Starting /dee2/code/volunteer_pipeline.sh SRR12145817 current disk space = 3088977731584 free memory = 1449499284 SRR12145817 SRAfilesize ae8603035588e04890002df65924e39b SRR12145817.sra SRR12145817.sra file validated SRR12145817 is single end SRR12145817 is conventional basespace SRR12145817 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7105 34.0 31.0 34.0 30.0 34.0 2 32.3625 34.0 31.0 34.0 31.0 34.0 3 32.64325 34.0 31.0 34.0 30.0 34.0 4 36.10925 37.0 35.0 37.0 35.0 37.0 5 36.11275 37.0 37.0 37.0 35.0 37.0 6 36.2655 37.0 37.0 37.0 35.0 37.0 7 36.31575 37.0 37.0 37.0 35.0 37.0 8 36.30925 37.0 37.0 37.0 35.0 37.0 9 38.15225 39.0 39.0 39.0 37.0 39.0 10-11 38.133750000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.15175 39.0 39.0 39.0 37.0 39.0 14-15 39.66575 41.0 40.0 41.0 37.0 41.0 16-17 39.687625 41.0 40.0 41.0 37.0 41.0 18-19 39.646 41.0 40.0 41.0 37.0 41.0 20-21 39.556 41.0 40.0 41.0 37.0 41.0 22-23 39.570875 41.0 40.0 41.0 37.0 41.0 24-25 39.514875 41.0 39.5 41.0 37.0 41.0 26-27 39.318875000000006 41.0 39.0 41.0 36.0 41.0 28-29 39.219875 41.0 39.0 41.0 36.0 41.0 30-31 39.185625 41.0 39.0 41.0 36.0 41.0 32-33 39.1165 41.0 39.0 41.0 36.0 41.0 34-35 38.745125 40.0 38.5 41.0 34.5 41.0 36-37 38.642250000000004 40.0 38.0 41.0 34.5 41.0 38-39 38.65425 40.0 38.0 41.0 35.0 41.0 40-41 38.567750000000004 40.0 38.0 41.0 34.5 41.0 42-43 38.33775 40.0 38.0 41.0 34.0 41.0 44-45 38.241125 40.0 38.0 41.0 34.0 41.0 46-47 38.091375 40.0 38.0 41.0 33.0 41.0 48-49 37.97 40.0 38.0 41.0 33.0 41.0 50-51 37.642875000000004 40.0 37.0 41.0 32.5 41.0 52-53 37.45975 40.0 37.0 41.0 32.0 41.0 54-55 37.698625 40.0 37.0 41.0 32.5 41.0 56-57 37.99787499999999 40.0 37.5 41.0 33.0 41.0 58-59 37.89425 40.0 37.0 41.0 33.5 41.0 60-61 37.57 40.0 37.0 41.0 32.5 41.0 62-63 37.3265 39.5 36.0 41.0 32.5 41.0 64-65 37.022375 39.0 36.0 41.0 32.0 41.0 66-67 36.738125 39.0 35.0 40.5 32.0 41.0 68-69 36.351124999999996 38.0 35.0 40.0 31.5 41.0 70-71 35.900875 37.0 35.0 39.5 30.5 41.0 72-73 35.520125 37.0 35.0 39.0 31.0 41.0 74-75 35.041125 36.0 35.0 39.0 30.0 40.5 76-77 33.82025 35.0 33.5 37.0 28.5 39.0 78-79 34.03575 35.0 34.0 37.0 29.0 39.0 80-81 33.821 35.0 34.0 37.0 29.0 38.5 82-83 33.548625 35.0 34.0 36.0 29.0 37.0 84-85 33.174375 35.0 34.0 36.0 29.0 37.0 86-87 33.009125 35.0 34.0 35.5 29.0 36.5 88-89 32.675875000000005 35.0 34.0 35.0 29.0 36.0 90-91 32.432625 35.0 33.0 35.0 27.5 36.0 92-93 32.32125 35.0 33.0 35.0 27.5 36.0 94-95 32.12375 35.0 33.0 35.0 27.0 35.5 96-97 31.935375 35.0 33.0 35.0 27.0 35.0 98-99 31.463250000000002 35.0 33.0 35.0 25.5 35.0 100 31.18275 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 5.0 11 1.0 12 3.0 13 6.0 14 5.0 15 8.0 16 4.0 17 6.0 18 9.0 19 8.0 20 6.0 21 12.0 22 9.0 23 12.0 24 14.0 25 15.0 26 10.0 27 19.0 28 31.0 29 41.0 30 53.0 31 67.0 32 93.0 33 112.0 34 127.0 35 255.0 36 367.0 37 880.0 38 1456.0 39 362.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.194603009859883 15.594187856772185 20.083030617540217 39.12817851582771 2 19.950000000000003 24.2 35.575 20.275000000000002 3 23.474999999999998 25.874999999999996 28.025 22.625 4 24.0 32.0 20.75 23.25 5 24.362181090545274 35.042521260630316 23.011505752876438 17.58379189594797 6 18.65 38.574999999999996 23.9 18.875 7 17.05 18.8 44.525 19.625 8 19.05 24.474999999999998 29.25 27.224999999999998 9 19.8 23.05 32.05 25.1 10-11 21.6875 34.7875 23.0 20.525 12-13 20.6875 27.575 29.2 22.537499999999998 14-15 22.0 29.125 28.275 20.599999999999998 16-17 21.05 28.849999999999998 28.012500000000003 22.0875 18-19 20.95 29.912499999999998 27.5125 21.625 20-21 21.075 29.262500000000003 28.275 21.3875 22-23 21.0 29.225 27.3875 22.3875 24-25 21.2875 