Starting /dee2/code/volunteer_pipeline.sh SRR12145819 current disk space = 3088984297472 free memory = 1401863128 SRR12145819 SRAfilesize 5ffcb7f0653f6492b18682bd99d04b9b SRR12145819.sra SRR12145819.sra file validated SRR12145819 is single end SRR12145819 is conventional basespace SRR12145819 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66 34.0 31.0 34.0 30.0 34.0 2 32.35725 34.0 31.0 34.0 31.0 34.0 3 32.65375 34.0 31.0 34.0 30.0 34.0 4 36.186 37.0 37.0 37.0 35.0 37.0 5 36.18175 37.0 37.0 37.0 35.0 37.0 6 36.32925 37.0 37.0 37.0 35.0 37.0 7 36.314 37.0 37.0 37.0 35.0 37.0 8 36.31075 37.0 37.0 37.0 35.0 37.0 9 38.242 39.0 39.0 39.0 37.0 39.0 10-11 38.17875 39.0 39.0 39.0 37.0 39.0 12-13 38.175125 39.0 39.0 39.0 37.0 39.0 14-15 39.654250000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.673874999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.707499999999996 41.0 40.0 41.0 37.0 41.0 20-21 39.644125 41.0 40.0 41.0 37.0 41.0 22-23 39.585499999999996 41.0 40.0 41.0 37.0 41.0 24-25 39.526375 41.0 40.0 41.0 37.0 41.0 26-27 39.291875000000005 41.0 39.5 41.0 36.5 41.0 28-29 39.195125 41.0 39.0 41.0 36.0 41.0 30-31 39.218125 41.0 39.0 41.0 36.0 41.0 32-33 39.1115 41.0 39.0 41.0 36.0 41.0 34-35 38.8095 40.5 38.5 41.0 35.0 41.0 36-37 38.672875 40.0 38.0 41.0 35.0 41.0 38-39 38.580124999999995 40.0 38.0 41.0 34.5 41.0 40-41 38.488875 40.0 38.0 41.0 34.0 41.0 42-43 38.392250000000004 40.0 38.0 41.0 34.0 41.0 44-45 38.291624999999996 40.0 38.0 41.0 34.0 41.0 46-47 38.203625 40.0 38.0 41.0 34.0 41.0 48-49 37.9935 40.0 38.0 41.0 33.0 41.0 50-51 37.76325 40.0 38.0 41.0 33.0 41.0 52-53 37.6355 40.0 37.0 41.0 32.5 41.0 54-55 37.80625 40.0 37.5 41.0 33.0 41.0 56-57 38.115875 40.0 38.0 41.0 34.0 41.0 58-59 37.97175 40.0 37.5 41.0 34.0 41.0 60-61 37.588625 40.0 37.0 41.0 33.0 41.0 62-63 37.461124999999996 39.5 36.5 41.0 33.0 41.0 64-65 37.154375 39.0 36.0 41.0 32.0 41.0 66-67 36.7945 39.0 35.5 41.0 32.0 41.0 68-69 36.487 38.0 35.0 40.0 32.0 41.0 70-71 36.04375 37.0 35.0 39.5 31.5 41.0 72-73 35.563375 37.0 35.0 39.0 31.0 41.0 74-75 35.092375000000004 36.0 35.0 39.0 30.0 40.0 76-77 33.9155 35.0 33.5 37.0 29.0 39.0 78-79 34.268375 35.0 34.0 37.0 30.0 39.0 80-81 34.018875 35.0 34.0 36.5 30.0 38.5 82-83 33.6495 35.0 34.0 36.0 30.0 37.0 84-85 33.422250000000005 35.0 34.0 36.0 29.5 37.0 86-87 33.1345 35.0 34.0 35.5 29.0 36.5 88-89 32.881125 35.0 34.0 35.0 29.0 36.0 90-91 32.632374999999996 35.0 34.0 35.0 28.5 36.0 92-93 32.44 35.0 34.0 35.0 29.0 36.0 94-95 32.283249999999995 35.0 33.5 35.0 28.0 35.5 96-97 32.086625 35.0 33.0 35.0 27.0 35.0 98-99 31.649625 35.0 33.0 35.0 25.5 35.0 100 31.4215 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 2.0 10 1.0 11 8.0 12 6.0 13 2.0 14 6.0 15 5.0 16 7.0 17 5.0 18 6.0 19 9.0 20 6.0 21 10.0 22 9.0 23 10.0 24 15.0 25 7.0 26 21.0 27 18.0 28 25.0 29 36.0 30 50.0 31 66.0 32 62.0 33 121.0 34 145.0 35 190.0 36 354.0 37 907.0 38 1530.0 39 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.967456391564696 14.917990106743037 20.151002343139808 39.96355115855246 2 20.125 23.974999999999998 35.55 20.349999999999998 3 21.675 26.900000000000002 28.275 23.150000000000002 4 23.200000000000003 33.324999999999996 21.224999999999998 22.25 5 23.75 36.025 21.375 18.85 6 17.7 39.95 23.575 18.775 7 16.7 18.625 43.375 21.3 8 18.275 24.725 28.299999999999997 28.7 9 19.400000000000002 24.2 31.724999999999998 24.675 10-11 22.55 34.612500000000004 22.025 20.8125 12-13 19.7125 27.187499999999996 29.925 23.175 14-15 20.724999999999998 28.65 29.012500000000003 21.6125 16-17 20.9 28.537499999999998 27.500000000000004 