Starting /dee2/code/volunteer_pipeline.sh SRR12145821 current disk space = 3088790511616 free memory = 1418706796 SRR12145821 SRAfilesize bc06498b668b54e870f5413b000cf5b4 SRR12145821.sra SRR12145821.sra file validated SRR12145821 is single end SRR12145821 is conventional basespace SRR12145821 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.574 34.0 31.0 34.0 30.0 34.0 2 32.32275 34.0 31.0 34.0 30.0 34.0 3 32.64625 34.0 31.0 34.0 30.0 34.0 4 36.129 37.0 37.0 37.0 35.0 37.0 5 36.177 37.0 37.0 37.0 35.0 37.0 6 36.35475 37.0 37.0 37.0 35.0 37.0 7 36.357 37.0 37.0 37.0 35.0 37.0 8 36.36025 37.0 37.0 37.0 35.0 37.0 9 38.19625 39.0 39.0 39.0 37.0 39.0 10-11 38.196375 39.0 39.0 39.0 37.0 39.0 12-13 38.170125 39.0 39.0 39.0 37.0 39.0 14-15 39.654375 41.0 40.0 41.0 37.0 41.0 16-17 39.715875 41.0 40.0 41.0 37.0 41.0 18-19 39.664500000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.594375 41.0 40.0 41.0 37.0 41.0 22-23 39.5625 41.0 40.0 41.0 37.0 41.0 24-25 39.542375 41.0 40.0 41.0 37.0 41.0 26-27 39.306875000000005 41.0 39.5 41.0 36.5 41.0 28-29 39.23175 41.0 39.0 41.0 36.0 41.0 30-31 39.193749999999994 41.0 39.0 41.0 36.0 41.0 32-33 39.060249999999996 41.0 39.0 41.0 36.0 41.0 34-35 38.791875000000005 40.5 38.5 41.0 35.0 41.0 36-37 38.641375 40.0 38.0 41.0 35.0 41.0 38-39 38.646875 40.0 38.0 41.0 35.0 41.0 40-41 38.560625 40.0 38.0 41.0 34.5 41.0 42-43 38.4675 40.0 38.0 41.0 34.0 41.0 44-45 38.280125 40.0 38.0 41.0 34.0 41.0 46-47 38.178124999999994 40.0 38.0 41.0 34.0 41.0 48-49 37.93825 40.0 38.0 41.0 33.0 41.0 50-51 37.761624999999995 40.0 37.5 41.0 33.0 41.0 52-53 37.700375 40.0 37.0 41.0 33.0 41.0 54-55 37.82775 40.0 37.5 41.0 33.5 41.0 56-57 38.086875000000006 40.0 38.0 41.0 33.5 41.0 58-59 38.025000000000006 40.0 37.5 41.0 34.0 41.0 60-61 37.622749999999996 40.0 37.0 41.0 32.5 41.0 62-63 37.50675 39.5 36.5 41.0 33.0 41.0 64-65 37.216875 39.0 36.0 41.0 32.0 41.0 66-67 36.787125 39.0 35.5 40.5 32.0 41.0 68-69 36.441375 38.0 35.0 40.0 31.5 41.0 70-71 35.99075 37.0 35.0 39.5 31.0 41.0 72-73 35.497 37.0 35.0 39.0 30.5 41.0 74-75 34.966625 36.0 35.0 39.0 30.0 40.0 76-77 33.802875 35.0 33.5 37.0 28.5 39.0 78-79 34.089875000000006 35.0 34.0 37.0 29.5 39.0 80-81 33.894375 35.0 34.0 37.0 30.0 39.0 82-83 33.557 35.0 34.0 36.0 29.5 37.0 84-85 33.215875 35.0 34.0 36.0 29.5 37.0 86-87 32.893375 35.0 34.0 35.5 29.0 36.5 88-89 32.731125 35.0 34.0 35.0 29.0 36.0 90-91 32.574375 35.0 34.0 35.0 29.0 36.0 92-93 32.308125000000004 35.0 33.0 35.0 28.0 36.0 94-95 32.24125 35.0 34.0 35.0 29.0 35.5 96-97 31.9135 35.0 33.0 35.0 27.0 35.0 98-99 31.605625000000003 35.0 33.0 35.0 25.0 35.0 100 31.24125 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 6.0 12 4.0 13 11.0 14 5.0 15 3.0 16 6.0 17 6.0 18 3.0 19 5.0 20 5.0 21 9.0 22 6.0 23 11.0 24 14.0 25 28.0 26 20.0 27 32.0 28 36.0 29 30.0 30 44.0 31 73.0 32 63.0 33 92.0 34 135.0 35 211.0 36 363.0 37 887.0 38 1515.0 39 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.04493207941484 15.569487983281086 20.87251828631139 37.51306165099268 2 21.525 23.549999999999997 34.150000000000006 20.775 3 22.95 25.224999999999998 28.449999999999996 23.375 4 25.025 32.025 21.7 21.25 5 24.306076519129782 36.1090272568142 22.355588897224308 17.22930732683171 6 19.900000000000002 38.324999999999996 22.775000000000002 19.0 7 16.6 19.925 43.375 20.1 8 18.9 25.5 28.999999999999996 26.6 9 20.175 24.425 31.15 24.25 10-11 22.0625 34.849999999999994 22.5125 20.575 12-13 20.2625 28.000000000000004 30.65 21.087500000000002 14-15 21.2 28.15 28.762500000000003 21.8875 16-17 21.475 29.125 28.575 20.825 18-19 20.8875 30.162499999999998 27.0625 21.8875 20-21 20.7625 29.8875 27.3625 21.987499999999997 22-23 21.475 