Starting /dee2/code/volunteer_pipeline.sh SRR12145820 current disk space = 3088880484352 free memory = 1398671568 SRR12145820 SRAfilesize d90a7ed062cf52afae6eb422907e8cf3 SRR12145820.sra SRR12145820.sra file validated SRR12145820 is single end SRR12145820 is conventional basespace SRR12145820 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83375 34.0 31.0 34.0 31.0 34.0 2 32.40275 34.0 31.0 34.0 31.0 34.0 3 32.67475 34.0 31.0 34.0 31.0 34.0 4 36.145 37.0 37.0 37.0 35.0 37.0 5 36.1145 37.0 37.0 37.0 35.0 37.0 6 36.29025 37.0 37.0 37.0 35.0 37.0 7 36.272 37.0 37.0 37.0 35.0 37.0 8 36.306 37.0 37.0 37.0 35.0 37.0 9 38.17475 39.0 39.0 39.0 37.0 39.0 10-11 38.207625 39.0 39.0 39.0 37.0 39.0 12-13 38.141875 39.0 39.0 39.0 37.0 39.0 14-15 39.637375 41.0 40.0 41.0 37.0 41.0 16-17 39.686875 41.0 40.0 41.0 37.0 41.0 18-19 39.68237499999999 41.0 40.0 41.0 37.0 41.0 20-21 39.594625 41.0 40.0 41.0 37.0 41.0 22-23 39.520375 41.0 40.0 41.0 37.0 41.0 24-25 39.53875 41.0 39.5 41.0 37.0 41.0 26-27 39.298375 41.0 39.0 41.0 36.0 41.0 28-29 39.271 41.0 39.0 41.0 36.0 41.0 30-31 39.216125000000005 41.0 39.0 41.0 36.0 41.0 32-33 39.16475 41.0 39.0 41.0 36.0 41.0 34-35 38.793000000000006 40.5 38.5 41.0 35.0 41.0 36-37 38.601 40.0 38.0 41.0 34.5 41.0 38-39 38.553 40.0 38.0 41.0 35.0 41.0 40-41 38.619375000000005 40.0 38.0 41.0 35.0 41.0 42-43 38.411 40.0 38.0 41.0 34.0 41.0 44-45 38.280625 40.0 38.0 41.0 33.5 41.0 46-47 38.208375000000004 40.0 38.0 41.0 33.5 41.0 48-49 37.938 40.0 38.0 41.0 33.0 41.0 50-51 37.81575 40.0 37.5 41.0 32.5 41.0 52-53 37.677 40.0 37.0 41.0 32.5 41.0 54-55 37.91675 40.0 37.5 41.0 33.0 41.0 56-57 38.173125 40.0 38.0 41.0 34.0 41.0 58-59 38.016 40.0 37.5 41.0 33.5 41.0 60-61 37.6355 40.0 37.0 41.0 33.0 41.0 62-63 37.49575 39.5 36.5 41.0 33.0 41.0 64-65 37.236999999999995 39.0 36.0 41.0 32.0 41.0 66-67 36.845875 39.0 35.5 41.0 31.5 41.0 68-69 36.536875 38.0 35.0 40.0 31.0 41.0 70-71 36.06175 37.0 35.0 39.5 31.0 41.0 72-73 35.585875 37.0 35.0 39.0 31.0 41.0 74-75 35.107375 36.0 34.5 39.0 30.5 40.5 76-77 33.929 35.0 33.5 37.0 29.0 39.0 78-79 34.167 35.0 34.0 37.0 29.5 39.0 80-81 33.902125 35.0 34.0 37.0 29.5 39.0 82-83 33.58825 35.0 34.0 36.0 29.0 37.0 84-85 33.246875 35.0 34.0 36.0 29.0 37.0 86-87 32.9935 35.0 34.0 35.5 29.0 36.5 88-89 32.768875 35.0 34.0 35.0 29.0 36.0 90-91 32.600375 35.0 34.0 35.0 29.0 36.0 92-93 32.397625000000005 35.0 33.5 35.0 28.5 36.0 94-95 32.2565 35.0 34.0 35.0 29.0 35.5 96-97 31.921 35.0 33.0 35.0 27.0 35.0 98-99 31.598625 35.0 33.0 35.0 26.0 35.0 100 31.1945 35.0 33.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 4.0 12 3.0 13 7.0 14 2.0 15 4.0 16 5.0 17 5.0 18 2.0 19 6.0 20 9.0 21 7.0 22 9.0 23 9.0 24 5.0 25 10.0 26 29.0 27 36.0 28 32.0 29 47.0 30 60.0 31 57.0 32 83.0 33 120.0 34 148.0 35 210.0 36 335.0 37 841.0 38 1510.0 39 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.142118863049095 14.728682170542637 21.214470284237727 38.91472868217054 2 22.025 23.474999999999998 33.875 20.625 3 24.175 26.625 26.0 23.200000000000003 4 23.775 33.300000000000004 20.5 22.425 5 24.18104526131533 34.90872718179545 22.9057264316079 18.00450112528132 6 19.2 38.35 23.575 18.875 7 15.925 19.400000000000002 45.074999999999996 19.6 8 19.2 25.05 29.575000000000003 26.174999999999997 9 20.625 23.75 31.65 23.974999999999998 10-11 21.8125 35.362500000000004 22.0125 20.8125 12-13 19.7375 26.900000000000002 30.125 23.2375 14-15 20.875 28.225 29.725 21.175 16-17 21.462500000000002 28.249999999999996 28.462500000000002 21.825 18-19 22.0 28.962500000000002 27.3875 21.65 20-21 21.175 28.349999999999998 28.749999999999996 21.725 22-23 21.5625 28.8875 28.237499999999997 21.3125 24-25 21.224999999999998 29.675 