Starting /dee2/code/volunteer_pipeline.sh SRR12145818 current disk space = 3089082130432 free memory = 1393947032 SRR12145818 SRAfilesize 97fca27daf426316c83efe7b3cc6820a SRR12145818.sra SRR12145818.sra file validated SRR12145818 is single end SRR12145818 is conventional basespace SRR12145818 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3655 34.0 31.0 34.0 30.0 34.0 2 32.1755 34.0 31.0 34.0 30.0 34.0 3 32.61525 34.0 31.0 34.0 30.0 34.0 4 36.1145 37.0 37.0 37.0 35.0 37.0 5 36.1795 37.0 37.0 37.0 35.0 37.0 6 36.3625 37.0 37.0 37.0 35.0 37.0 7 36.3285 37.0 37.0 37.0 35.0 37.0 8 36.31225 37.0 37.0 37.0 35.0 37.0 9 38.17125 39.0 39.0 39.0 37.0 39.0 10-11 38.145250000000004 39.0 39.0 39.0 36.0 39.0 12-13 38.106875 39.0 39.0 39.0 37.0 39.0 14-15 39.606625 41.0 40.0 41.0 37.0 41.0 16-17 39.655 41.0 40.0 41.0 37.0 41.0 18-19 39.683 41.0 40.0 41.0 37.0 41.0 20-21 39.598124999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.516125 41.0 40.0 41.0 36.5 41.0 24-25 39.430375 41.0 39.5 41.0 36.5 41.0 26-27 39.285375 41.0 39.0 41.0 36.0 41.0 28-29 39.143 41.0 39.0 41.0 36.0 41.0 30-31 39.143125 41.0 39.0 41.0 36.0 41.0 32-33 39.09975 41.0 39.0 41.0 36.0 41.0 34-35 38.755875 40.0 38.5 41.0 35.0 41.0 36-37 38.53775 40.0 38.0 41.0 34.0 41.0 38-39 38.589875 40.0 38.0 41.0 34.5 41.0 40-41 38.4975 40.0 38.0 41.0 34.0 41.0 42-43 38.358875 40.0 38.0 41.0 34.0 41.0 44-45 38.203500000000005 40.0 38.0 41.0 33.5 41.0 46-47 38.13875 40.0 38.0 41.0 33.0 41.0 48-49 37.884 40.0 38.0 41.0 33.0 41.0 50-51 37.828125 40.0 38.0 41.0 32.5 41.0 52-53 37.613125 40.0 37.0 41.0 33.0 41.0 54-55 37.81425 40.0 37.5 41.0 33.0 41.0 56-57 38.079750000000004 40.0 38.0 41.0 33.5 41.0 58-59 37.898375 40.0 37.5 41.0 33.0 41.0 60-61 37.522875 40.0 37.0 41.0 32.5 41.0 62-63 37.35025 39.5 36.5 41.0 32.0 41.0 64-65 37.169624999999996 39.0 36.0 41.0 32.0 41.0 66-67 36.780125 39.0 35.5 41.0 31.5 41.0 68-69 36.337125 38.0 35.0 40.0 31.0 41.0 70-71 35.816375 37.0 35.0 39.5 31.0 41.0 72-73 35.43475 37.0 35.0 39.0 30.5 41.0 74-75 34.98425 36.0 34.5 39.0 30.0 40.0 76-77 33.740625 35.0 33.0 37.0 28.5 39.0 78-79 34.103750000000005 35.0 34.0 37.0 29.5 39.0 80-81 33.864875 35.0 34.0 37.0 30.0 38.5 82-83 33.546 35.0 34.0 36.0 29.5 37.0 84-85 33.210375 35.0 34.0 36.0 29.0 37.0 86-87 32.874125 35.0 34.0 35.0 29.0 36.5 88-89 32.69325 35.0 34.0 35.0 29.0 36.0 90-91 32.536249999999995 35.0 34.0 35.0 28.0 36.0 92-93 32.315124999999995 35.0 33.5 35.0 28.5 36.0 94-95 32.157875000000004 35.0 33.0 35.0 27.0 35.5 96-97 31.90775 35.0 33.0 35.0 27.0 35.0 98-99 31.582125 35.0 33.0 35.0 25.5 35.0 100 31.21025 35.0 33.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 4.0 10 3.0 11 7.0 12 6.0 13 4.0 14 7.0 15 5.0 16 1.0 17 12.0 18 4.0 19 5.0 20 5.0 21 4.0 22 9.0 23 12.0 24 19.0 25 15.0 26 17.0 27 23.0 28 32.0 29 38.0 30 60.0 31 68.0 32 90.0 33 102.0 34 120.0 35 210.0 36 381.0 37 904.0 38 1459.0 39 371.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.28252299605782 16.47831800262812 18.344283837056505 39.894875164257556 2 20.875 24.25 34.775 20.1 3 22.625 27.450000000000003 25.924999999999997 24.0 4 23.575 33.25 20.75 22.425 5 23.599999999999998 36.4 21.325 18.675 6 18.45 38.95 24.675 17.925 7 17.05 18.75 43.675000000000004 20.525 8 19.75 22.75 28.050000000000004 29.45 9 20.0 24.725 31.025000000000002 24.25 10-11 22.5875 34.55 22.925 19.9375 12-13 21.125 27.425 28.975 22.475 14-15 21.2375 28.249999999999996 28.7 21.8125 16-17 21.0 29.1375 28.3875 21.475 18-19 20.349999999999998 30.412499999999998 26.937499999999996 22.3 20-21 21.525 28.849999999999998 28.3625 21.2625 22-23 21.55 