30.075000000000003 27.5625 20.8875 24-25 21.2875 30.0875 26.8125 21.8125 26-27 21.1625 28.625 28.1875 22.025 28-29 21.6125 29.037499999999998 27.650000000000002 21.7 30-31 20.875 29.575000000000003 28.275 21.275 32-33 22.0625 29.5 26.9625 21.475 34-35 21.8625 29.475 27.800000000000004 20.8625 36-37 20.674999999999997 29.562500000000004 28.325 21.4375 38-39 21.637500000000003 28.812500000000004 27.237499999999997 22.3125 40-41 21.575 29.4875 27.3375 21.6 42-43 21.099999999999998 29.2375 28.050000000000004 21.6125 44-45 22.112499999999997 29.262500000000003 27.3375 21.2875 46-47 21.55 30.0875 26.3 22.0625 48-49 21.8875 29.45 27.6125 21.05 50-51 21.65 27.6625 28.8375 21.85 52-53 21.8625 28.525 27.375 22.237499999999997 54-55 20.974999999999998 29.525000000000002 28.449999999999996 21.05 56-57 21.4875 28.349999999999998 27.987499999999997 22.175 58-59 20.5625 28.65 28.012500000000003 22.775000000000002 60-61 21.5 29.262500000000003 28.0625 21.175 62-63 21.212500000000002 28.762500000000003 28.225 21.8 64-65 22.275 28.762500000000003 27.525 21.4375 66-67 21.425 28.599999999999998 28.849999999999998 21.125 68-69 21.425 28.449999999999996 28.237499999999997 21.8875 70-71 22.025 28.199999999999996 28.7375 21.0375 72-73 21.775 28.537499999999998 28.6125 21.075 74-75 21.5625 27.962500000000002 28.462500000000002 22.0125 76-77 21.55 28.499999999999996 28.3875 21.5625 78-79 21.637500000000003 28.849999999999998 28.1875 21.325 80-81 21.85 29.099999999999998 27.987499999999997 21.0625 82-83 22.35 28.1375 28.4 21.1125 84-85 21.325 28.675 27.650000000000002 22.35 86-87 21.712500000000002 28.1875 29.012500000000003 21.087500000000002 88-89 21.587500000000002 28.4125 28.5875 21.4125 90-91 21.825 28.4 28.262500000000003 21.512500000000003 92-93 21.2 28.5875 28.8625 21.349999999999998 94-95 21.5625 28.9375 27.962500000000002 21.5375 96-97 21.475 28.275 28.7375 21.512500000000003 98-99 21.3125 28.4375 28.4125 21.837500000000002 100 22.825 27.6 28.599999999999998 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 2.5 24 2.5 25 3.5 26 5.0 27 7.0 28 13.0 29 22.5 30 30.5 31 40.5 32 46.5 33 66.0 34 90.0 35 98.0 36 111.5 37 135.5 38 174.0 39 200.0 40 199.0 41 212.0 42 247.5 43 276.0 44 265.5 45 244.5 46 228.5 47 215.0 48 192.0 49 174.5 50 159.5 51 114.5 52 83.0 53 68.5 54 58.5 55 41.5 56 30.0 57 28.0 58 19.5 59 13.5 60 9.0 61 6.5 62 5.5 63 5.0 64 7.5 65 8.5 66 4.5 67 3.5 68 4.0 69 3.0 70 4.0 71 2.5 72 1.5 73 1.5 74 1.5 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87471811576046 99.65 2 0.07516913054372337 0.15 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.025056376847907794 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096592 spots for SRR12145821.sra Written 1096592 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra Read 1096590 spots for SRR12145821.sra Written 1096590 spots for SRR12145821.sra SRR ids: ['SRR12145821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j6poq4dx SRR12145821.sra spots: 21931802 blocks: [[1, 1096590], [1096591, 2193180], [2193181, 3289770], [3289771, 4386360], [4386361, 5482950], [5482951, 6579540], [6579541, 7676130], [7676131, 8772720], [8772721, 9869310], [9869311, 10965900], [10965901, 12062490], [12062491, 13159080], [13159081, 14255670], [14255671, 15352260], [15352261, 16448850], [16448851, 17545440], [17545441, 18642030], [18642031, 19738620], [19738621, 20835210], [20835211, 21931802]] SRR12145821 file size 5717954 SRR12145821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145821 SRR12145821_1.fastq Input file: SRR12145821_1.fastq trimmed: SRR12145821-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:49:40 2025 >> started Thu Feb 13 15:49:50 2025 >> done (10.652s) 21931802 reads processed; of these: 3206 ( 0.01%) short reads filtered out after trimming by size control 39328 ( 0.18%) empty reads filtered out after trimming by size control 21889268 (99.81%) reads available; of these: 1255283 ( 5.73%) trimmed reads available after processing 20633985 (94.