27.875 21.224999999999998 26-27 20.974999999999998 29.375 28.725 20.925 28-29 22.55 29.7375 27.5875 20.125 30-31 20.625 29.525000000000002 28.512500000000003 21.337500000000002 32-33 21.637500000000003 29.4375 27.187499999999996 21.7375 34-35 21.5375 29.2875 28.0625 21.1125 36-37 21.3 29.299999999999997 27.6875 21.712500000000002 38-39 21.2875 29.325000000000003 27.575 21.8125 40-41 20.6875 29.299999999999997 28.237499999999997 21.775 42-43 21.725 29.15 27.3625 21.762500000000003 44-45 21.462500000000002 29.7125 27.787499999999998 21.0375 46-47 21.875 29.4125 27.250000000000004 21.462500000000002 48-49 20.8625 28.6625 28.199999999999996 22.275 50-51 21.7875 29.875 27.3625 20.974999999999998 52-53 21.375 28.95 27.625 22.05 54-55 21.925 27.9125 28.125 22.037499999999998 56-57 21.587500000000002 29.075 28.225 21.1125 58-59 21.65 28.6125 28.1 21.637500000000003 60-61 20.7875 28.8375 28.4125 21.9625 62-63 21.2 29.7125 28.925 20.1625 64-65 21.75 28.812500000000004 28.475 20.962500000000002 66-67 20.9875 29.062500000000004 28.449999999999996 21.5 68-69 22.3625 28.499999999999996 27.650000000000002 21.4875 70-71 21.2875 28.3125 29.037499999999998 21.3625 72-73 21.2 28.6875 28.7 21.4125 74-75 21.375 28.4125 28.6875 21.525 76-77 22.2125 28.525 27.762500000000003 21.5 78-79 21.9625 29.2375 27.800000000000004 21.0 80-81 21.3875 27.800000000000004 29.325000000000003 21.4875 82-83 22.45 28.3875 28.625 20.5375 84-85 21.675 28.349999999999998 28.95 21.025 86-87 21.675 27.9375 28.575 21.8125 88-89 21.4375 28.075 28.5625 21.925 90-91 21.087500000000002 29.425 27.725 21.762500000000003 92-93 21.1125 28.512500000000003 28.425 21.95 94-95 21.1375 28.212500000000002 29.075 21.575 96-97 21.5 28.4 28.3875 21.712500000000002 98-99 20.6875 28.525 28.975 21.8125 100 21.325 28.475 28.1 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 3.0 19 2.0 20 1.5 21 1.5 22 4.0 23 5.5 24 6.0 25 6.0 26 7.0 27 14.0 28 22.0 29 27.0 30 29.5 31 39.5 32 60.0 33 73.0 34 82.5 35 97.5 36 112.5 37 131.0 38 151.0 39 172.5 40 203.5 41 229.0 42 237.5 43 255.5 44 249.5 45 240.0 46 236.5 47 215.5 48 195.5 49 169.0 50 148.5 51 118.5 52 86.5 53 75.5 54 65.0 55 46.5 56 36.0 57 30.5 58 21.0 59 17.0 60 16.0 61 10.0 62 9.0 63 6.5 64 4.0 65 4.0 66 4.5 67 3.0 68 1.5 69 4.0 70 3.5 71 2.0 72 1.0 73 0.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.200652119388011 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025081514923501375 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 6 0.15 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987700 spots for SRR12145820.sra Written 987700 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra Read 987699 spots for SRR12145820.sra Written 987699 spots for SRR12145820.sra SRR ids: ['SRR12145820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zbclmbeh SRR12145820.sra spots: 19753981 blocks: [[1, 987699], [987700, 1975398], [1975399, 2963097], [2963098, 3950796], [3950797, 4938495], [4938496, 5926194], [5926195, 6913893], [6913894, 7901592], [7901593, 8889291], [8889292, 9876990], [9876991, 10864689], [10864690, 11852388], [11852389, 12840087], [12840088, 13827786], [13827787, 14815485], [14815486, 15803184], [15803185, 16790883], [16790884, 17778582], [17778583, 18766281], [18766282, 19753981]] SRR12145820 file size 5149126 SRR12145820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145820 SRR12145820_1.fastq Input file: SRR12145820_1.fastq trimmed: SRR12145820-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:28:07 2025 >> started Thu Feb 13 15:28:17 2025 >> done (10.668s) 19753981 reads processed; of these: 3298 ( 0.02%) short reads filtered out after trimming by size control 41447 ( 0.21%) empty reads filtered out after trimming by size control 19709236 (99.77%) reads available; of these: 1154401 ( 5.86%) trimmed reads available after processing 18554835 (94.