Starting /dee2/code/volunteer_pipeline.sh SRR12161358 current disk space = 3088797687808 free memory = 1443918604 SRR12161358 SRAfilesize ae89295ff5900d8933e38e57b2db3759 SRR12161358.sra SRR12161358.sra file validated SRR12161358 is paired end SRR12161358 is conventional basespace SRR12161358 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.635 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.538 37.0 37.0 37.0 37.0 37.0 4 36.526 37.0 37.0 37.0 37.0 37.0 5 36.63 37.0 37.0 37.0 37.0 37.0 6 36.593 37.0 37.0 37.0 37.0 37.0 7 36.4605 37.0 37.0 37.0 37.0 37.0 8 36.5645 37.0 37.0 37.0 37.0 37.0 9 36.513 37.0 37.0 37.0 37.0 37.0 10-14 36.5556 37.0 37.0 37.0 37.0 37.0 15-19 36.5077 37.0 37.0 37.0 37.0 37.0 20-24 36.5379 37.0 37.0 37.0 37.0 37.0 25-29 36.462 37.0 37.0 37.0 37.0 37.0 30-34 36.4747 37.0 37.0 37.0 37.0 37.0 35-39 36.4665 37.0 37.0 37.0 37.0 37.0 40-44 36.394600000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4254 37.0 37.0 37.0 37.0 37.0 50-54 36.3137 37.0 37.0 37.0 37.0 37.0 55-59 36.373 37.0 37.0 37.0 37.0 37.0 60-64 36.3943 37.0 37.0 37.0 37.0 37.0 65-69 36.3143 37.0 37.0 37.0 37.0 37.0 70-74 36.3428 37.0 37.0 37.0 37.0 37.0 75-79 36.313900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2688 37.0 37.0 37.0 37.0 37.0 85-89 36.2628 37.0 37.0 37.0 37.0 37.0 90-94 36.2762 37.0 37.0 37.0 37.0 37.0 95-99 36.21660000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2178 37.0 37.0 37.0 37.0 37.0 105-109 36.1528 37.0 37.0 37.0 37.0 37.0 110-114 36.1636 37.0 37.0 37.0 37.0 37.0 115-119 36.1177 37.0 37.0 37.0 37.0 37.0 120-124 36.1212 37.0 37.0 37.0 37.0 37.0 125-129 36.0643 37.0 37.0 37.0 37.0 37.0 130-134 36.0874 37.0 37.0 37.0 37.0 37.0 135-139 36.019400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.96319999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.894600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.7145 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 3.0 25 3.0 26 4.0 27 1.0 28 15.0 29 15.0 30 26.0 31 35.0 32 46.0 33 77.0 34 114.0 35 289.0 36 2941.0 37 428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.625 12.1 5.5 36.775000000000006 2 20.1 12.475 34.1 33.324999999999996 3 17.05 17.2 27.925 37.824999999999996 4 20.9 24.325 25.4 29.375 5 23.075000000000003 29.925 24.525 22.475 6 20.3 33.900000000000006 23.674999999999997 22.125 7 15.5 27.250000000000004 41.025 16.225 8 17.724999999999998 25.324999999999996 32.125 24.825 9 17.5 25.424999999999997 33.324999999999996 23.75 10-14 19.685 30.06 27.284999999999997 22.97 15-19 19.64 28.675 27.055 24.63 20-24 20.06 28.13 27.76 24.05 25-29 20.24 28.4 27.245 24.115000000000002 30-34 20.305 28.810000000000002 27.01 23.875 35-39 20.62 27.565 27.644999999999996 24.169999999999998 40-44 20.515 28.88 26.855 23.75 45-49 20.45 28.79 26.825 23.935000000000002 50-54 20.345 28.27 26.950000000000003 24.435000000000002 55-59 20.135 29.18 27.060000000000002 23.625 60-64 20.44 27.894999999999996 27.3 24.365000000000002 65-69 20.24 27.935 27.355 24.47 70-74 20.895 27.865000000000002 27.425 23.815 75-79 20.04 28.349999999999998 27.075 24.535 80-84 20.71 27.785 27.21 24.295 85-89 20.669999999999998 28.555000000000003 27.12 23.655 90-94 20.200000000000003 27.67 27.634999999999998 24.495 95-99 20.815 27.96 27.575 23.65 100-104 20.724999999999998 27.965 27.38 23.93 105-109 21.145 27.560000000000002 27.005000000000003 24.29 110-114 21.05 27.79 27.0 24.16 115-119 21.145 27.650000000000002 26.965 24.240000000000002 120-124 20.895 28.060000000000002 26.825 24.22 125-129 20.995 27.415 27.284999999999997 24.305 130-134 20.97 27.01 27.415 24.605 135-139 21.605 27.915 26.66 23.82 140-144 21.044999999999998 27.76 27.71 23.485 145-149 21.025 28.000000000000004 26.83 24.145 150-151 21.95 27.825 26.724999999999998 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 2.0 26 4.0 27 7.0 28 7.0 29 9.5 30 20.0 31 24.0 32 30.5 33 40.0 34 51.5 35 62.0 36 81.0 37 101.5 38 109.0 39 134.5 40 163.5 41 192.0 42 212.5 43 229.5 44 246.0 45 256.0 46 266.0 47 266.5 48 251.5 49 215.5 50 200.5 51 184.0 52 141.0 53 108.5 54 85.5 55 70.5 56 64.0 57 54.0 58 35.0 59 24.0 60 17.5 61 7.0 62 2.5 63 3.0 64 3.5 65 2.