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 558 0.00% 19 685 0.00% 20 1002 0.00% 21 1085 0.00% 22 1376 0.01% 23 1820 0.01% 24 2479 0.01% 25 3242 0.01% 26 3279 0.01% 27 3184 0.01% 28 3634 0.02% 29 3618 0.02% 30 3590 0.02% 31 3437 0.02% 32 3816 0.02% 33 3694 0.02% 34 4193 0.02% 35 4639 0.02% 36 4288 0.02% 37 4454 0.02% 38 4638 0.02% 39 4652 0.02% 40 5008 0.02% 41 5116 0.02% 42 5414 0.02% 43 5539 0.03% 44 5994 0.03% 45 6271 0.03% 46 5850 0.03% 47 6305 0.03% 48 6282 0.03% 49 6229 0.03% 50 6340 0.03% 51 6425 0.03% 52 6309 0.03% 53 6732 0.03% 54 6196 0.03% 55 6350 0.03% 56 6826 0.03% 57 7108 0.03% 58 7559 0.03% 59 7728 0.04% 60 8091 0.04% 61 8130 0.04% 62 8354 0.04% 63 8477 0.04% 64 8746 0.04% 65 9177 0.04% 66 9302 0.04% 67 9794 0.04% 68 10483 0.05% 69 10481 0.05% 70 10836 0.05% 71 11383 0.05% 72 11882 0.05% 73 12247 0.06% 74 12874 0.06% 75 13230 0.06% 76 9107 0.04% 77 10094 0.05% 78 11536 0.05% 79 12627 0.06% 80 13776 0.06% 81 14582 0.07% 82 15513 0.07% 83 16687 0.08% 84 18248 0.08% 85 18871 0.09% 86 20385 0.09% 87 21647 0.10% 88 23426 0.11% 89 25748 0.12% 90 28351 0.13% 91 32128 0.15% 92 37158 0.17% 93 43310 0.20% 94 51375 0.23% 95 60771 0.28% 96 74539 0.34% 97 91884 0.42% 98 111290 0.51% 99 135799 0.62% 100 20633985 94.27% 21889268 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=15 prefix-density=0.25 prefix-fanout=2.8 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=11.44 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=11.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAA Started job on | Feb 13 15:50:12 Started mapping on | Feb 13 15:50:12 Finished on | Feb 13 15:50:35 Mapping speed, Million of reads per hour | 3426.15 Number of input reads | 21889268 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20717204 Uniquely mapped reads % | 94.65% Average mapped length | 98.74 Number of splices: Total | 4495100 Number of splices: Annotated (sjdb) | 4393064 Number of splices: GT/AG | 4423902 Number of splices: GC/AG | 55477 Number of splices: AT/AC | 4794 Number of splices: Non-canonical | 10927 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521564 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 263522 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 650500 650500 650500 N_multimapping 521564 521564 521564 N_noFeature 917592 10652219 10725129 N_ambiguous 328142 34982 36348 UnstrandedReadsAssigned:19471470 PositiveStrandReadsAssigned:10030003 NegativeStrandReadsAssigned:9955727 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145821 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145821-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,889,268 reads, 20,180,561 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR12145821.ke.tsv 34699 SRR12145821.se.tsv 87100 total ==> SRR12145821.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 534 18.0486 Potri.005G024800.1.v4.1 1035 936 271 18.7789 Potri.004G059700.1.v4.1 961 862 105 7.90058 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 304.678 6.94845 Potri.016G087400.1.v4.1 270 171 651 246.923 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 36 1.39484 Potri.012G127500.1.v4.1 977 878 1254 92.636 ==> SRR12145821.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2850 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 243 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12145821 completed mapping pipeline successfully