23.0625 18-19 21.087500000000002 29.4 27.125 22.3875 20-21 21.5625 29.599999999999998 26.700000000000003 22.1375 22-23 21.637500000000003 30.012499999999996 26.8 21.55 24-25 22.125 27.762500000000003 28.287499999999998 21.825 26-27 21.712500000000002 29.612500000000004 27.0 21.675 28-29 21.6125 28.3125 27.212500000000002 22.8625 30-31 21.825 28.175 28.512500000000003 21.4875 32-33 21.175 28.95 27.85 22.025 34-35 21.175 27.85 28.6625 22.3125 36-37 21.725 28.537499999999998 27.650000000000002 22.0875 38-39 21.4375 29.15 27.287499999999998 22.125 40-41 21.0625 29.262500000000003 28.6625 21.0125 42-43 21.8625 28.3625 27.5125 22.2625 44-45 20.4125 29.45 28.012500000000003 22.125 46-47 22.15 28.6125 27.6375 21.6 48-49 21.837500000000002 28.775000000000002 27.9375 21.45 50-51 21.0625 28.787499999999998 28.6625 21.4875 52-53 21.212500000000002 28.625 28.025 22.1375 54-55 20.962500000000002 28.999999999999996 27.962500000000002 22.075 56-57 21.4125 29.1625 27.3 22.125 58-59 20.974999999999998 29.2875 27.6125 22.125 60-61 21.512500000000003 29.2375 28.012500000000003 21.2375 62-63 21.587500000000002 28.375 28.1375 21.9 64-65 21.25 28.812500000000004 28.6625 21.275 66-67 21.9375 28.287499999999998 28.5875 21.1875 68-69 21.9625 28.599999999999998 27.900000000000002 21.5375 70-71 21.45 28.499999999999996 28.000000000000004 22.05 72-73 21.725 29.512500000000003 27.875 20.8875 74-75 21.4375 28.15 28.0625 22.35 76-77 22.275 28.0875 28.349999999999998 21.2875 78-79 20.825 28.299999999999997 28.8625 22.0125 80-81 20.9125 29.1375 28.299999999999997 21.65 82-83 21.224999999999998 28.549999999999997 27.537499999999998 22.6875 84-85 21.1625 28.050000000000004 28.6875 22.1 86-87 21.3 29.2 28.325 21.175 88-89 22.3875 28.575 28.025 21.0125 90-91 22.3625 27.0 29.012500000000003 21.625 92-93 21.512500000000003 28.625 28.4 21.462500000000002 94-95 21.762500000000003 27.700000000000003 28.4 22.1375 96-97 21.337500000000002 28.875 27.85 21.9375 98-99 22.275 26.937499999999996 29.6625 21.125 100 22.6 27.575 28.375 21.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.5 21 2.0 22 2.0 23 2.0 24 2.0 25 4.5 26 5.5 27 9.5 28 15.0 29 18.5 30 26.0 31 32.0 32 45.0 33 61.5 34 69.0 35 84.0 36 110.5 37 130.5 38 160.0 39 186.0 40 194.5 41 204.5 42 239.5 43 284.5 44 261.5 45 244.5 46 258.5 47 234.0 48 205.5 49 175.5 50 147.5 51 124.5 52 99.5 53 89.5 54 69.0 55 42.5 56 30.5 57 22.5 58 17.0 59 13.5 60 14.5 61 13.0 62 8.0 63 5.0 64 5.5 65 6.5 66 4.0 67 2.0 68 2.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073892 spots for SRR12145819.sra Written 1073892 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra Read 1073884 spots for SRR12145819.sra Written 1073884 spots for SRR12145819.sra SRR ids: ['SRR12145819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l77b0bwa SRR12145819.sra spots: 21477688 blocks: [[1, 1073884], [1073885, 2147768], [2147769, 3221652], [3221653, 4295536], [4295537, 5369420], [5369421, 6443304], [6443305, 7517188], [7517189, 8591072], [8591073, 9664956], [9664957, 10738840], [10738841, 11812724], [11812725, 12886608], [12886609, 13960492], [13960493, 15034376], [15034377, 16108260], [16108261, 17182144], [17182145, 18256028], [18256029, 19329912], [19329913, 20403796], [20403797, 21477688]] SRR12145819 file size 5599384 SRR12145819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145819 SRR12145819_1.fastq Input file: SRR12145819_1.fastq trimmed: SRR12145819-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:21:04 2025 >> started Thu Feb 13 15:21:16 2025 >> done (11.807s) 21477688 reads processed; of these: 3693 ( 0.02%) short reads filtered out after trimming by size control 16978 ( 0.08%) empty reads filtered out after trimming by size control 21457017 (99.90%) reads available; of these: 1242786 ( 5.79%) trimmed reads available after processing 20214231 (94.