Starting /dee2/code/volunteer_pipeline.sh SRR12145825 current disk space = 3088827654144 free memory = 1449919276 SRR12145825 SRAfilesize 2b76999f82c3dcb3e40fd331be1d6f7a SRR12145825.sra SRR12145825.sra file validated SRR12145825 is single end SRR12145825 is conventional basespace SRR12145825 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12145825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58725 34.0 31.0 34.0 30.0 34.0 2 32.318 34.0 31.0 34.0 31.0 34.0 3 32.6565 34.0 31.0 34.0 30.0 34.0 4 36.173 37.0 37.0 37.0 35.0 37.0 5 36.18575 37.0 37.0 37.0 35.0 37.0 6 36.359 37.0 37.0 37.0 35.0 37.0 7 36.36025 37.0 37.0 37.0 35.0 37.0 8 36.368 37.0 37.0 37.0 35.0 37.0 9 38.2325 39.0 39.0 39.0 37.0 39.0 10-11 38.205875000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.207125000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.754125 41.0 40.0 41.0 37.0 41.0 16-17 39.75175 41.0 40.0 41.0 37.0 41.0 18-19 39.7505 41.0 40.0 41.0 37.5 41.0 20-21 39.641125 41.0 40.0 41.0 37.0 41.0 22-23 39.62925 41.0 40.0 41.0 37.0 41.0 24-25 39.613375 41.0 40.0 41.0 37.0 41.0 26-27 39.405 41.0 39.0 41.0 37.0 41.0 28-29 39.364875 41.0 39.0 41.0 37.0 41.0 30-31 39.343125 41.0 39.0 41.0 36.5 41.0 32-33 39.22225 41.0 39.0 41.0 36.0 41.0 34-35 38.895624999999995 40.0 38.5 41.0 35.5 41.0 36-37 38.75775 40.0 38.0 41.0 34.5 41.0 38-39 38.715875 40.0 38.0 41.0 35.0 41.0 40-41 38.750375000000005 40.0 38.0 41.0 35.0 41.0 42-43 38.646875 40.0 38.0 41.0 35.0 41.0 44-45 38.413 40.0 38.0 41.0 34.0 41.0 46-47 38.29775 40.0 38.0 41.0 34.0 41.0 48-49 38.104749999999996 40.0 38.0 41.0 33.0 41.0 50-51 37.975375 40.0 38.0 41.0 33.0 41.0 52-53 37.828125 40.0 37.5 41.0 33.0 41.0 54-55 38.030375 40.0 37.5 41.0 33.5 41.0 56-57 38.299 40.0 38.0 41.0 34.0 41.0 58-59 38.156875 40.0 37.5 41.0 34.0 41.0 60-61 37.815125 40.0 37.0 41.0 33.0 41.0 62-63 37.582499999999996 39.5 36.5 41.0 33.0 41.0 64-65 37.244749999999996 39.0 36.0 41.0 32.5 41.0 66-67 36.999125 39.0 35.5 40.5 32.0 41.0 68-69 36.626000000000005 38.0 35.0 40.0 32.0 41.0 70-71 36.16137500000001 37.0 35.0 39.5 32.0 41.0 72-73 35.641375 37.0 35.0 39.0 31.0 41.0 74-75 35.156000000000006 36.0 35.0 39.0 30.5 40.0 76-77 33.960375 35.0 33.5 37.0 29.5 39.0 78-79 34.253125 35.0 34.0 37.0 30.0 39.0 80-81 34.054625 35.0 34.0 37.0 30.0 38.5 82-83 33.799625000000006 35.0 34.0 36.0 30.0 37.0 84-85 33.491375000000005 35.0 34.0 36.0 30.0 37.0 86-87 33.155874999999995 35.0 34.0 35.5 29.0 36.5 88-89 32.976124999999996 35.0 34.0 35.0 29.0 36.0 90-91 32.71175 35.0 34.0 35.0 29.0 36.0 92-93 32.494625 35.0 34.0 35.0 29.0 36.0 94-95 32.41525 35.0 34.0 35.0 29.0 35.5 96-97 32.113749999999996 35.0 33.0 35.0 28.0 35.0 98-99 31.764 35.0 33.0 35.0 26.5 35.0 100 31.528 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 5.0 14 3.0 15 5.0 16 6.0 17 1.0 18 5.0 19 2.0 20 9.0 21 4.0 22 12.0 23 14.0 24 17.0 25 15.0 26 14.0 27 22.0 28 25.0 29 39.0 30 44.0 31 55.0 32 79.0 33 113.0 34 132.0 35 210.0 36 407.0 37 952.0 38 1444.0 39 359.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.80438184663537 15.62336984872196 19.092331768388107 40.479916536254564 2 19.950000000000003 24.224999999999998 36.0 19.825 3 23.175 26.974999999999998 26.650000000000002 23.200000000000003 4 24.8 32.85 18.625 23.724999999999998 5 24.0180135101326 36.47735801851388 21.766324743557668 17.738303727795845 6 18.425 38.85 24.2 18.525 7 18.099999999999998 18.525 42.775 20.599999999999998 8 19.425 24.474999999999998 28.65 27.450000000000003 9 19.875 23.9 30.65 25.575 10-11 21.762500000000003 34.949999999999996 22.0875 21.2 12-13 19.475 27.5625 29.5875 23.375 14-15 21.425 28.475 28.3625 21.7375 16-17 21.175 29.299999999999997 27.1625 