Starting /dee2/code/volunteer_pipeline.sh SRR12145823 current disk space = 3088797687808 free memory = 1485870692 SRR12145823 SRAfilesize 21e16c22b94ef9d216f2d09c0e13646e SRR12145823.sra SRR12145823.sra file validated SRR12145823 is single end SRR12145823 is conventional basespace SRR12145823 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.40725 34.0 31.0 34.0 30.0 34.0 2 32.1965 34.0 31.0 34.0 30.0 34.0 3 32.55375 34.0 31.0 34.0 30.0 34.0 4 36.09175 37.0 35.0 37.0 35.0 37.0 5 36.13975 37.0 37.0 37.0 35.0 37.0 6 36.30225 37.0 37.0 37.0 35.0 37.0 7 36.3275 37.0 37.0 37.0 35.0 37.0 8 36.3485 37.0 37.0 37.0 35.0 37.0 9 38.18325 39.0 39.0 39.0 37.0 39.0 10-11 38.204625 39.0 39.0 39.0 37.0 39.0 12-13 38.167625 39.0 39.0 39.0 37.0 39.0 14-15 39.6315 41.0 40.0 41.0 37.0 41.0 16-17 39.699 41.0 40.0 41.0 37.0 41.0 18-19 39.602125 41.0 40.0 41.0 37.0 41.0 20-21 39.548500000000004 41.0 40.0 41.0 37.0 41.0 22-23 39.537499999999994 41.0 39.5 41.0 37.0 41.0 24-25 39.5215 41.0 39.5 41.0 37.0 41.0 26-27 39.327 41.0 39.0 41.0 36.0 41.0 28-29 39.27575 41.0 39.0 41.0 36.0 41.0 30-31 39.192125000000004 41.0 39.0 41.0 36.0 41.0 32-33 39.07 40.5 39.0 41.0 36.0 41.0 34-35 38.72775 40.0 38.5 41.0 34.5 41.0 36-37 38.57275 40.0 38.0 41.0 34.5 41.0 38-39 38.532624999999996 40.0 38.0 41.0 34.5 41.0 40-41 38.517625 40.0 38.0 41.0 34.5 41.0 42-43 38.408125 40.0 38.0 41.0 34.0 41.0 44-45 38.224875 40.0 38.0 41.0 34.0 41.0 46-47 38.21125 40.0 38.0 41.0 34.0 41.0 48-49 37.986000000000004 40.0 38.0 41.0 33.0 41.0 50-51 37.750125 40.0 37.0 41.0 33.0 41.0 52-53 37.658125 40.0 37.0 41.0 33.0 41.0 54-55 37.7805 40.0 37.5 41.0 33.0 41.0 56-57 38.1115 40.0 38.0 41.0 34.0 41.0 58-59 37.968125 40.0 37.5 41.0 33.5 41.0 60-61 37.527375 39.5 36.5 41.0 33.0 41.0 62-63 37.417874999999995 39.0 36.5 41.0 32.5 41.0 64-65 37.16225 39.0 36.0 41.0 32.0 41.0 66-67 36.698125000000005 38.5 35.0 40.5 31.5 41.0 68-69 36.30325 37.5 35.0 40.0 31.0 41.0 70-71 35.83825 37.0 35.0 39.0 31.0 41.0 72-73 35.414375 36.5 35.0 39.0 31.0 41.0 74-75 34.935375 36.0 34.5 38.5 30.0 40.0 76-77 33.679 35.0 33.0 37.0 28.5 39.0 78-79 34.037 35.0 34.0 37.0 29.0 39.0 80-81 33.8525 35.0 34.0 36.5 30.0 38.0 82-83 33.56125 35.0 34.0 36.0 29.0 37.0 84-85 33.27875 35.0 34.0 36.0 29.0 37.0 86-87 33.096000000000004 35.0 34.0 35.0 29.5 36.0 88-89 32.861374999999995 35.0 34.0 35.0 29.0 36.0 90-91 32.657875 35.0 33.5 35.0 29.0 36.0 92-93 32.478750000000005 35.0 33.0 35.0 29.0 36.0 94-95 32.228125000000006 35.0 33.0 35.0 28.5 35.5 96-97 32.043 35.0 33.0 35.0 27.0 35.0 98-99 31.666874999999997 35.0 33.0 35.0 25.5 35.0 100 31.17525 35.0 33.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 7.0 12 1.0 13 7.0 14 4.0 15 2.0 16 5.0 17 3.0 18 6.0 19 8.0 20 10.0 21 9.0 22 7.0 23 15.0 24 9.0 25 14.0 26 14.0 27 25.0 28 23.0 29 46.0 30 41.0 31 53.0 32 71.0 33 116.0 34 153.0 35 264.0 36 425.0 37 903.0 38 1474.0 39 279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.23723487824038 15.396700706991359 19.42916993977481 38.93689447499346 2 19.725 24.725 34.825 20.724999999999998 3 22.425 27.725 27.375 22.475 4 25.624999999999996 32.5 19.8 22.075 5 24.937468734367183 34.71735867933967 22.661330665332667 17.68384192096048 6 18.175 38.15 23.775 19.900000000000002 7 16.05 18.6 44.0 21.349999999999998 8 18.625 24.85 29.575000000000003 26.950000000000003 9 19.875 24.275 30.725 25.124999999999996 10-11 22.3375 33.4625 21.95 22.25 12-13 20.0375 26.2875 30.337500000000002 23.3375 14-15 20.2625 28.6125 28.749999999999996 22.375 16-17 20.825 29.6375 27.1625 22.375 18-19 22.0 29.625 27.250000000000004 21.125 20-21 21.9625 27.750000000000004 