Starting /dee2/code/volunteer_pipeline.sh SRR12161357 current disk space = 3088790212608 free memory = 1455405692 SRR12161357 SRAfilesize bd6c11697fc0e6878fa91d4b3fdf08cc SRR12161357.sra SRR12161357.sra file validated SRR12161357 is paired end SRR12161357 is conventional basespace SRR12161357 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5225 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.5145 37.0 37.0 37.0 37.0 37.0 4 36.5405 37.0 37.0 37.0 37.0 37.0 5 36.5475 37.0 37.0 37.0 37.0 37.0 6 36.507 37.0 37.0 37.0 37.0 37.0 7 36.456 37.0 37.0 37.0 37.0 37.0 8 36.5875 37.0 37.0 37.0 37.0 37.0 9 36.496 37.0 37.0 37.0 37.0 37.0 10-14 36.5667 37.0 37.0 37.0 37.0 37.0 15-19 36.5708 37.0 37.0 37.0 37.0 37.0 20-24 36.521499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.469100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.431200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4116 37.0 37.0 37.0 37.0 37.0 40-44 36.4323 37.0 37.0 37.0 37.0 37.0 45-49 36.3932 37.0 37.0 37.0 37.0 37.0 50-54 36.3333 37.0 37.0 37.0 37.0 37.0 55-59 36.365899999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3729 37.0 37.0 37.0 37.0 37.0 65-69 36.317899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2998 37.0 37.0 37.0 37.0 37.0 75-79 36.2692 37.0 37.0 37.0 37.0 37.0 80-84 36.3051 37.0 37.0 37.0 37.0 37.0 85-89 36.2347 37.0 37.0 37.0 37.0 37.0 90-94 36.267399999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1911 37.0 37.0 37.0 37.0 37.0 100-104 36.2116 37.0 37.0 37.0 37.0 37.0 105-109 36.1605 37.0 37.0 37.0 37.0 37.0 110-114 36.183 37.0 37.0 37.0 37.0 37.0 115-119 36.15169999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.1194 37.0 37.0 37.0 37.0 37.0 125-129 36.0809 37.0 37.0 37.0 37.0 37.0 130-134 36.0743 37.0 37.0 37.0 37.0 37.0 135-139 35.9551 37.0 37.0 37.0 37.0 37.0 140-144 35.9332 37.0 37.0 37.0 37.0 37.0 145-149 35.9168 37.0 37.0 37.0 37.0 37.0 150-151 35.641000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 3.0 26 5.0 27 11.0 28 8.0 29 24.0 30 21.0 31 27.0 32 61.0 33 69.0 34 116.0 35 278.0 36 2943.0 37 431.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.272136068034015 12.206103051525762 5.6278139069534765 37.89394697348674 2 19.075 13.025 33.324999999999996 34.575 3 17.25 15.299999999999999 28.425 39.025 4 21.825 23.974999999999998 24.65 29.549999999999997 5 23.075000000000003 30.175 23.95 22.8 6 21.275 33.900000000000006 22.875 21.95 7 14.299999999999999 27.575 40.400000000000006 17.724999999999998 8 18.275 27.0 29.675 25.05 9 16.525000000000002 24.175 35.375 23.925 10-14 19.759999999999998 29.520000000000003 27.42 23.3 15-19 19.994999999999997 27.800000000000004 27.779999999999998 24.425 20-24 19.89 28.395 27.775 23.94 25-29 20.325 27.855 27.73 24.09 30-34 20.064999999999998 27.900000000000002 27.99 24.044999999999998 35-39 20.415 27.834999999999997 27.97 23.78 40-44 20.03 27.884999999999998 28.28 23.805 45-49 20.685000000000002 28.005000000000003 27.255000000000003 24.055 50-54 20.65 27.87 27.665 23.815 55-59 20.04 27.915 27.99 24.055 60-64 20.5 27.875 27.744999999999997 23.880000000000003 65-69 20.445 28.055000000000003 27.375 24.125 70-74 20.265 28.29 27.32 24.125 75-79 19.965 28.249999999999996 27.139999999999997 24.645 80-84 19.875 28.305000000000003 27.785 24.035 85-89 20.385 28.395 27.860000000000003 23.36 90-94 20.225 28.595 27.279999999999998 23.9 95-99 20.810000000000002 27.560000000000002 27.145000000000003 24.485 100-104 20.355 28.660000000000004 27.655 23.330000000000002 105-109 20.89 27.805000000000003 27.365000000000002 23.94 110-114 20.575 28.194999999999997 27.55 23.68 115-119 20.4 27.925 27.74 23.935000000000002 120-124 20.495 27.474999999999998 27.605 24.425 125-129 20.57 27.205000000000002 28.485 23.74 130-134 20.830000000000002 27.175 27.810000000000002 24.185000000000002 135-139 21.365000000000002 27.38 27.805000000000003 23.45 140-144 21.125 27.750000000000004 27.375 23.75 145-149 20.919999999999998 27.994999999999997 26.68 24.404999999999998 150-151 21.2 28.225 27.450000000000003 23.