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 503 0.00% 19 676 0.00% 20 845 0.00% 21 871 0.00% 22 1180 0.01% 23 1641 0.01% 24 2008 0.01% 25 2797 0.01% 26 2882 0.01% 27 2950 0.01% 28 2935 0.01% 29 3053 0.01% 30 2964 0.01% 31 3027 0.01% 32 3242 0.02% 33 3292 0.02% 34 3688 0.02% 35 4966 0.02% 36 3760 0.02% 37 3966 0.02% 38 4048 0.02% 39 4162 0.02% 40 4287 0.02% 41 4648 0.02% 42 4826 0.02% 43 5178 0.02% 44 5374 0.03% 45 5472 0.03% 46 5691 0.03% 47 5709 0.03% 48 5833 0.03% 49 5929 0.03% 50 5936 0.03% 51 6164 0.03% 52 5881 0.03% 53 6378 0.03% 54 5906 0.03% 55 6241 0.03% 56 6669 0.03% 57 6679 0.03% 58 7179 0.03% 59 7400 0.03% 60 7718 0.04% 61 7945 0.04% 62 8042 0.04% 63 8271 0.04% 64 8585 0.04% 65 9123 0.04% 66 9391 0.04% 67 9813 0.05% 68 10306 0.05% 69 9970 0.05% 70 10404 0.05% 71 10864 0.05% 72 11439 0.05% 73 12275 0.06% 74 12720 0.06% 75 12880 0.06% 76 9010 0.04% 77 10158 0.05% 78 11587 0.05% 79 12433 0.06% 80 13555 0.06% 81 14195 0.07% 82 15259 0.07% 83 16832 0.08% 84 18286 0.09% 85 18943 0.09% 86 20314 0.09% 87 21574 0.10% 88 23488 0.11% 89 25855 0.12% 90 28743 0.13% 91 32636 0.15% 92 37925 0.18% 93 43824 0.20% 94 52015 0.24% 95 61572 0.29% 96 75462 0.35% 97 92521 0.43% 98 112976 0.53% 99 137041 0.64% 100 20214231 94.21% 21457017 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=37.33 fanout-score-rank=8 prefix-density=0.30 prefix-fanout=30.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=3 fanout-score=170.94 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=22.3 sequence=AAGAAGAAGAAA Started job on | Feb 13 15:21:33 Started mapping on | Feb 13 15:21:34 Finished on | Feb 13 15:21:54 Mapping speed, Million of reads per hour | 3862.26 Number of input reads | 21457017 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20604058 Uniquely mapped reads % | 96.02% Average mapped length | 98.71 Number of splices: Total | 5390889 Number of splices: Annotated (sjdb) | 5277209 Number of splices: GT/AG | 5302565 Number of splices: GC/AG | 71675 Number of splices: AT/AC | 6282 Number of splices: Non-canonical | 10367 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489119 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 112454 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 363840 363840 363840 N_multimapping 489119 489119 489119 N_noFeature 972607 10671974 10735401 N_ambiguous 244620 37315 38473 UnstrandedReadsAssigned:19386831 PositiveStrandReadsAssigned:9894769 NegativeStrandReadsAssigned:9830184 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145819 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145819-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,457,017 reads, 19,857,598 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52401 SRR12145819.ke.tsv 34699 SRR12145819.se.tsv 87100 total ==> SRR12145819.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 613 21.4008 Potri.005G024800.1.v4.1 1035 936 186 13.3132 Potri.004G059700.1.v4.1 961 862 28 2.17618 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 344.437 8.11381 Potri.016G087400.1.v4.1 270 171 935 366.319 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 87 3.48183 Potri.012G127500.1.v4.1 977 878 2677 204.267 ==> SRR12145819.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2295 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12145819 completed mapping pipeline successfully