28.449999999999996 27.800000000000004 22.4625 26-27 21.3125 28.65 28.4 21.637500000000003 28-29 21.099999999999998 28.6875 28.225 21.987499999999997 30-31 20.8125 29.2875 27.8625 22.037499999999998 32-33 20.962500000000002 28.537499999999998 28.625 21.875 34-35 21.375 29.1375 27.5875 21.9 36-37 21.2625 29.75 26.7625 22.225 38-39 20.5 29.225 28.349999999999998 21.925 40-41 21.7375 28.8625 26.7625 22.6375 42-43 21.95 28.537499999999998 28.6375 20.875 44-45 21.3 28.6375 28.675 21.3875 46-47 21.912499999999998 27.85 28.575 21.6625 48-49 21.6 27.875 28.575 21.95 50-51 21.775 28.925 28.1875 21.1125 52-53 21.987499999999997 28.299999999999997 28.125 21.587500000000002 54-55 20.95 28.4125 29.062500000000004 21.575 56-57 21.4 28.9375 28.000000000000004 21.6625 58-59 20.7625 28.6375 28.5875 22.0125 60-61 20.8625 28.537499999999998 28.3625 22.237499999999997 62-63 21.775 28.487499999999997 29.099999999999998 20.6375 64-65 21.1125 28.9 28.95 21.0375 66-67 21.2625 29.325000000000003 28.299999999999997 21.1125 68-69 21.5 28.675 28.125 21.7 70-71 21.375 27.725 29.012500000000003 21.8875 72-73 20.7125 29.1625 28.462500000000002 21.6625 74-75 20.575 29.5 27.8625 22.0625 76-77 21.6 28.775000000000002 27.950000000000003 21.675 78-79 20.8 28.050000000000004 29.6875 21.462500000000002 80-81 20.65 28.512500000000003 28.599999999999998 22.237499999999997 82-83 21.349999999999998 28.425 28.487499999999997 21.7375 84-85 22.3125 27.8625 28.749999999999996 21.075 86-87 21.4 28.812500000000004 28.249999999999996 21.5375 88-89 21.4375 27.950000000000003 28.725 21.8875 90-91 21.325 28.1375 28.5625 21.975 92-93 20.5 29.525000000000002 27.675 22.3 94-95 22.075 28.287499999999998 28.0875 21.55 96-97 21.7 27.8625 28.8625 21.575 98-99 20.837500000000002 28.787499999999998 28.975 21.4 100 21.8 28.875 28.1 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 0.5 21 0.0 22 0.5 23 1.5 24 3.5 25 7.5 26 8.0 27 9.5 28 15.5 29 22.5 30 32.5 31 44.0 32 51.5 33 66.0 34 83.0 35 104.5 36 130.5 37 135.0 38 150.0 39 188.0 40 210.0 41 225.5 42 244.5 43 245.5 44 255.0 45 261.0 46 236.5 47 208.0 48 186.5 49 166.5 50 132.0 51 108.5 52 93.5 53 72.0 54 62.5 55 49.0 56 35.5 57 28.5 58 18.5 59 10.5 60 7.5 61 13.5 62 14.5 63 8.0 64 7.5 65 6.5 66 7.0 67 5.0 68 0.5 69 2.5 70 3.0 71 2.0 72 2.0 73 1.5 74 2.0 75 2.0 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0125 0.0 0.0 0.0 46-47 0.025 0.025 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.037500000000000006 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.1 0.025 0.0 0.0 0.0 84-85 0.125 0.025 0.0 0.0 0.0 86-87 0.15 0.025 0.0 0.0 0.0 88 0.15 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081896 spots for SRR12145817.sra Written 1081896 spots for SRR12145817.sra Read 1081904 spots for SRR12145817.sra Written 1081904 spots for SRR12145817.sra SRR ids: ['SRR12145817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_edbdizs_ SRR12145817.sra spots: 21637928 blocks: [[1, 1081896], [1081897, 2163792], [2163793, 3245688], [3245689, 4327584], [4327585, 5409480], [5409481, 6491376], [6491377, 7573272], [7573273, 8655168], [8655169, 9737064], [9737065, 10818960], [10818961, 11900856], [11900857, 12982752], [12982753, 14064648], [14064649, 15146544], [15146545, 16228440], [16228441, 17310336], [17310337, 18392232], [18392233, 19474128], [19474129, 20556024], [20556025, 21637928]] SRR12145817 file size 5641238 SRR12145817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145817 SRR12145817_1.fastq Input file: SRR12145817_1.fastq trimmed: SRR12145817-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:21:43 2025 >> started Thu Feb 13 15:21:53 2025 >> done (10.008s) 21637928 reads processed; of these: 4063 ( 0.02%) short reads filtered out after trimming by size control 37375 ( 0.17%) empty reads filtered out after trimming by size control 21596490 (99.81%) reads available; of these: 1315909 ( 6.09%) trimmed reads available after processing 20280581 (93.