Starting /dee2/code/volunteer_pipeline.sh SRR12145822 current disk space = 3088850026496 free memory = 1476741436 SRR12145822 SRAfilesize e4bdf5985437248bc67bb41a52f43b9a SRR12145822.sra SRR12145822.sra file validated SRR12145822 is single end SRR12145822 is conventional basespace SRR12145822 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.77675 34.0 31.0 34.0 30.0 34.0 2 32.42825 34.0 31.0 34.0 31.0 34.0 3 32.68225 34.0 31.0 34.0 30.0 34.0 4 36.175 37.0 37.0 37.0 35.0 37.0 5 36.17575 37.0 37.0 37.0 35.0 37.0 6 36.377 37.0 37.0 37.0 35.0 37.0 7 36.33975 37.0 37.0 37.0 35.0 37.0 8 36.322 37.0 37.0 37.0 35.0 37.0 9 38.17475 39.0 39.0 39.0 37.0 39.0 10-11 38.194374999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.17425 39.0 39.0 39.0 37.0 39.0 14-15 39.628249999999994 41.0 40.0 41.0 37.0 41.0 16-17 39.684124999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.645624999999995 41.0 40.0 41.0 37.0 41.0 20-21 39.6085 41.0 40.0 41.0 37.0 41.0 22-23 39.581875 41.0 40.0 41.0 37.0 41.0 24-25 39.452625 41.0 39.5 41.0 37.0 41.0 26-27 39.291375 41.0 39.0 41.0 36.0 41.0 28-29 39.20675 41.0 39.0 41.0 36.0 41.0 30-31 39.223375000000004 41.0 39.0 41.0 36.0 41.0 32-33 39.125375 41.0 39.0 41.0 36.0 41.0 34-35 38.7655 40.0 38.5 41.0 35.0 41.0 36-37 38.60325 40.0 38.0 41.0 34.5 41.0 38-39 38.614125 40.0 38.0 41.0 35.0 41.0 40-41 38.63475 40.0 38.0 41.0 35.0 41.0 42-43 38.461875 40.0 38.0 41.0 34.0 41.0 44-45 38.339875 40.0 38.0 41.0 34.0 41.0 46-47 38.250249999999994 40.0 38.0 41.0 34.0 41.0 48-49 38.0305 40.0 38.0 41.0 33.0 41.0 50-51 37.886125 40.0 38.0 41.0 33.0 41.0 52-53 37.710375 40.0 37.5 41.0 33.0 41.0 54-55 37.8745 40.0 37.5 41.0 33.0 41.0 56-57 38.080375000000004 40.0 38.0 41.0 34.0 41.0 58-59 37.925875000000005 40.0 37.5 41.0 33.0 41.0 60-61 37.615875 40.0 37.0 41.0 33.0 41.0 62-63 37.4725 39.5 36.5 41.0 32.5 41.0 64-65 37.203 39.0 36.0 41.0 32.5 41.0 66-67 36.798249999999996 39.0 35.5 41.0 32.0 41.0 68-69 36.415375 38.0 35.0 40.0 32.0 41.0 70-71 35.968374999999995 37.0 35.0 39.5 31.0 41.0 72-73 35.57125 37.0 35.0 39.0 31.0 41.0 74-75 35.04675 36.0 35.0 39.0 30.0 40.5 76-77 33.89975 35.0 33.5 37.0 29.0 39.0 78-79 34.10375 35.0 34.0 37.0 29.0 39.0 80-81 33.914 35.0 34.0 37.0 30.0 39.0 82-83 33.546375 35.0 34.0 36.0 29.0 37.0 84-85 33.267375 35.0 34.0 36.0 29.0 37.0 86-87 32.885875 35.0 34.0 35.5 29.0 36.5 88-89 32.74825 35.0 34.0 35.0 29.0 36.0 90-91 32.515625 35.0 34.0 35.0 28.5 36.0 92-93 32.329875 35.0 33.5 35.0 28.0 36.0 94-95 32.209999999999994 35.0 33.5 35.0 28.0 35.5 96-97 32.0805 35.0 33.0 35.0 28.0 35.0 98-99 31.668625 35.0 33.0 35.0 25.5 35.0 100 31.505 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 2.0 5 2.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 4.0 12 2.0 13 4.0 14 4.0 15 7.0 16 6.0 17 4.0 18 5.0 19 6.0 20 6.0 21 7.0 22 9.0 23 16.0 24 14.0 25 15.0 26 27.0 27 25.0 28 31.0 29 43.0 30 39.0 31 71.0 32 77.0 33 105.0 34 123.0 35 188.0 36 368.0 37 886.0 38 1516.0 39 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.084306095979247 15.953307392996107 20.051880674448768 38.91050583657588 2 21.825 24.75 33.375 20.05 3 22.625 27.950000000000003 27.250000000000004 22.175 4 23.200000000000003 32.675 21.675 22.45 5 24.05 36.6 21.45 17.9 6 18.725 38.550000000000004 23.549999999999997 19.175 7 15.950000000000001 17.95 45.45 20.65 8 19.400000000000002 24.7 28.799999999999997 27.1 9 19.75 24.275 30.575000000000003 25.4 10-11 22.3375 34.9 22.275 20.4875 12-13 20.6625 26.887499999999996 30.2375 22.2125 14-15 20.175 28.8875 29.65 21.2875 16-17 20.95 29.812499999999996 27.537499999999998 21.7 18-19 20.6875 28.9375 28.787499999999998 