39 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.48598130841122 10.981308411214954 13.184245660881174 36.34846461949265 2 27.725 17.45 31.874999999999996 22.95 3 25.224999999999998 18.725 25.650000000000002 30.4 4 27.825 22.675 24.65 24.85 5 27.650000000000002 25.85 27.224999999999998 19.275000000000002 6 21.575 32.225 26.3 19.900000000000002 7 17.75 21.349999999999998 39.775 21.125 8 21.075 25.924999999999997 30.85 22.15 9 20.8 25.575 29.75 23.875 10-11 21.775 33.5875 24.675 19.9625 12-13 21.512500000000003 26.900000000000002 29.2875 22.3 14-15 20.825 29.1375 27.950000000000003 22.0875 16-17 21.7375 27.737499999999997 28.4 22.125 18-19 22.025 28.3875 28.275 21.3125 20-21 21.825 28.3125 27.0125 22.85 22-23 22.6 27.675 27.3625 22.3625 24-25 22.9625 27.775 27.0125 22.25 26-27 22.175 28.749999999999996 27.425 21.65 28-29 22.225 27.3375 27.625 22.8125 30-31 22.2125 28.3875 27.6875 21.712500000000002 32-33 21.375 28.625 27.9125 22.0875 34-35 22.237499999999997 28.0625 27.037499999999998 22.662499999999998 36-37 21.15 28.3375 28.287499999999998 22.225 38-39 22.875 28.025 27.537499999999998 21.5625 40-41 22.9375 28.499999999999996 27.075 21.4875 42-43 22.6 28.5625 27.05 21.7875 44-45 22.3125 27.9125 27.462500000000002 22.3125 46-47 22.3375 27.450000000000003 27.8625 22.35 48-49 21.8875 28.1875 28.0625 21.8625 50-51 22.15 27.8875 27.537499999999998 22.425 52-53 22.775000000000002 27.950000000000003 27.200000000000003 22.075 54-55 22.5125 27.875 27.3125 22.3 56-57 22.2125 28.5625 27.6375 21.587500000000002 58-59 22.3875 27.712500000000002 27.375 22.525000000000002 60-61 22.7 28.037499999999998 27.775 21.4875 62-63 23.05 26.924999999999997 28.325 21.7 64-65 22.675 27.725 27.825 21.775 66-67 22.6875 27.150000000000002 28.3875 21.775 68-69 23.0875 28.325 26.487500000000004 22.1 70-71 22.8375 26.875 28.199999999999996 22.0875 72-73 23.150000000000002 27.925 27.6 21.325 74-75 22.5875 26.737499999999997 27.8625 22.8125 76-77 22.3 27.8625 28.7 21.1375 78-79 22.8125 27.3125 27.150000000000002 22.725 80-81 22.0125 28.4 27.437499999999996 22.15 82-83 23.5125 27.35 28.075 21.0625 84-85 22.475 27.525 28.199999999999996 21.8 86-87 21.637500000000003 28.0875 27.474999999999998 22.8 88-89 21.462500000000002 28.6625 27.575 22.3 90 21.925 29.325000000000003 26.55 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 1.5 26 4.0 27 9.0 28 11.5 29 15.5 30 20.0 31 22.0 32 34.5 33 44.0 34 53.5 35 77.5 36 112.0 37 141.5 38 178.0 39 205.5 40 205.0 41 228.5 42 266.5 43 289.5 44 286.0 45 287.5 46 278.5 47 250.0 48 231.5 49 195.0 50 171.0 51 164.5 52 142.0 53 112.0 54 84.0 55 63.5 56 49.0 57 37.5 58 31.0 59 23.5 60 19.0 61 18.5 62 14.5 63 9.0 64 4.5 65 2.0 66 3.5 67 5.0 68 2.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 25.