Starting /dee2/code/volunteer_pipeline.sh SRR12145824 current disk space = 3088841818112 free memory = 1389574348 SRR12145824 SRAfilesize 43377749051b07e5386cdf1a19067602 SRR12145824.sra SRR12145824.sra file validated SRR12145824 is single end SRR12145824 is conventional basespace SRR12145824 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6765 34.0 31.0 34.0 30.0 34.0 2 32.36625 34.0 31.0 34.0 30.0 34.0 3 32.635 34.0 31.0 34.0 30.0 34.0 4 36.135 37.0 37.0 37.0 35.0 37.0 5 36.13925 37.0 37.0 37.0 35.0 37.0 6 36.29475 37.0 37.0 37.0 35.0 37.0 7 36.3305 37.0 37.0 37.0 35.0 37.0 8 36.3015 37.0 37.0 37.0 35.0 37.0 9 38.198 39.0 39.0 39.0 37.0 39.0 10-11 38.14425 39.0 39.0 39.0 37.0 39.0 12-13 38.134625 39.0 39.0 39.0 37.0 39.0 14-15 39.606875 41.0 40.0 41.0 36.5 41.0 16-17 39.643874999999994 41.0 40.0 41.0 37.0 41.0 18-19 39.651375 41.0 40.0 41.0 37.0 41.0 20-21 39.569874999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.530125 41.0 39.5 41.0 37.0 41.0 24-25 39.509375 41.0 39.0 41.0 37.0 41.0 26-27 39.359875 41.0 39.0 41.0 36.5 41.0 28-29 39.245625000000004 41.0 39.0 41.0 36.0 41.0 30-31 39.16475 41.0 39.0 41.0 36.0 41.0 32-33 39.1485 41.0 39.0 41.0 36.0 41.0 34-35 38.754000000000005 40.0 38.5 41.0 34.5 41.0 36-37 38.561375 40.0 38.0 41.0 34.0 41.0 38-39 38.57325 40.0 38.0 41.0 34.5 41.0 40-41 38.54775 40.0 38.0 41.0 34.5 41.0 42-43 38.295875 40.0 38.0 41.0 34.0 41.0 44-45 38.19499999999999 40.0 38.0 41.0 33.5 41.0 46-47 38.016625000000005 40.0 38.0 41.0 33.0 41.0 48-49 37.812749999999994 40.0 37.5 41.0 33.0 41.0 50-51 37.652874999999995 40.0 37.0 41.0 32.5 41.0 52-53 37.539500000000004 40.0 37.0 41.0 32.5 41.0 54-55 37.741375000000005 40.0 37.5 41.0 33.0 41.0 56-57 38.040125 40.0 37.5 41.0 34.0 41.0 58-59 37.85625 40.0 37.0 41.0 33.0 41.0 60-61 37.4655 39.5 36.5 41.0 32.5 41.0 62-63 37.270624999999995 39.0 36.0 41.0 32.0 41.0 64-65 36.946124999999995 39.0 35.5 41.0 32.0 41.0 66-67 36.486000000000004 38.5 35.0 40.5 31.0 41.0 68-69 36.159375 37.5 35.0 40.0 31.0 41.0 70-71 35.810249999999996 37.0 35.0 39.5 31.0 41.0 72-73 35.431625 36.5 35.0 39.0 31.0 41.0 74-75 34.924499999999995 36.0 34.5 39.0 30.0 40.0 76-77 33.715625 35.0 33.5 37.0 28.5 39.0 78-79 34.06925 35.0 34.0 37.0 29.5 39.0 80-81 33.830124999999995 35.0 34.0 37.0 30.0 38.5 82-83 33.563875 35.0 34.0 36.0 29.0 37.0 84-85 33.2335 35.0 34.0 36.0 29.0 37.0 86-87 32.881375000000006 35.0 34.0 35.5 29.0 36.5 88-89 32.689499999999995 35.0 34.0 35.0 29.0 36.0 90-91 32.421375 35.0 33.5 35.0 27.5 36.0 92-93 32.181875000000005 35.0 33.0 35.0 27.0 36.0 94-95 32.12025 35.0 33.0 35.0 28.0 35.5 96-97 31.808625 35.0 33.0 35.0 25.5 35.0 98-99 31.42425 35.0 33.0 35.0 25.0 35.0 100 31.07775 35.0 33.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 6.0 12 6.0 13 2.0 14 3.0 15 5.0 16 5.0 17 6.0 18 18.0 19 3.0 20 4.0 21 7.0 22 7.0 23 13.0 24 15.0 25 10.0 26 25.0 27 22.0 28 38.0 29 39.0 30 61.0 31 65.0 32 85.0 33 100.0 34 125.0 35 245.0 36 420.0 37 876.0 38 1411.0 39 372.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.37837837837838 15.384615384615385 17.203742203742202 39.03326403326403 2 21.224999999999998 21.775 34.2 22.8 3 23.225 27.125 25.825 23.825 4 25.775 31.474999999999998 20.325 22.425 5 25.168876657493122 34.676007005253936 21.165874405804352 18.989241931448586 6 17.599999999999998 38.5 23.95 19.950000000000003 7 16.975 20.1 43.2 19.725 8 19.675 23.575 29.575000000000003 27.175 9 21.325 23.325000000000003 31.35 24.0 10-11 23.175 33.6125 22.075 21.1375 12-13 20.2375 26.6 31.05 22.112499999999997 14-15 20.5125 28.449999999999996 29.525000000000002 21.512500000000003 16-17 21.2625 28.425 27.5125 