29.425 27.187499999999996 21.837500000000002 24-25 20.349999999999998 30.349999999999998 27.1375 22.162499999999998 26-27 21.425 29.45 27.537499999999998 21.587500000000002 28-29 21.5 28.449999999999996 28.7 21.349999999999998 30-31 21.325 29.15 27.825 21.7 32-33 20.95 28.487499999999997 28.375 22.1875 34-35 20.8875 28.6875 28.599999999999998 21.825 36-37 20.95 29.6375 27.800000000000004 21.6125 38-39 21.4875 28.9 27.737499999999997 21.875 40-41 20.7625 29.25 28.125 21.8625 42-43 20.474999999999998 28.825 28.512500000000003 22.1875 44-45 21.3625 29.625 28.1 20.9125 46-47 21.75 29.075 27.5125 21.6625 48-49 20.349999999999998 29.362500000000004 28.1375 22.15 50-51 20.7 28.512500000000003 28.1875 22.6 52-53 21.425 28.5625 28.6625 21.349999999999998 54-55 20.9125 28.3625 28.499999999999996 22.225 56-57 21.3875 29.025000000000002 28.025 21.5625 58-59 21.8875 29.125 26.5 22.4875 60-61 21.3625 29.425 27.55 21.6625 62-63 20.6375 29.2375 28.625 21.5 64-65 21.5 28.725 28.3875 21.3875 66-67 21.525 29.4375 27.825 21.212500000000002 68-69 22.075 28.599999999999998 28.549999999999997 20.775 70-71 21.975 28.3125 28.325 21.3875 72-73 21.3875 29.512500000000003 27.525 21.575 74-75 21.275 28.4125 28.875 21.4375 76-77 22.325 28.425 27.8125 21.4375 78-79 21.2375 28.525 28.275 21.9625 80-81 21.3625 29.062500000000004 28.975 20.599999999999998 82-83 21.525 28.9375 28.012500000000003 21.525 84-85 21.212500000000002 28.599999999999998 29.075 21.1125 86-87 22.0125 28.0625 28.475 21.45 88-89 21.525 28.1625 29.1875 21.125 90-91 21.625 29.4375 27.537499999999998 21.4 92-93 21.425 28.7 28.375 21.5 94-95 21.3125 29.362500000000004 28.175 21.15 96-97 20.9125 29.299999999999997 27.9375 21.85 98-99 21.7375 28.625 28.325 21.3125 100 21.099999999999998 30.0 27.700000000000003 21.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 2.5 21 2.5 22 2.0 23 4.0 24 3.5 25 1.5 26 3.5 27 12.0 28 17.0 29 25.5 30 37.0 31 39.0 32 45.0 33 64.0 34 84.5 35 106.5 36 128.5 37 135.5 38 146.5 39 169.5 40 205.5 41 240.0 42 253.0 43 248.0 44 227.5 45 234.0 46 242.5 47 224.5 48 207.0 49 180.5 50 151.5 51 127.0 52 97.0 53 72.0 54 55.0 55 45.0 56 39.0 57 25.0 58 15.0 59 14.0 60 12.5 61 7.5 62 6.5 63 8.0 64 5.0 65 3.5 66 3.5 67 2.5 68 2.0 69 0.5 70 0.0 71 1.5 72 2.5 73 1.0 74 0.0 75 0.0 76 1.5 77 1.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382807 spots for SRR12145818.sra Written 1382807 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra Read 1382791 spots for SRR12145818.sra Written 1382791 spots for SRR12145818.sra SRR ids: ['SRR12145818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sc9bclb_ SRR12145818.sra spots: 27655836 blocks: [[1, 1382791], [1382792, 2765582], [2765583, 4148373], [4148374, 5531164], [5531165, 6913955], [6913956, 8296746], [8296747, 9679537], [9679538, 11062328], [11062329, 12445119], [12445120, 13827910], [13827911, 15210701], [15210702, 16593492], [16593493, 17976283], [17976284, 19359074], [19359075, 20741865], [20741866, 22124656], [22124657, 23507447], [23507448, 24890238], [24890239, 26273029], [26273030, 27655836]] SRR12145818 file size 7213189 SRR12145818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145818 SRR12145818_1.fastq Input file: SRR12145818_1.fastq trimmed: SRR12145818-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:13:12 2025 >> started Thu Feb 13 15:13:27 2025 >> done (15.091s) 27655836 reads processed; of these: 4496 ( 0.02%) short reads filtered out after trimming by size control 29312 ( 0.11%) empty reads filtered out after trimming by size control 27622028 (99.88%) reads available; of these: 1615736 ( 5.85%) trimmed reads available after processing 26006292 (94.