22.3625 18-19 21.3 27.5625 29.512500000000003 21.625 20-21 22.0125 28.6125 28.025 21.349999999999998 22-23 21.987499999999997 28.975 27.0625 21.975 24-25 20.9875 29.875 27.1125 22.025 26-27 21.55 28.025 28.8625 21.5625 28-29 21.4 28.9375 28.375 21.2875 30-31 21.1125 28.5875 27.962500000000002 22.3375 32-33 21.6875 29.475 27.775 21.0625 34-35 21.3625 29.212500000000002 27.3 22.125 36-37 21.8625 28.7 28.249999999999996 21.1875 38-39 21.337500000000002 28.9875 28.625 21.05 40-41 21.625 29.6375 27.224999999999998 21.512500000000003 42-43 20.95 28.3875 28.599999999999998 22.0625 44-45 21.725 28.9875 27.8375 21.45 46-47 21.025 29.1125 28.000000000000004 21.8625 48-49 20.5125 29.6375 27.787499999999998 22.0625 50-51 22.05 28.15 28.799999999999997 21.0 52-53 21.587500000000002 28.8375 27.487499999999997 22.0875 54-55 20.25 28.8625 28.787499999999998 22.1 56-57 22.275 28.1375 28.375 21.212500000000002 58-59 20.549999999999997 28.475 28.5625 22.412499999999998 60-61 21.075 28.012500000000003 28.0875 22.825 62-63 21.0125 28.512500000000003 28.537499999999998 21.9375 64-65 21.575 28.15 27.5125 22.7625 66-67 21.0 29.15 27.762500000000003 22.0875 68-69 21.55 28.675 28.5625 21.212500000000002 70-71 22.162499999999998 29.037499999999998 27.3875 21.4125 72-73 21.987499999999997 27.6625 28.3625 21.987499999999997 74-75 21.3125 28.599999999999998 28.3375 21.75 76-77 22.112499999999997 27.8625 28.449999999999996 21.575 78-79 21.575 28.975 27.6625 21.7875 80-81 21.425 28.1875 29.037499999999998 21.349999999999998 82-83 21.65 27.8375 28.537499999999998 21.975 84-85 22.025 28.225 28.5875 21.1625 86-87 21.4875 28.000000000000004 28.762500000000003 21.75 88-89 22.0125 28.425 27.325 22.237499999999997 90-91 21.775 28.812500000000004 27.700000000000003 21.712500000000002 92-93 21.575 28.037499999999998 28.462500000000002 21.925 94-95 21.55 27.6875 28.9875 21.775 96-97 21.95 28.375 28.262500000000003 21.4125 98-99 22.15 28.199999999999996 28.212500000000002 21.4375 100 21.975 28.125 28.225 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 1.5 23 2.5 24 2.0 25 4.0 26 3.5 27 7.0 28 14.5 29 17.0 30 26.5 31 35.5 32 38.0 33 58.5 34 77.0 35 90.0 36 99.5 37 122.0 38 162.0 39 191.0 40 202.5 41 208.0 42 241.0 43 274.0 44 282.0 45 265.0 46 232.5 47 217.0 48 223.0 49 197.5 50 147.0 51 113.5 52 92.5 53 84.5 54 65.0 55 45.0 56 32.5 57 22.0 58 24.5 59 17.0 60 11.0 61 12.5 62 9.0 63 6.5 64 4.5 65 3.5 66 3.0 67 1.5 68 2.0 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270642 spots for SRR12145825.sra Written 1270642 spots for SRR12145825.sra Read 1270650 spots for SRR12145825.sra Written 1270650 spots for SRR12145825.sra SRR ids: ['SRR12145825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nen_ak6n SRR12145825.sra spots: 25412848 blocks: [[1, 1270642], [1270643, 2541284], [2541285, 3811926], [3811927, 5082568], [5082569, 6353210], [6353211, 7623852], [7623853, 8894494], [8894495, 10165136], [10165137, 11435778], [11435779, 12706420], [12706421, 13977062], [13977063, 15247704], [15247705, 16518346], [16518347, 17788988], [17788989, 19059630], [19059631, 20330272], [20330273, 21600914], [21600915, 22871556], [22871557, 24142198], [24142199, 25412848]] SRR12145825 file size 6627257 SRR12145825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12145825 SRR12145825_1.fastq Input file: SRR12145825_1.fastq trimmed: SRR12145825-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:44:48 2025 >> started Thu Feb 13 15:45:00 2025 >> done (11.881s) 25412848 reads processed; of these: 4586 ( 0.02%) short reads filtered out after trimming by size control 22304 ( 0.09%) empty reads filtered out after trimming by size control 25385958 (99.89%) reads available; of these: 1427325 ( 5.62%) trimmed reads available after processing 23958633 (94.