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 90 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.6054490413723511 1.2 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTTCTTTTCCTCTGGTTACTAAGATGTTTCAGTTCGCCAGGTTGTCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1171652 read2 length is 90 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1171652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5265 39.0 37.0 39.0 31.0 39.0 2 37.32075 39.0 37.0 39.0 34.0 39.0 3 37.29325 39.0 37.0 39.0 34.0 39.0 4 36.87175 39.0 37.0 39.0 33.0 39.0 5 37.2165 39.0 37.0 39.0 34.0 39.0 6 37.09875 39.0 37.0 39.0 34.0 39.0 7 37.331 39.0 37.0 39.0 34.0 39.0 8 37.316 39.0 37.0 39.0 34.0 39.0 9 37.26325 39.0 37.0 39.0 34.0 39.0 10-11 37.20075 39.0 37.0 39.0 34.0 39.0 12-13 37.287875 39.0 37.0 39.0 34.0 39.0 14-15 37.147 39.0 37.0 39.0 33.5 39.0 16-17 37.299 39.0 37.0 39.0 34.5 39.0 18-19 37.162 39.0 37.0 39.0 33.5 39.0 20-21 37.0865 39.0 37.0 39.0 33.5 39.0 22-23 36.908500000000004 39.0 37.0 39.0 33.0 39.0 24-25 36.8685 39.0 37.0 39.0 33.0 39.0 26-27 36.69425 39.0 36.5 39.0 33.0 39.0 28-29 36.575874999999996 39.0 36.0 39.0 33.0 39.0 30-31 36.47025 39.0 36.0 39.0 32.5 39.0 32-33 36.25275 38.5 36.0 39.0 31.5 39.0 34-35 36.077124999999995 38.0 36.0 39.0 31.0 39.0 36-37 35.785624999999996 38.0 35.0 39.0 30.5 39.0 38-39 35.759125 37.0 35.0 39.0 30.5 39.0 40-41 36.02 38.0 35.5 39.0 31.5 39.0 42-43 35.981875 38.0 36.0 39.0 31.0 39.0 44-45 35.956125 37.5 36.0 39.0 31.0 39.0 46-47 35.631125 37.0 35.0 39.0 30.5 39.0 48-49 35.471875 37.0 35.0 39.0 30.0 39.0 50-51 35.60525 38.0 35.5 39.0 30.5 39.0 52-53 35.921875 38.0 36.0 39.0 31.0 39.0 54-55 35.7675 38.0 36.0 39.0 30.5 39.0 56-57 35.998125 39.0 36.0 39.0 31.0 39.0 58-59 35.684625 39.0 36.0 39.0 30.5 39.0 60-61 35.698125000000005 39.0 36.0 39.0 30.5 39.0 62-63 35.557 38.5 36.0 39.0 30.0 39.0 64-65 35.327375 38.0 35.0 39.0 29.5 39.0 66-67 35.154875000000004 38.0 35.5 39.0 29.5 39.0 68-69 34.841125000000005 37.0 35.0 39.0 28.0 39.0 70-71 34.702749999999995 37.0 35.0 39.0 28.0 39.0 72-73 34.343625 37.0 34.0 39.0 27.0 39.0 74-75 34.0945 37.0 34.0 39.0 27.0 39.0 76-77 33.567499999999995 37.0 33.0 39.0 25.0 39.0 78-79 33.356375 37.0 33.0 39.0 24.5 39.0 80-81 33.013999999999996 37.0 33.0 39.0 22.5 39.0 82-83 32.649125 36.0 32.0 39.0 21.0 39.0 84-85 32.304875 36.0 32.0 39.0 20.0 39.0 86-87 31.845750000000002 36.0 31.5 38.5 14.5 39.0 88-89 31.412750000000003 36.0 31.0 38.0 5.5 39.0 90 31.12125 36.0 31.0 38.0 2.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 2.0 5 3.0 6 6.0 7 2.0 8 2.0 9 7.0 10 4.0 11 5.0 12 5.0 13 5.0 14 8.0 15 6.0 16 10.0 17 12.0 18 9.0 19 10.0 20 12.0 21 10.0 22 21.0 23 14.0 24 22.0 25 24.0 26 29.0 27 39.0 28 34.0 29 53.0 30 77.0 31 72.0 32 112.0 33 150.0 34 202.0 35 305.0 36 456.0 37 807.0 38 1452.0 39 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.909090909090914 5.0 13.83838383838384 40.25252525252525 2 26.85 16.05 31.624999999999996 25.474999999999998 3 24.349999999999998 17.974999999999998 25.874999999999996 31.8 4 28.349999999999998 21.15 25.275 25.224999999999998 5 28.025 24.65 27.3 20.025000000000002 6 23.799999999999997 30.325000000000003 25.224999999999998 20.65 7 19.875 20.849999999999998 39.050000000000004 20.225 8 