21.587500000000002 20-21 20.575 29.262500000000003 28.125 22.037499999999998 22-23 21.75 29.262500000000003 28.15 20.837500000000002 24-25 22.15 29.849999999999998 26.575 21.425 26-27 21.55 29.325000000000003 27.900000000000002 21.224999999999998 28-29 22.2 29.212500000000002 26.900000000000002 21.6875 30-31 21.05 29.225 28.65 21.075 32-33 21.2875 28.962500000000002 28.449999999999996 21.3 34-35 21.1375 29.4 27.8375 21.625 36-37 21.099999999999998 29.7125 27.2625 21.925 38-39 22.05 29.8375 27.025 21.087500000000002 40-41 21.762500000000003 29.6875 26.887499999999996 21.6625 42-43 20.724999999999998 28.487499999999997 29.125 21.6625 44-45 21.9625 28.7375 27.825 21.475 46-47 20.6125 29.025000000000002 28.0875 22.275 48-49 21.6625 29.375 27.462500000000002 21.5 50-51 21.725 29.525000000000002 27.825 20.925 52-53 21.1875 29.225 28.325 21.2625 54-55 21.0625 28.8375 28.512500000000003 21.587500000000002 56-57 22.0 28.449999999999996 28.3875 21.1625 58-59 20.849999999999998 28.6625 28.6875 21.8 60-61 21.2 28.599999999999998 28.225 21.975 62-63 21.6625 28.1375 28.275 21.925 64-65 21.7375 28.3625 28.3125 21.587500000000002 66-67 21.2875 28.775000000000002 28.0875 21.85 68-69 21.462500000000002 28.6375 28.212500000000002 21.6875 70-71 21.462500000000002 29.0875 28.775000000000002 20.674999999999997 72-73 21.837500000000002 29.037499999999998 27.212500000000002 21.912499999999998 74-75 20.9125 28.9 28.787499999999998 21.4 76-77 21.9375 28.712500000000002 27.3875 21.9625 78-79 21.625 28.375 28.1875 21.8125 80-81 21.875 28.9375 27.9375 21.25 82-83 21.0625 29.3875 29.037499999999998 20.5125 84-85 22.05 27.700000000000003 28.8625 21.3875 86-87 22.3625 28.462500000000002 28.812500000000004 20.3625 88-89 21.875 27.9125 28.487499999999997 21.725 90-91 21.5625 29.2 27.675 21.5625 92-93 22.3625 27.3125 29.175 21.15 94-95 21.4 29.299999999999997 28.299999999999997 21.0 96-97 21.912499999999998 28.3875 28.762500000000003 20.9375 98-99 21.325 28.625 28.3625 21.6875 100 22.0 29.275000000000002 28.025 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 3.0 26 10.5 27 16.5 28 14.5 29 20.5 30 40.0 31 55.5 32 67.0 33 84.5 34 91.0 35 98.5 36 119.0 37 132.5 38 152.5 39 180.0 40 203.0 41 216.5 42 216.5 43 237.0 44 255.0 45 238.0 46 220.0 47 215.0 48 200.0 49 175.0 50 158.0 51 129.0 52 101.0 53 77.5 54 51.5 55 39.0 56 32.0 57 26.0 58 21.0 59 16.0 60 14.0 61 12.0 62 8.0 63 7.5 64 6.5 65 4.5 66 5.0 67 4.0 68 3.0 69 2.5 70 2.5 71 3.5 72 2.5 73 1.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra Read 1033492 spots for SRR12145822.sra Written 1033492 spots for SRR12145822.sra SRR ids: ['SRR12145822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jq9e94w9 SRR12145822.sra spots: 20669840 blocks: [[1, 1033492], [1033493, 2066984], [2066985, 3100476], [3100477, 4133968], [4133969, 5167460], [5167461, 6200952], [6200953, 7234444], [7234445, 8267936], [8267937, 9301428], [9301429, 10334920], [10334921, 11368412], [11368413, 12401904], [12401905, 13435396], [13435397, 14468888], [14468889, 15502380], [15502381, 16535872], [16535873, 17569364], [17569365, 18602856], [18602857, 19636348], [19636349, 20669840]] SRR12145822 file size 5388326 SRR12145822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145822 SRR12145822_1.fastq Input file: SRR12145822_1.fastq trimmed: SRR12145822-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:59:33 2025 >> started Thu Feb 13 15:59:44 2025 >> done (10.954s) 20669840 reads processed; of these: 3452 ( 0.02%) short reads filtered out after trimming by size control 20186 ( 0.10%) empty reads filtered out after trimming by size control 20646202 (99.89%) reads available; of these: 1159914 ( 5.62%) trimmed reads available after processing 19486288 (94.