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 1.5 9 1.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 3.5 25 5.5 26 7.5 27 7.0 28 8.5 29 11.5 30 16.0 31 23.0 32 28.5 33 44.0 34 63.5 35 68.5 36 79.5 37 93.5 38 116.0 39 149.0 40 163.0 41 185.5 42 208.0 43 227.5 44 254.5 45 257.5 46 245.5 47 245.0 48 245.5 49 234.0 50 209.5 51 176.0 52 128.0 53 98.0 54 90.5 55 75.5 56 60.0 57 43.0 58 29.0 59 21.0 60 18.5 61 15.0 62 12.5 63 7.5 64 3.0 65 4.0 66 3.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 94.50928381962865 89.075 2 4.960212201591512 9.35 3 0.4509283819628647 1.275 4 0.07957559681697612 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.2374999999999998 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCATGT 10 0.006830828 145.0 3 >>END_MODULE SRR12161357 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161357_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.214 37.0 37.0 37.0 37.0 37.0 2 35.947 37.0 37.0 37.0 37.0 37.0 3 35.9395 37.0 37.0 37.0 37.0 37.0 4 36.0455 37.0 37.0 37.0 37.0 37.0 5 36.208 37.0 37.0 37.0 37.0 37.0 6 36.2215 37.0 37.0 37.0 37.0 37.0 7 36.1015 37.0 37.0 37.0 37.0 37.0 8 36.1705 37.0 37.0 37.0 37.0 37.0 9 36.122 37.0 37.0 37.0 37.0 37.0 10-14 36.0982 37.0 37.0 37.0 37.0 37.0 15-19 36.1421 37.0 37.0 37.0 37.0 37.0 20-24 36.056 37.0 37.0 37.0 37.0 37.0 25-29 36.002 37.0 37.0 37.0 37.0 37.0 30-34 36.039100000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.9602 37.0 37.0 37.0 37.0 37.0 40-44 36.0158 37.0 37.0 37.0 37.0 37.0 45-49 35.894 37.0 37.0 37.0 37.0 37.0 50-54 35.9218 37.0 37.0 37.0 37.0 37.0 55-59 35.8449 37.0 37.0 37.0 37.0 37.0 60-64 35.830999999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.8648 37.0 37.0 37.0 37.0 37.0 70-74 35.7447 37.0 37.0 37.0 37.0 37.0 75-79 35.7233 37.0 37.0 37.0 37.0 37.0 80-84 35.812799999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.727 37.0 37.0 37.0 37.0 37.0 90-94 35.648999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.7024 37.0 37.0 37.0 37.0 37.0 100-104 35.763 37.0 37.0 37.0 37.0 37.0 105-109 35.685199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5972 37.0 37.0 37.0 37.0 37.0 115-119 35.6476 37.0 37.0 37.0 37.0 37.0 120-124 35.519000000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4966 37.0 37.0 37.0 37.0 37.0 130-134 35.376 37.0 37.0 37.0 34.6 37.0 135-139 35.451800000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.381600000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.441700000000004 37.0 37.0 37.0 37.0 37.0 150-151 34.692 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 5.0 16 1.0 17 1.0 18 0.0 19 1.0 20 4.0 21 2.0 22 6.0 23 9.0 24 6.0 25 5.0 26 9.0 27 19.0 28 25.0 29 22.0 30 25.0 31 41.0 32 60.0 33 101.0 34 212.0 35 602.0 36 2635.0 37 201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.5 25.324999999999996 9.325 24.85 2 27.750000000000004 27.325 28.599999999999998 16.325 3 20.125 28.349999999999998 32.324999999999996 19.2 4 23.849999999999998 34.175 22.975 19.0 5 25.3 36.275 20.325 18.099999999999998 6 21.175 39.725 21.0 18.099999999999998 7 20.9 21.925 38.65 18.525 8 22.15 25.35 26.8 25.7 9 22.475 24.825 29.525000000000002 23.175 10-14 23.265 29.125 26.405 21.205 15-19 23.195 28.405 27.089999999999996 21.310000000000002 20-24 22.985 28.744999999999997 27.439999999999998 20.830000000000002 25-29 23.14 29.354999999999997 26.775 20.73 30-34 22.975 27.884999999999998 28.07 21.07 35-39 22.884999999999998 27.925 27.900000000000002 21.29 40-44 22.805 28.360000000000003 27.500000000000004 21.335 45-49 22.720000000000002 28.139999999999997 27.425 21.715 50-54 23.02 28.060000000000002 27.395000000000003 21.525 55-59 23.06 28.055000000000003 27.29 21.595 60-64 22.99 28.349999999999998 27.16 21.5 65-69 22.770000000000003 28.325 27.33 21.575 70-74 23.78 