20.375 26.775 29.799999999999997 23.05 9 21.125 23.9 32.75 22.225 10-11 22.3625 31.412499999999998 25.137500000000003 21.087500000000002 12-13 21.15 26.8375 29.5375 22.475 14-15 21.3875 28.037499999999998 28.549999999999997 22.025 16-17 21.975 27.125 28.812500000000004 22.0875 18-19 21.625 27.474999999999998 28.675 22.225 20-21 21.0625 29.1125 27.962500000000002 21.8625 22-23 22.85 27.675 27.462500000000002 22.0125 24-25 21.6125 28.15 27.737499999999997 22.5 26-27 22.275 28.625 27.9375 21.1625 28-29 22.3125 27.6375 27.8375 22.2125 30-31 21.425 28.0875 27.8625 22.625 32-33 21.5625 27.825 28.225 22.3875 34-35 22.2625 28.0875 27.5875 22.0625 36-37 21.7 28.037499999999998 28.7 21.5625 38-39 22.675 27.1 28.199999999999996 22.025 40-41 21.637500000000003 28.299999999999997 27.975 22.0875 42-43 22.8625 27.775 26.950000000000003 22.412499999999998 44-45 21.7375 28.475 27.725 22.0625 46-47 22.4375 27.712500000000002 27.1125 22.7375 48-49 23.2625 26.825 27.650000000000002 22.2625 50-51 21.965245655706962 27.603450431303912 27.965995749468686 22.46530816352044 52-53 22.0 28.5625 27.037499999999998 22.400000000000002 54-55 21.6625 28.175 27.437499999999996 22.725 56-57 22.237499999999997 27.900000000000002 28.3625 21.5 58-59 22.977872234029252 27.278409801225152 27.19089886235779 22.552819102387797 60-61 22.037499999999998 27.037499999999998 27.825 23.1 62-63 22.5625 26.787499999999998 28.225 22.425 64-65 21.7875 28.000000000000004 27.825 22.3875 66-67 23.5625 27.737499999999997 25.587500000000002 23.1125 68-69 22.5625 27.487499999999997 27.3 22.650000000000002 70-71 22.875 28.025 27.025 22.075 72-73 22.5125 26.974999999999998 27.6125 22.900000000000002 74-75 21.8875 27.3 28.175 22.6375 76-77 22.400000000000002 28.825 26.474999999999998 22.3 78-79 21.525 28.1625 26.950000000000003 23.3625 80-81 23.1 27.037499999999998 27.750000000000004 22.112499999999997 82-83 22.6125 27.800000000000004 26.987499999999997 22.6 84-85 23.0 27.675 27.224999999999998 22.1 86-87 21.6875 28.3125 27.3875 22.6125 88-89 22.650000000000002 27.200000000000003 27.450000000000003 22.7 90 22.125 27.0 27.35 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.5 24 1.0 25 0.5 26 4.0 27 7.5 28 13.0 29 18.5 30 19.0 31 24.0 32 34.5 33 47.5 34 60.5 35 77.5 36 94.0 37 122.0 38 154.0 39 183.0 40 203.0 41 214.0 42 245.0 43 270.5 44 273.5 45 262.5 46 258.0 47 263.5 48 244.0 49 211.5 50 200.0 51 183.5 52 158.0 53 142.0 54 103.5 55 76.5 56 71.0 57 50.0 58 31.0 59 22.5 60 22.0 61 17.5 62 19.0 63 16.0 64 6.5 65 4.0 66 1.5 67 1.5 68 2.5 69 2.0 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 90 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1141483168818 97.89999999999999 2 0.7339913945836497 1.4500000000000002 3 0.07593014426727411 0.22499999999999998 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.02531004808909137 0.15 7 0.02531004808909137 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAG 7 0.17500000000000002 No Hit GCTTTCTTTTCCTCTGGTTACTAAGATGTTTCAGTTCGCCAGGTTGTCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461052 