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 466 0.00% 19 682 0.00% 20 971 0.00% 21 977 0.00% 22 1256 0.01% 23 1720 0.01% 24 2279 0.01% 25 2981 0.02% 26 3024 0.02% 27 2895 0.01% 28 3375 0.02% 29 3260 0.02% 30 3221 0.02% 31 3090 0.02% 32 3417 0.02% 33 3438 0.02% 34 3698 0.02% 35 4190 0.02% 36 3878 0.02% 37 3946 0.02% 38 4175 0.02% 39 4213 0.02% 40 4349 0.02% 41 4468 0.02% 42 4841 0.02% 43 4997 0.03% 44 5108 0.03% 45 5509 0.03% 46 5361 0.03% 47 5484 0.03% 48 5767 0.03% 49 5697 0.03% 50 5732 0.03% 51 5858 0.03% 52 5708 0.03% 53 6084 0.03% 54 5677 0.03% 55 5749 0.03% 56 6169 0.03% 57 6571 0.03% 58 6733 0.03% 59 6962 0.04% 60 7282 0.04% 61 7402 0.04% 62 7731 0.04% 63 7669 0.04% 64 7941 0.04% 65 8247 0.04% 66 8767 0.04% 67 9008 0.05% 68 9502 0.05% 69 9566 0.05% 70 9923 0.05% 71 10552 0.05% 72 10861 0.06% 73 11260 0.06% 74 11880 0.06% 75 11919 0.06% 76 8128 0.04% 77 9477 0.05% 78 10511 0.05% 79 11589 0.06% 80 12651 0.06% 81 13480 0.07% 82 14212 0.07% 83 15190 0.08% 84 16779 0.09% 85 17288 0.09% 86 18811 0.10% 87 19944 0.10% 88 21363 0.11% 89 23585 0.12% 90 26288 0.13% 91 30082 0.15% 92 34346 0.17% 93 40103 0.20% 94 47883 0.24% 95 56030 0.28% 96 68912 0.35% 97 84829 0.43% 98 103772 0.53% 99 125662 0.64% 100 18554835 94.14% 19709236 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=9 prefix-density=0.20 prefix-fanout=3.1 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATA criterion=fanout-score sequence-density=0.13 sequence-density-rank=5 fanout-score=17.07 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=17.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAA Started job on | Feb 13 15:28:36 Started mapping on | Feb 13 15:28:36 Finished on | Feb 13 15:28:57 Mapping speed, Million of reads per hour | 3378.73 Number of input reads | 19709236 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18711136 Uniquely mapped reads % | 94.94% Average mapped length | 98.72 Number of splices: Total | 4096853 Number of splices: Annotated (sjdb) | 4001826 Number of splices: GT/AG | 4030437 Number of splices: GC/AG | 52215 Number of splices: AT/AC | 4266 Number of splices: Non-canonical | 9935 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486017 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 222556 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.45% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512083 512083 512083 N_multimapping 486017 486017 486017 N_noFeature 816978 9632414 9684046 N_ambiguous 275832 31962 32747 UnstrandedReadsAssigned:17618326 PositiveStrandReadsAssigned:9046760 NegativeStrandReadsAssigned:8994343 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145820 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145820-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,709,236 reads, 18,218,272 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR12145820.ke.tsv 34699 SRR12145820.se.tsv 87100 total ==> SRR12145820.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 573 21.1196 Potri.005G024800.1.v4.1 1035 936 251 18.9673 Potri.004G059700.1.v4.1 961 862 127 10.4209 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 275.429 6.84995 Potri.016G087400.1.v4.1 270 171 667 275.891 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 43 1.81685 Potri.012G127500.1.v4.1 977 878 2094 168.69 ==> SRR12145820.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1967 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 109 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12145820 completed mapping pipeline successfully