28.060000000000002 27.034999999999997 21.125 75-79 23.305 27.529999999999998 26.950000000000003 22.215 80-84 22.95 28.299999999999997 26.915 21.834999999999997 85-89 23.28 28.7 26.875 21.145 90-94 23.945 28.325 26.915 20.815 95-99 23.419999999999998 27.96 27.474999999999998 21.145 100-104 24.075 28.12 26.895000000000003 20.91 105-109 23.200000000000003 27.98 27.395000000000003 21.425 110-114 23.580000000000002 28.355000000000004 27.615000000000002 20.45 115-119 23.935000000000002 27.68 27.08 21.305 120-124 23.45 28.21 27.560000000000002 20.78 125-129 24.085 28.275 26.99 20.65 130-134 24.02 28.044999999999998 27.224999999999998 20.71 135-139 24.185000000000002 27.47 27.505000000000003 20.84 140-144 23.95 27.715 27.994999999999997 20.34 145-149 24.36 27.87 27.515 20.255000000000003 150-151 24.712500000000002 28.262500000000003 26.237500000000004 20.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.5 13 1.5 14 0.5 15 1.5 16 1.5 17 0.5 18 0.0 19 1.5 20 2.5 21 3.0 22 2.0 23 1.0 24 1.5 25 3.0 26 3.5 27 5.5 28 9.5 29 9.0 30 11.0 31 17.5 32 27.5 33 38.5 34 48.0 35 62.5 36 83.0 37 108.5 38 128.5 39 145.5 40 192.5 41 221.0 42 252.0 43 283.5 44 273.5 45 254.0 46 239.5 47 237.0 48 214.0 49 185.0 50 160.0 51 144.0 52 131.0 53 105.0 54 95.5 55 76.0 56 52.5 57 41.0 58 28.5 59 25.5 60 18.5 61 11.5 62 9.0 63 6.5 64 3.5 65 2.0 66 0.5 67 1.5 68 2.0 69 0.5 70 0.0 71 0.5 72 1.5 73 1.0 74 0.5 75 1.0 76 1.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.51364961569043 89.14999999999999 2 5.062284654121388 9.55 3 0.34455340577789556 0.975 4 0.05300821627352239 0.2 5 0.026504108136761195 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.2000000000000002 0.0 0.0 0.0 0.0 128-129 1.2625000000000002 0.0 0.0 0.0 0.0 130-131 1.425 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTGA 10 0.006830828 145.0 5 TTCCTGC 10 0.006830828 145.0 9 ACTGGAC 10 0.006830828 145.0 1 GTAGTCA 10 0.006830828 145.0 145 >>END_MODULE Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626508 spots for SRR12161357.sra Written 1626508 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra Read 1626489 spots for SRR12161357.sra Written 1626489 spots for SRR12161357.sra SRR ids: ['SRR12161357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kwu6wpca SRR12161357.sra spots: 32529799 blocks: [[1, 1626489], [1626490, 3252978], [3252979, 4879467], [4879468, 6505956], [6505957, 8132445], [8132446, 9758934], [9758935, 11385423], [11385424, 13011912], [13011913, 14638401], [14638402, 16264890], [16264891, 17891379], [17891380, 19517868], [19517869, 21144357], [21144358, 22770846], [22770847, 24397335], [24397336, 26023824], [26023825, 27650313], [27650314, 29276802], [29276803, 30903291], [30903292, 32529799]] SRR12161357 file size 11033348 SRR12161357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161357 SRR12161357_1.fastq SRR12161357_2.fastq Input file: SRR12161357_1.fastq Paired file: SRR12161357_2.fastq trimmed: SRR12161357-trimmed-pair1.fastq, SRR12161357-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:44:46 2025 >> started Thu Feb 13 15:45:22 2025 >> done (36.387s) 32529799 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 7688 ( 0.02%) empty read pairs filtered out after trimming by size control 32522079 (99.98%) read pairs available; of these: 1382453 ( 4.25%) trimmed read pairs available after processing 31139626 (95.