28.7 21.587500000000002 22-23 21.2375 28.825 27.8625 22.075 24-25 21.6875 29.075 27.5125 21.725 26-27 22.3875 28.8875 27.650000000000002 21.075 28-29 21.6 28.925 28.1875 21.2875 30-31 21.1625 28.999999999999996 28.050000000000004 21.7875 32-33 21.1625 29.037499999999998 27.224999999999998 22.575 34-35 22.537499999999998 28.537499999999998 27.35 21.575 36-37 22.05 29.25 27.2625 21.4375 38-39 21.2375 28.625 27.9125 22.225 40-41 20.9375 28.0875 28.262500000000003 22.7125 42-43 21.95 28.3625 27.4125 22.275 44-45 21.925 28.299999999999997 28.15 21.625 46-47 22.0125 28.050000000000004 27.625 22.3125 48-49 21.762500000000003 27.950000000000003 28.4 21.8875 50-51 21.912499999999998 28.3875 28.1 21.6 52-53 22.375 28.1125 27.525 21.987499999999997 54-55 20.5375 28.95 28.4125 22.1 56-57 21.725 28.275 27.6625 22.3375 58-59 22.275 28.349999999999998 27.450000000000003 21.925 60-61 21.325 27.675 28.199999999999996 22.8 62-63 20.575 29.4375 27.8625 22.125 64-65 22.5 28.6125 27.725 21.1625 66-67 22.037499999999998 28.075 27.800000000000004 22.0875 68-69 21.9375 28.237499999999997 27.8125 22.0125 70-71 22.912499999999998 27.787499999999998 27.6375 21.6625 72-73 22.4625 27.975 27.800000000000004 21.762500000000003 74-75 22.2 28.725 26.950000000000003 22.125 76-77 22.05 29.025000000000002 27.4125 21.512500000000003 78-79 21.8 29.0875 28.249999999999996 20.8625 80-81 21.349999999999998 28.4375 28.125 22.0875 82-83 22.0875 28.9375 27.150000000000002 21.825 84-85 21.375 28.4375 28.0875 22.1 86-87 21.512500000000003 29.462500000000002 27.55 21.475 88-89 21.55 28.0625 28.9 21.4875 90-91 22.400000000000002 28.1125 28.0875 21.4 92-93 21.775 28.237499999999997 28.375 21.6125 94-95 21.9625 28.6875 27.525 21.825 96-97 21.125 28.5875 28.475 21.8125 98-99 22.75 28.525 27.6875 21.0375 100 21.224999999999998 28.449999999999996 27.950000000000003 22.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.5 24 3.0 25 2.5 26 3.5 27 7.5 28 15.5 29 18.5 30 21.0 31 36.0 32 51.5 33 58.0 34 62.5 35 75.5 36 96.0 37 117.5 38 141.0 39 163.0 40 198.5 41 223.5 42 243.0 43 261.0 44 257.5 45 282.0 46 276.5 47 234.5 48 200.5 49 172.0 50 162.0 51 134.5 52 100.0 53 86.0 54 67.5 55 48.0 56 42.0 57 33.0 58 19.5 59 16.5 60 17.5 61 9.0 62 5.0 63 4.5 64 4.5 65 6.5 66 3.5 67 1.5 68 3.0 69 2.5 70 1.0 71 0.5 72 1.5 73 2.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383172 spots for SRR12145823.sra Written 1383172 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra Read 1383167 spots for SRR12145823.sra Written 1383167 spots for SRR12145823.sra SRR ids: ['SRR12145823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5acyf37s SRR12145823.sra spots: 27663345 blocks: [[1, 1383167], [1383168, 2766334], [2766335, 4149501], [4149502, 5532668], [5532669, 6915835], [6915836, 8299002], [8299003, 9682169], [9682170, 11065336], [11065337, 12448503], [12448504, 13831670], [13831671, 15214837], [15214838, 16598004], [16598005, 17981171], [17981172, 19364338], [19364339, 20747505], [20747506, 22130672], [22130673, 23513839], [23513840, 24897006], [24897007, 26280173], [26280174, 27663345]] SRR12145823 file size 7215087 SRR12145823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145823 SRR12145823_1.fastq Input file: SRR12145823_1.fastq trimmed: SRR12145823-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:51:00 2025 >> started Thu Feb 13 15:51:14 2025 >> done (13.708s) 27663345 reads processed; of these: 3327 ( 0.01%) short reads filtered out after trimming by size control 29655 ( 0.11%) empty reads filtered out after trimming by size control 27630363 (99.88%) reads available; of these: 