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 614 0.00% 19 848 0.00% 20 1083 0.00% 21 1233 0.00% 22 1624 0.01% 23 2158 0.01% 24 2861 0.01% 25 3843 0.01% 26 3914 0.01% 27 3973 0.01% 28 4103 0.01% 29 4114 0.01% 30 3983 0.01% 31 4061 0.01% 32 4413 0.02% 33 4476 0.02% 34 5050 0.02% 35 6495 0.02% 36 5238 0.02% 37 5491 0.02% 38 5487 0.02% 39 5827 0.02% 40 5853 0.02% 41 6009 0.02% 42 6528 0.02% 43 6686 0.02% 44 7186 0.03% 45 7405 0.03% 46 7641 0.03% 47 7643 0.03% 48 7869 0.03% 49 7790 0.03% 50 7944 0.03% 51 8021 0.03% 52 7905 0.03% 53 8186 0.03% 54 8028 0.03% 55 8039 0.03% 56 8667 0.03% 57 9130 0.03% 58 9328 0.03% 59 9543 0.03% 60 10127 0.04% 61 10160 0.04% 62 10741 0.04% 63 10850 0.04% 64 11077 0.04% 65 11678 0.04% 66 12304 0.04% 67 12577 0.05% 68 13413 0.05% 69 13418 0.05% 70 13582 0.05% 71 14138 0.05% 72 14846 0.05% 73 15699 0.06% 74 16321 0.06% 75 16722 0.06% 76 11803 0.04% 77 12867 0.05% 78 15096 0.05% 79 16145 0.06% 80 17612 0.06% 81 18579 0.07% 82 20101 0.07% 83 21888 0.08% 84 23368 0.08% 85 24558 0.09% 86 26458 0.10% 87 28077 0.10% 88 30243 0.11% 89 33435 0.12% 90 36930 0.13% 91 41870 0.15% 92 48138 0.17% 93 56726 0.21% 94 67516 0.24% 95 79421 0.29% 96 97187 0.35% 97 119843 0.43% 98 146412 0.53% 99 177520 0.64% 100 26006292 94.15% 27622028 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=15.70 fanout-score-rank=7 prefix-density=0.11 prefix-fanout=15.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=176.37 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=22.4 sequence=AAAAGAAAAGAAAA Started job on | Feb 13 15:13:47 Started mapping on | Feb 13 15:13:47 Finished on | Feb 13 15:14:16 Mapping speed, Million of reads per hour | 3428.94 Number of input reads | 27622028 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 26486242 Uniquely mapped reads % | 95.89% Average mapped length | 98.71 Number of splices: Total | 6311617 Number of splices: Annotated (sjdb) | 6181506 Number of splices: GT/AG | 6210539 Number of splices: GC/AG | 81081 Number of splices: AT/AC | 6740 Number of splices: Non-canonical | 13257 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 652506 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 166971 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.14% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 483280 483280 483280 N_multimapping 652506 652506 652506 N_noFeature 1080132 13589599 13711243 N_ambiguous 352932 43163 44880 UnstrandedReadsAssigned:25053178 PositiveStrandReadsAssigned:12853480 NegativeStrandReadsAssigned:12730119 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145818 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145818-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,622,028 reads, 25,743,871 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR12145818.ke.tsv 34699 SRR12145818.se.tsv 87100 total ==> SRR12145818.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 648 17.1174 Potri.005G024800.1.v4.1 1035 936 173 9.3693 Potri.004G059700.1.v4.1 961 862 52 3.05797 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 433.701 7.73032 Potri.016G087400.1.v4.1 270 171 1050 311.265 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 73 2.21057 Potri.012G127500.1.v4.1 977 878 4900 282.903 ==> SRR12145818.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3098 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 534 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 108 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12145818 completed mapping pipeline successfully