spots for SRR1171652.sra Written 3461052 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra Read 3461035 spots for SRR1171652.sra Written 3461035 spots for SRR1171652.sra SRR ids: ['SRR1171652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ks32c0nk SRR1171652.sra spots: 69220717 blocks: [[1, 3461035], [3461036, 6922070], [6922071, 10383105], [10383106, 13844140], [13844141, 17305175], [17305176, 20766210], [20766211, 24227245], [24227246, 27688280], [27688281, 31149315], [31149316, 34610350], [34610351, 38071385], [38071386, 41532420], [41532421, 44993455], [44993456, 48454490], [48454491, 51915525], [51915526, 55376560], [55376561, 58837595], [58837596, 62298630], [62298631, 65759665], [65759666, 69220717]] SRR1171652 file size 15120331 SRR1171652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1171652 SRR1171652_1.fastq SRR1171652_2.fastq Input file: SRR1171652_1.fastq Paired file: SRR1171652_2.fastq trimmed: SRR1171652-trimmed-pair1.fastq, SRR1171652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:35:17 2025 >> started Fri Feb 14 01:36:19 2025 >> done (62.051s) 69220717 read pairs processed; of these: 231298 ( 0.33%) short read pairs filtered out after trimming by size control 184851 ( 0.27%) empty read pairs filtered out after trimming by size control 68804568 (99.40%) read pairs available; of these: 14830394 (21.55%) trimmed read pairs available after processing 53974174 (78.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 3 0.00% 33 0 0.00% 34 2 0.00% 35 2 0.00% 36 1 0.00% 37 1 0.00% 38 7 0.00% 39 4 0.00% 40 4 0.00% 41 2 0.00% 42 1 0.00% 43 2 0.00% 44 6 0.00% 45 8029 0.01% 46 16879 0.02% 47 26576 0.04% 48 20248 0.03% 49 32737 0.05% 50 29230 0.04% 51 33881 0.05% 52 45405 0.07% 53 33097 0.05% 54 96781 0.14% 55 106620 0.15% 56 94850 0.14% 57 195074 0.28% 58 81523 0.12% 59 153860 0.22% 60 162910 0.24% 61 117142 0.17% 62 238206 0.35% 63 97217 0.14% 64 165060 0.24% 65 175755 0.26% 66 149100 0.22% 67 306203 0.45% 68 124639 0.18% 69 252235 0.37% 70 274891 0.40% 71 178651 0.26% 72 391368 0.57% 73 168564 0.24% 74 343016 0.50% 75 398256 0.58% 76 272356 0.40% 77 623141 0.91% 78 238740 0.35% 79 513579 0.75% 80 613147 0.89% 81 428590 0.62% 82 966614 1.40% 83 327441 0.48% 84 750740 1.09% 85 910867 1.32% 86 673733 0.98% 87 1929812 2.80% 88 580323 0.84% 89 1483265 2.16% 90 53974174 78.45% 68804568 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.17 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=46.62 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.6 sequence=TTGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCTCCAAGAACTTCATGAGCCTGCCTAATATCAAGGTTCCTCTCATCTTGGGTGTTTGGGGAGGCAAAGGCCAAGGAAAATCCTTCCAGTGTGAACTTGTCTTTGCCAAGATGGGAATTAACCCAATCATGATGAGTGCTGGAGAATTGGAAAGTGGGAACGCTGGTGAACCCGCAAAGCTTATCAGGCAAAGGTACCGTGAGGCGGCTGATATAATCAAGAAGAAGGGAAAGATGTGCTGCCTCTTCATCAACGATCTTGATGCCGGAGCTGGTAGACTTGGTGGAACTACCCAATACACCGTCAACAACCAGATGGTTAATGCTACCCTCATGAACATTGCTGACAACCCAACAAATGTGCAACTTCCCGGCATGTACAACAAGGAGGAGAATCCACGTGTCCCCATCATCGTCACTGGTAACGATTTTTCAACATTGTATGCTCCTCTTATCCGTGATGGTCGTATGGAGAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.16 