1651544 ( 5.98%) trimmed reads available after processing 25978819 (94.02%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 518 0.00% 19 886 0.00% 20 1017 0.00% 21 1058 0.00% 22 1411 0.01% 23 1990 0.01% 24 2681 0.01% 25 3370 0.01% 26 3649 0.01% 27 3530 0.01% 28 3655 0.01% 29 3681 0.01% 30 3711 0.01% 31 3725 0.01% 32 4162 0.02% 33 4243 0.02% 34 5573 0.02% 35 6555 0.02% 36 5119 0.02% 37 5587 0.02% 38 5742 0.02% 39 5849 0.02% 40 5891 0.02% 41 6845 0.02% 42 7834 0.03% 43 7191 0.03% 44 7999 0.03% 45 8322 0.03% 46 7761 0.03% 47 8171 0.03% 48 7833 0.03% 49 8013 0.03% 50 7962 0.03% 51 9135 0.03% 52 8425 0.03% 53 10604 0.04% 54 8207 0.03% 55 8702 0.03% 56 9189 0.03% 57 9660 0.03% 58 11425 0.04% 59 10460 0.04% 60 11062 0.04% 61 10662 0.04% 62 10574 0.04% 63 11169 0.04% 64 11313 0.04% 65 11856 0.04% 66 12517 0.05% 67 12728 0.05% 68 13570 0.05% 69 13322 0.05% 70 13749 0.05% 71 14696 0.05% 72 15058 0.05% 73 15829 0.06% 74 16880 0.06% 75 17068 0.06% 76 11891 0.04% 77 13171 0.05% 78 14980 0.05% 79 16370 0.06% 80 17764 0.06% 81 19022 0.07% 82 20392 0.07% 83 21868 0.08% 84 23639 0.09% 85 24553 0.09% 86 26387 0.10% 87 28574 0.10% 88 30886 0.11% 89 33821 0.12% 90 37524 0.14% 91 43012 0.16% 92 49436 0.18% 93 57843 0.21% 94 69668 0.25% 95 81321 0.29% 96 99772 0.36% 97 122755 0.44% 98 148142 0.54% 99 179359 0.65% 100 25978819 94.02% 27630363 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=10 prefix-density=0.30 prefix-fanout=2.9 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCAC criterion=fanout-score sequence-density=0.17 sequence-density-rank=7 fanout-score=7.44 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.4 sequence=GCTCCAGCTCCAGCACCAGT Started job on | Feb 13 15:51:28 Started mapping on | Feb 13 15:51:29 Finished on | Feb 13 15:51:54 Mapping speed, Million of reads per hour | 3978.77 Number of input reads | 27630363 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 26511326 Uniquely mapped reads % | 95.95% Average mapped length | 98.74 Number of splices: Total | 6903454 Number of splices: Annotated (sjdb) | 6780681 Number of splices: GT/AG | 6800492 Number of splices: GC/AG | 82927 Number of splices: AT/AC | 7675 Number of splices: Non-canonical | 12360 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 647067 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 144599 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471970 471970 471970 N_multimapping 647067 647067 647067 N_noFeature 939297 13499295 13642511 N_ambiguous 392966 41640 42958 UnstrandedReadsAssigned:25179063 PositiveStrandReadsAssigned:12970391 NegativeStrandReadsAssigned:12825857 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145823 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145823-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,630,363 reads, 25,910,666 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR12145823.ke.tsv 34699 SRR12145823.se.tsv 87100 total ==> SRR12145823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 645 17.5631 Potri.005G024800.1.v4.1 1035 936 82 4.57778 Potri.004G059700.1.v4.1 961 862 343 20.7924 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 330.245 6.0677 Potri.016G087400.1.v4.1 270 171 920 281.131 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 39 1.21738 Potri.012G127500.1.v4.1 977 878 1637 97.4252 ==> SRR12145823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3122 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 620 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 269 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12145823 completed mapping pipeline successfully