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 8 0.00% 22 12 0.00% 23 9 0.00% 24 15 0.00% 25 13 0.00% 26 17 0.00% 27 10 0.00% 28 15 0.00% 29 22 0.00% 30 12 0.00% 31 21 0.00% 32 17 0.00% 33 20 0.00% 34 22 0.00% 35 23 0.00% 36 15 0.00% 37 17 0.00% 38 16 0.00% 39 29 0.00% 40 18 0.00% 41 21 0.00% 42 16 0.00% 43 24 0.00% 44 34 0.00% 45 20 0.00% 46 33 0.00% 47 31 0.00% 48 21 0.00% 49 49 0.00% 50 31 0.00% 51 69 0.00% 52 45 0.00% 53 64 0.00% 54 52 0.00% 55 61 0.00% 56 78 0.00% 57 86 0.00% 58 94 0.00% 59 85 0.00% 60 112 0.00% 61 136 0.00% 62 140 0.00% 63 175 0.00% 64 166 0.00% 65 166 0.00% 66 194 0.00% 67 190 0.00% 68 238 0.00% 69 280 0.00% 70 309 0.00% 71 388 0.00% 72 366 0.00% 73 470 0.00% 74 495 0.00% 75 542 0.00% 76 607 0.00% 77 661 0.00% 78 832 0.00% 79 798 0.00% 80 946 0.00% 81 1172 0.00% 82 1235 0.00% 83 1401 0.00% 84 1413 0.00% 85 1719 0.01% 86 1844 0.01% 87 1995 0.01% 88 2353 0.01% 89 2556 0.01% 90 2768 0.01% 91 3003 0.01% 92 3286 0.01% 93 3604 0.01% 94 4030 0.01% 95 4423 0.01% 96 4604 0.01% 97 5071 0.02% 98 5292 0.02% 99 5778 0.02% 100 6081 0.02% 101 6520 0.02% 102 7221 0.02% 103 7443 0.02% 104 8334 0.03% 105 8541 0.03% 106 9092 0.03% 107 9632 0.03% 108 9940 0.03% 109 10597 0.03% 110 11196 0.03% 111 11724 0.04% 112 12577 0.04% 113 12927 0.04% 114 13853 0.04% 115 14708 0.05% 116 15184 0.05% 117 15968 0.05% 118 16824 0.05% 119 17325 0.05% 120 18732 0.06% 121 19222 0.06% 122 19989 0.06% 123 21398 0.07% 124 22026 0.07% 125 22885 0.07% 126 23948 0.07% 127 24759 0.08% 128 25827 0.08% 129 26638 0.08% 130 28085 0.09% 131 29215 0.09% 132 30312 0.09% 133 31541 0.10% 134 32724 0.10% 135 33842 0.10% 136 35262 0.11% 137 36031 0.11% 138 37843 0.12% 139 39583 0.12% 140 40397 0.12% 141 42112 0.13% 142 43646 0.13% 143 45051 0.14% 144 47153 0.14% 145 48222 0.15% 146 49617 0.15% 147 50905 0.16% 148 53062 0.16% 149 53367 0.16% 150 56357 0.17% 151 31139626 95.75% 32522079 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.76 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=10.95 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.3 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=0.96 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=22.98 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.4 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTC SRR12161357 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:46:09 Started mapping on | Feb 13 15:46:09 Finished on | Feb 13 15:49:52 Mapping speed, Million of reads per hour | 525.02 Number of input reads | 32522079 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30500121 Uniquely mapped reads % | 93.78% Average mapped length | 299.02 Number of splices: Total | 32438591 Number of splices: Annotated (sjdb) | 31788295 Number of splices: GT/AG | 31742327 Number of splices: GC/AG | 588801 Number of splices: AT/AC | 19128 Number of splices: Non-canonical | 88335 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 832410 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 229249 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.71% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1189548 1189548 1189548 N_multimapping 832410 832410 832410 N_noFeature 1075913 30083652 1181224 N_ambiguous 523269 1724 211233 UnstrandedReadsAssigned:28900939 PositiveStrandReadsAssigned:414745 NegativeStrandReadsAssigned:29107664 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161357 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161357-trimmed-pair1.fastq SRR12161357-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,522,079 reads, 29,252,217 reads pseudoaligned [quant] estimated average fragment length: 276.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR12161357.ke.tsv 34699 SRR12161357.se.tsv 87100 total ==> SRR12161357.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.03 779 11.7689 Potri.005G024800.1.v4.1 1035 759.034 587 20.3531 Potri.004G059700.1.v4.1 961 685.255 24 0.921748 Potri.007G009000.2.v4.1 1416 1140.03 0 0 Potri.003G141000.2.v4.1 2943 2667.03 1341.56 13.2384 Potri.016G087400.1.v4.1 270 67.8473 1064.77 413.025 Potri.015G069301.1.v4.1 564 302.144 0 0 Potri.010G195200.1.v4.1 1773 1497.03 50 0.879006 Potri.012G127500.1.v4.1 977 701.154 309 11.5984 ==> SRR12161357.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 240 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 403 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR12161357 completed mapping pipeline successfully