22.8 18-19 22.3375 28.512500000000003 27.35 21.8 20-21 22.1375 28.5875 27.187499999999996 22.0875 22-23 21.462500000000002 29.175 27.275 22.0875 24-25 20.5375 29.5875 28.4375 21.4375 26-27 21.512500000000003 28.775000000000002 27.725 21.987499999999997 28-29 21.725 28.775000000000002 27.325 22.175 30-31 21.2875 28.3875 27.85 22.475 32-33 21.75 28.9125 27.775 21.5625 34-35 23.0125 28.475 26.5625 21.95 36-37 21.55 28.762500000000003 28.037499999999998 21.65 38-39 21.675 28.8625 27.987499999999997 21.475 40-41 21.9 28.7375 27.250000000000004 22.112499999999997 42-43 21.7875 28.075 28.825 21.3125 44-45 21.6875 28.599999999999998 27.625 22.0875 46-47 22.4625 27.775 28.037499999999998 21.725 48-49 21.125 29.15 27.35 22.375 50-51 21.475 29.049999999999997 28.225 21.25 52-53 22.375 28.3625 28.1 21.1625 54-55 21.8125 28.6875 27.800000000000004 21.7 56-57 21.1625 28.812500000000004 27.737499999999997 22.287499999999998 58-59 21.087500000000002 28.475 28.349999999999998 22.0875 60-61 21.462500000000002 27.750000000000004 28.299999999999997 22.4875 62-63 21.7 28.849999999999998 27.325 22.125 64-65 22.2125 26.8375 28.6375 22.3125 66-67 20.8875 28.6625 28.9875 21.462500000000002 68-69 22.0 27.950000000000003 27.700000000000003 22.35 70-71 21.65 28.6625 28.1 21.587500000000002 72-73 21.1875 28.95 28.175 21.6875 74-75 21.425 28.9375 27.762500000000003 21.875 76-77 21.95 29.025000000000002 27.35 21.675 78-79 22.412499999999998 27.3625 28.7375 21.4875 80-81 21.7875 27.675 28.575 21.9625 82-83 20.3625 28.1375 28.749999999999996 22.75 84-85 22.037499999999998 28.025 28.299999999999997 21.637500000000003 86-87 21.475 28.95 28.249999999999996 21.325 88-89 21.875 28.075 27.8125 22.237499999999997 90-91 22.2625 27.55 28.325 21.8625 92-93 21.7 28.712500000000002 27.6625 21.925 94-95 21.9 27.675 28.349999999999998 22.075 96-97 21.925 28.025 27.975 22.075 98-99 21.325 28.5875 28.349999999999998 21.7375 100 21.3 27.950000000000003 28.975 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 3.5 24 3.5 25 5.5 26 10.5 27 14.5 28 17.0 29 19.0 30 25.0 31 34.0 32 44.5 33 54.0 34 68.0 35 83.0 36 112.5 37 136.0 38 151.5 39 177.0 40 184.5 41 198.5 42 235.0 43 261.5 44 254.5 45 245.0 46 231.5 47 202.5 48 191.5 49 179.0 50 150.0 51 121.5 52 108.5 53 103.5 54 88.0 55 71.5 56 51.5 57 31.0 58 25.5 59 24.0 60 17.0 61 12.0 62 9.5 63 4.5 64 3.0 65 3.5 66 3.0 67 3.0 68 3.0 69 2.5 70 2.5 71 2.0 72 2.5 73 3.5 74 2.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063245 spots for SRR12145824.sra Written 1063245 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra Read 1063232 spots for SRR12145824.sra Written 1063232 spots for SRR12145824.sra SRR ids: ['SRR12145824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2j95keht SRR12145824.sra spots: 21264653 blocks: [[1, 1063232], [1063233, 2126464], [2126465, 3189696], [3189697, 4252928], [4252929, 5316160], [5316161, 6379392], [6379393, 7442624], [7442625, 8505856], [8505857, 9569088], [9569089, 10632320], [10632321, 11695552], [11695553, 12758784], [12758785, 13822016], [13822017, 14885248], [14885249, 15948480], [15948481, 17011712], [17011713, 18074944], [18074945, 19138176], [19138177, 20201408], [20201409, 21264653]] SRR12145824 file size 5543711 SRR12145824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145824 SRR12145824_1.fastq Input file: SRR12145824_1.fastq trimmed: SRR12145824-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:37:35 2025 >> started Thu Feb 13 15:37:46 2025 >> done (11.167s) 21264653 reads processed; of these: 2472 ( 0.01%) short reads filtered out after trimming by size control 18752 ( 0.09%) empty reads filtered out after trimming by size control 21243429 (99.90%) reads available; of these: 1312065 ( 6.18%) trimmed reads available after processing 19931364 (93.