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 594 0.00% 19 806 0.00% 20 1207 0.01% 21 1114 0.01% 22 1453 0.01% 23 1973 0.01% 24 2532 0.01% 25 3419 0.02% 26 3558 0.02% 27 3469 0.02% 28 3883 0.02% 29 3595 0.02% 30 3578 0.02% 31 3610 0.02% 32 3971 0.02% 33 3895 0.02% 34 4548 0.02% 35 5533 0.03% 36 4383 0.02% 37 4598 0.02% 38 4778 0.02% 39 4748 0.02% 40 4927 0.02% 41 5204 0.02% 42 5457 0.03% 43 5726 0.03% 44 6115 0.03% 45 6391 0.03% 46 6509 0.03% 47 6468 0.03% 48 6341 0.03% 49 6584 0.03% 50 6538 0.03% 51 6762 0.03% 52 6566 0.03% 53 7047 0.03% 54 6490 0.03% 55 6675 0.03% 56 7171 0.03% 57 7406 0.03% 58 7762 0.04% 59 7941 0.04% 60 8276 0.04% 61 8479 0.04% 62 8698 0.04% 63 8953 0.04% 64 8997 0.04% 65 9640 0.04% 66 10050 0.05% 67 10483 0.05% 68 11195 0.05% 69 11130 0.05% 70 11204 0.05% 71 11521 0.05% 72 12227 0.06% 73 12771 0.06% 74 13341 0.06% 75 13776 0.06% 76 9283 0.04% 77 10491 0.05% 78 12094 0.06% 79 13217 0.06% 80 14358 0.07% 81 14937 0.07% 82 16285 0.08% 83 17611 0.08% 84 18909 0.09% 85 19960 0.09% 86 21252 0.10% 87 22673 0.10% 88 25122 0.12% 89 26674 0.12% 90 29572 0.14% 91 33931 0.16% 92 39321 0.18% 93 46098 0.21% 94 54489 0.25% 95 64214 0.30% 96 78285 0.36% 97 95664 0.44% 98 117242 0.54% 99 142161 0.66% 100 20280581 93.91% 21596490 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=21.45 fanout-score-rank=13 prefix-density=0.15 prefix-fanout=21.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=216.65 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=26.7 sequence=TTCTTCTTCTTT Started job on | Feb 13 15:22:09 Started mapping on | Feb 13 15:22:09 Finished on | Feb 13 15:22:38 Mapping speed, Million of reads per hour | 2680.94 Number of input reads | 21596490 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20351133 Uniquely mapped reads % | 94.23% Average mapped length | 98.69 Number of splices: Total | 4825209 Number of splices: Annotated (sjdb) | 4725976 Number of splices: GT/AG | 4749165 Number of splices: GC/AG | 60361 Number of splices: AT/AC | 5521 Number of splices: Non-canonical | 10162 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518715 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 308188 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 726642 726642 726642 N_multimapping 518715 518715 518715 N_noFeature 842765 10448807 10560547 N_ambiguous 257298 36184 37020 UnstrandedReadsAssigned:19251070 PositiveStrandReadsAssigned:9866142 NegativeStrandReadsAssigned:9753566 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145817 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145817-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,596,490 reads, 19,940,702 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR12145817.ke.tsv 34699 SRR12145817.se.tsv 87100 total ==> SRR12145817.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 706 24.455 Potri.005G024800.1.v4.1 1035 936 237 16.831 Potri.004G059700.1.v4.1 961 862 23 1.77361 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 353.284 8.25718 Potri.016G087400.1.v4.1 270 171 789 306.704 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 113.728 4.51595 Potri.012G127500.1.v4.1 977 878 4822 365.065 ==> SRR12145817.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1417 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 343 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 58 SRR12145817 completed mapping pipeline successfully