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 469 0.00% 19 631 0.00% 20 803 0.00% 21 927 0.00% 22 1207 0.01% 23 1621 0.01% 24 2173 0.01% 25 2763 0.01% 26 2957 0.01% 27 2803 0.01% 28 3067 0.01% 29 3055 0.01% 30 3128 0.02% 31 3135 0.02% 32 3185 0.02% 33 3295 0.02% 34 3788 0.02% 35 4994 0.02% 36 3804 0.02% 37 3870 0.02% 38 4124 0.02% 39 4066 0.02% 40 4354 0.02% 41 4566 0.02% 42 4578 0.02% 43 5047 0.02% 44 5164 0.03% 45 5455 0.03% 46 5402 0.03% 47 5654 0.03% 48 5618 0.03% 49 5812 0.03% 50 5683 0.03% 51 5849 0.03% 52 5655 0.03% 53 5971 0.03% 54 5629 0.03% 55 5906 0.03% 56 6103 0.03% 57 6567 0.03% 58 6829 0.03% 59 6874 0.03% 60 7199 0.03% 61 7495 0.04% 62 7712 0.04% 63 7731 0.04% 64 8092 0.04% 65 8267 0.04% 66 8802 0.04% 67 9185 0.04% 68 9463 0.05% 69 9427 0.05% 70 9926 0.05% 71 10702 0.05% 72 10983 0.05% 73 11580 0.06% 74 11911 0.06% 75 12060 0.06% 76 8388 0.04% 77 9323 0.05% 78 10545 0.05% 79 11687 0.06% 80 12623 0.06% 81 13526 0.07% 82 14334 0.07% 83 15502 0.08% 84 16995 0.08% 85 17709 0.09% 86 18721 0.09% 87 20413 0.10% 88 21625 0.10% 89 24118 0.12% 90 26256 0.13% 91 30223 0.15% 92 34760 0.17% 93 40585 0.20% 94 48443 0.23% 95 56721 0.27% 96 69714 0.34% 97 85683 0.42% 98 103443 0.50% 99 125461 0.61% 100 19486288 94.38% 20646202 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=18.29 fanout-score-rank=3 prefix-density=0.13 prefix-fanout=18.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=36.81 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.9 sequence=AAGAAAAGAAAA Started job on | Feb 13 16:00:03 Started mapping on | Feb 13 16:00:03 Finished on | Feb 13 16:00:22 Mapping speed, Million of reads per hour | 3911.91 Number of input reads | 20646202 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 19754092 Uniquely mapped reads % | 95.68% Average mapped length | 98.74 Number of splices: Total | 4887832 Number of splices: Annotated (sjdb) | 4790570 Number of splices: GT/AG | 4808209 Number of splices: GC/AG | 64089 Number of splices: AT/AC | 5249 Number of splices: Non-canonical | 10285 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507002 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 160255 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.08% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385108 385108 385108 N_multimapping 507002 507002 507002 N_noFeature 793715 10154135 10206962 N_ambiguous 251554 32336 33053 UnstrandedReadsAssigned:18708823 PositiveStrandReadsAssigned:9567621 NegativeStrandReadsAssigned:9514077 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145822 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145822-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,646,202 reads, 19,249,970 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR12145822.ke.tsv 34699 SRR12145822.se.tsv 87100 total ==> SRR12145822.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 475 15.8104 Potri.005G024800.1.v4.1 1035 936 138 9.41731 Potri.004G059700.1.v4.1 961 862 73 5.40928 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 360.484 8.09617 Potri.016G087400.1.v4.1 270 171 791 295.464 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 52 1.98414 Potri.012G127500.1.v4.1 977 878 2633 191.549 ==> SRR12145822.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1373 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 398 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 148 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12145822 completed mapping pipeline successfully