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=49.39 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=TTGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCTCCAAGAACTTCATGAGCCTGCCTAATATCAAGGTTCCTCTCATCTTGGGTGTTTGGGGAGGCAAAGGCCAAGGAAAATCCTTCCAGTGTGAACTTGTCTTTGCCAAGATGGGAATTAACCCAATCATGATGAGTGCTGGAGAATTGGAAAGTGGGAACGCTGGTGAACCCGCAAAGCTTATCAGGCAAAGGTACCGTGAGGCGGCTGATATAATCAAGAAGAAGGGAAAGATGTGCTGCCTCTTCATCAACGATCTTGATGCCGGAGCTGGTAGACTTGGTGGAACTACCCAATACACCGTCAACAACCAGATGGTTAATGCTACCCTCATGAACATTGCTGACAACCCAACAAATGTGCAACTTCCCGGCATGTACAACAAGGAGGAGAATCCACGTGTCCCCATCATCGTCACTGGTAACGATTTTTCAACATTGTATGCTCCTCTTATCCGTGATGGTCGTATGGAGAA SRR1171652 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:36:53 Started mapping on | Feb 14 01:36:53 Finished on | Feb 14 01:38:45 Mapping speed, Million of reads per hour | 2211.58 Number of input reads | 68804568 Average input read length | 175 UNIQUE READS: Uniquely mapped reads number | 65525228 Uniquely mapped reads % | 95.23% Average mapped length | 174.48 Number of splices: Total | 35422931 Number of splices: Annotated (sjdb) | 34760579 Number of splices: GT/AG | 34709673 Number of splices: GC/AG | 626509 Number of splices: AT/AC | 34866 Number of splices: Non-canonical | 51883 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1906945 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 461073 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1450154 1450154 1450154 N_multimapping 1906945 1906945 1906945 N_noFeature 2333302 32892606 34466616 N_ambiguous 815563 164129 154324 UnstrandedReadsAssigned:62376363 PositiveStrandReadsAssigned:32468493 NegativeStrandReadsAssigned:30904288 Dataset is classified unstranded MeadianReadLen=90 20thPercentileLength=90 echo kmer=85 SRR1171652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1171652-trimmed-pair1.fastq SRR1171652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 68,804,568 reads, 64,692,519 reads pseudoaligned [quant] estimated average fragment length: 189.081 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,367 rounds 52401 SRR1171652.ke.tsv 34699 SRR1171652.se.tsv 87100 total ==> SRR1171652.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1829.92 2550 13.5932 Potri.005G024800.1.v4.1 1035 846.919 2583 29.7507 Potri.004G059700.1.v4.1 961 772.919 81 1.02227 Potri.007G009000.2.v4.1 1416 1227.92 0 0 Potri.003G141000.2.v4.1 2943 2754.92 4262.17 15.0916 Potri.016G087400.1.v4.1 270 82.1277 3057.59 363.165 Potri.015G069301.1.v4.1 564 375.992 0 0 Potri.010G195200.1.v4.1 1773 1584.92 98 0.603162 Potri.012G127500.1.v4.1 977 788.919 929 11.4868 ==> SRR1171652.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 218 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 917 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 23 SRR1171652 completed mapping pipeline successfully