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 400 0.00% 19 519 0.00% 20 726 0.00% 21 901 0.00% 22 1126 0.01% 23 1464 0.01% 24 2035 0.01% 25 2757 0.01% 26 3135 0.01% 27 2951 0.01% 28 2877 0.01% 29 2983 0.01% 30 3052 0.01% 31 3151 0.01% 32 3353 0.02% 33 3374 0.02% 34 3906 0.02% 35 5069 0.02% 36 3917 0.02% 37 4121 0.02% 38 4308 0.02% 39 4332 0.02% 40 4588 0.02% 41 4829 0.02% 42 5010 0.02% 43 5468 0.03% 44 5586 0.03% 45 5909 0.03% 46 5770 0.03% 47 6064 0.03% 48 5901 0.03% 49 6171 0.03% 50 6268 0.03% 51 6521 0.03% 52 6134 0.03% 53 6675 0.03% 54 6269 0.03% 55 6408 0.03% 56 6853 0.03% 57 7176 0.03% 58 7461 0.04% 59 7707 0.04% 60 8086 0.04% 61 8219 0.04% 62 8429 0.04% 63 8465 0.04% 64 8808 0.04% 65 9275 0.04% 66 9919 0.05% 67 10210 0.05% 68 10699 0.05% 69 10748 0.05% 70 11161 0.05% 71 11839 0.06% 72 12143 0.06% 73 12854 0.06% 74 13440 0.06% 75 13800 0.06% 76 9474 0.04% 77 10546 0.05% 78 12290 0.06% 79 13261 0.06% 80 14468 0.07% 81 15120 0.07% 82 16113 0.08% 83 17600 0.08% 84 19684 0.09% 85 20047 0.09% 86 21419 0.10% 87 23108 0.11% 88 24948 0.12% 89 27951 0.13% 90 30420 0.14% 91 34568 0.16% 92 39982 0.19% 93 46872 0.22% 94 55859 0.26% 95 65284 0.31% 96 79757 0.38% 97 98717 0.46% 98 119162 0.56% 99 144095 0.68% 100 19931364 93.82% 21243429 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=12 prefix-density=0.28 prefix-fanout=2.9 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=8.63 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.4 sequence=GGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTC Started job on | Feb 13 15:38:10 Started mapping on | Feb 13 15:38:10 Finished on | Feb 13 15:38:51 Mapping speed, Million of reads per hour | 1865.28 Number of input reads | 21243429 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19186448 Uniquely mapped reads % | 90.32% Average mapped length | 98.70 Number of splices: Total | 4477056 Number of splices: Annotated (sjdb) | 4374337 Number of splices: GT/AG | 4404711 Number of splices: GC/AG | 57213 Number of splices: AT/AC | 5347 Number of splices: Non-canonical | 9785 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 488276 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 129925 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.76% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1568705 1568705 1568705 N_multimapping 488276 488276 488276 N_noFeature 962762 9906658 10009548 N_ambiguous 300290 33110 34629 UnstrandedReadsAssigned:17923396 PositiveStrandReadsAssigned:9246680 NegativeStrandReadsAssigned:9142271 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145824 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145824-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,243,429 reads, 18,463,766 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR12145824.ke.tsv 34699 SRR12145824.se.tsv 87100 total ==> SRR12145824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 569 20.9871 Potri.005G024800.1.v4.1 1035 936 216 16.3341 Potri.004G059700.1.v4.1 961 862 146 11.9884 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 330.346 8.22159 Potri.016G087400.1.v4.1 270 171 593.398 245.621 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 53 2.24097 Potri.012G127500.1.v4.1 977 878 1080 87.0654 ==> SRR12145824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2974 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 192 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12145824 completed mapping pipeline successfully