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 601 0.00% 19 698 0.00% 20 940 0.00% 21 1005 0.00% 22 1400 0.01% 23 1874 0.01% 24 2430 0.01% 25 3084 0.01% 26 3297 0.01% 27 3213 0.01% 28 3234 0.01% 29 3458 0.01% 30 3448 0.01% 31 3298 0.01% 32 3790 0.01% 33 3815 0.02% 34 4371 0.02% 35 5858 0.02% 36 4457 0.02% 37 4515 0.02% 38 4718 0.02% 39 4918 0.02% 40 5024 0.02% 41 5169 0.02% 42 5675 0.02% 43 5858 0.02% 44 6361 0.03% 45 6504 0.03% 46 6384 0.03% 47 6500 0.03% 48 6725 0.03% 49 6749 0.03% 50 6839 0.03% 51 6949 0.03% 52 6826 0.03% 53 7304 0.03% 54 6975 0.03% 55 7057 0.03% 56 7266 0.03% 57 7804 0.03% 58 8063 0.03% 59 8487 0.03% 60 9165 0.04% 61 9129 0.04% 62 9329 0.04% 63 9478 0.04% 64 9947 0.04% 65 10204 0.04% 66 10574 0.04% 67 11045 0.04% 68 11711 0.05% 69 11719 0.05% 70 12010 0.05% 71 12614 0.05% 72 13268 0.05% 73 13888 0.05% 74 14600 0.06% 75 14745 0.06% 76 10248 0.04% 77 11602 0.05% 78 13055 0.05% 79 14144 0.06% 80 15591 0.06% 81 16371 0.06% 82 17547 0.07% 83 19243 0.08% 84 20836 0.08% 85 21414 0.08% 86 23060 0.09% 87 24909 0.10% 88 26509 0.10% 89 29525 0.12% 90 32770 0.13% 91 37613 0.15% 92 42725 0.17% 93 50378 0.20% 94 60247 0.24% 95 70704 0.28% 96 87364 0.34% 97 106548 0.42% 98 129790 0.51% 99 158765 0.63% 100 23958633 94.38% 25385958 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=13 prefix-density=0.28 prefix-fanout=2.9 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCAC criterion=fanout-score sequence-density=0.22 sequence-density-rank=3 fanout-score=41.99 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=31.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCT Started job on | Feb 13 15:45:19 Started mapping on | Feb 13 15:45:19 Finished on | Feb 13 15:45:43 Mapping speed, Million of reads per hour | 3807.89 Number of input reads | 25385958 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 24485265 Uniquely mapped reads % | 96.45% Average mapped length | 98.72 Number of splices: Total | 6298306 Number of splices: Annotated (sjdb) | 6176856 Number of splices: GT/AG | 6202627 Number of splices: GC/AG | 76276 Number of splices: AT/AC | 7229 Number of splices: Non-canonical | 12174 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595718 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 112153 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 304975 304975 304975 N_multimapping 595718 595718 595718 N_noFeature 962296 12554305 12606528 N_ambiguous 367332 40015 41099 UnstrandedReadsAssigned:23155637 PositiveStrandReadsAssigned:11890945 NegativeStrandReadsAssigned:11837638 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR12145825 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12145825-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,385,958 reads, 23,798,820 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR12145825.ke.tsv 34699 SRR12145825.se.tsv 87100 total ==> SRR12145825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 578 16.9316 Potri.005G024800.1.v4.1 1035 936 109 6.54631 Potri.004G059700.1.v4.1 961 862 182 11.8689 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 365.431 7.22306 Potri.016G087400.1.v4.1 270 171 843 277.126 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 41 1.37681 Potri.012G127500.1.v4.1 977 878 1129 72.2845 ==> SRR12145825.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3550 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 597 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 242 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12145825 completed mapping pipeline successfully