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9781508126832 88.175 2 5.568878230748734 10.45 3 0.3463895550226485 0.975 4 0.10658140154543032 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.487500000000001 0.0 0.0 0.0 0.0 130-131 4.8125 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCGT 10 0.006830828 145.0 7 AGAGCAC 40 0.005621335 54.375 145 >>END_MODULE SRR12161358 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161358_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.153 37.0 37.0 37.0 37.0 37.0 2 35.7755 37.0 37.0 37.0 37.0 37.0 3 35.889 37.0 37.0 37.0 37.0 37.0 4 35.8675 37.0 37.0 37.0 37.0 37.0 5 36.0535 37.0 37.0 37.0 37.0 37.0 6 36.0315 37.0 37.0 37.0 37.0 37.0 7 35.8985 37.0 37.0 37.0 37.0 37.0 8 35.96 37.0 37.0 37.0 37.0 37.0 9 36.005 37.0 37.0 37.0 37.0 37.0 10-14 36.056200000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.955 37.0 37.0 37.0 37.0 37.0 20-24 35.9641 37.0 37.0 37.0 37.0 37.0 25-29 35.8919 37.0 37.0 37.0 37.0 37.0 30-34 35.9199 37.0 37.0 37.0 37.0 37.0 35-39 35.8865 37.0 37.0 37.0 37.0 37.0 40-44 35.8286 37.0 37.0 37.0 37.0 37.0 45-49 35.8302 37.0 37.0 37.0 37.0 37.0 50-54 35.7984 37.0 37.0 37.0 37.0 37.0 55-59 35.7376 37.0 37.0 37.0 37.0 37.0 60-64 35.687200000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.7164 37.0 37.0 37.0 37.0 37.0 70-74 35.6333 37.0 37.0 37.0 37.0 37.0 75-79 35.6699 37.0 37.0 37.0 37.0 37.0 80-84 35.7193 37.0 37.0 37.0 37.0 37.0 85-89 35.628499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.5606 37.0 37.0 37.0 37.0 37.0 95-99 35.5394 37.0 37.0 37.0 37.0 37.0 100-104 35.568599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.50939999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.4491 37.0 37.0 37.0 37.0 37.0 115-119 35.461999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.524800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.338800000000006 37.0 37.0 37.0 34.6 37.0 130-134 35.1617 37.0 37.0 37.0 25.0 37.0 135-139 35.2531 37.0 37.0 37.0 34.6 37.0 140-144 35.1715 37.0 37.0 37.0 27.4 37.0 145-149 35.1284 37.0 37.0 37.0 25.0 37.0 150-151 34.50375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 6.0 15 4.0 16 8.0 17 0.0 18 1.0 19 2.0 20 4.0 21 6.0 22 5.0 23 7.0 24 8.0 25 10.0 26 9.0 27 21.0 28 13.0 29 28.0 30 32.0 31 36.0 32 81.0 33 141.0 34 244.0 35 613.0 36 2499.0 37 219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.625 25.85 8.649999999999999 23.875 2 28.075 26.325 29.599999999999998 16.0 3 20.9 27.625 31.624999999999996 19.85 4 23.225 34.4 22.95 19.425 5 25.174999999999997 36.475 21.625 16.725 6 20.674999999999997 39.0 21.7 18.625 7 21.099999999999998 22.3 36.925000000000004 19.675 8 22.225 26.8 26.724999999999998 24.25 9 21.55 24.9 29.799999999999997 23.75 10-14 23.91 28.999999999999996 25.974999999999998 21.115000000000002 15-19 22.6 28.799999999999997 27.435 21.165 20-24 23.195 28.845 27.275 20.685000000000002 25-29 23.31 28.76 26.790000000000003 21.14 30-34 23.32 28.444999999999997 27.36 20.875 35-39 22.725 28.610000000000003 27.66 21.005 40-44 22.97 28.265 27.200000000000003 21.565 45-49 22.89 28.294999999999998 27.584999999999997 21.23 50-54 23.655 27.785 26.765 21.795 55-59 22.665 27.860000000000003 27.52 21.955 60-64 23.84 28.005000000000003 27.025 21.13 65-69 23.580000000000002 27.3 27.73 21.39 70-74 23.385 27.529999999999998 27.145000000000003 21.94 75-79 23.18 27.900000000000002 27.07 21.85 80-84 23.105 28.07 26.779999999999998 22.045 85-89 23.599999999999998 27.215 27.16 22.025 90-94 24.445 26.924999999999997 27.36 21.27 95-99 24.12 27.694999999999997 27.11 21.075 100-104 24.349999999999998 28.310000000000002 26.605 20.735 105-109 24.3 27.384999999999998 26.810000000000002 21.505 110-114 24.545 27.015 27.634999999999998 20.805 115-119 24.474999999999998 28.57 26.765 20.19 120-124 24.985 27.944999999999997 27.175 19.895 125-129 24.38 28.315 26.83 20.474999999999998 130-134 24.91 28.29 26.119999999999997 20.68 135-139 24.93 27.85 26.965 20.255000000000003 140-144 25.2 27.46 26.765 20.575 145-149 26.009999999999998 27.634999999999998 26.465 19.89 150-151 26.387500000000003 28.249999999999996 26.4625 18.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 1.5 20 2.5 21 2.5 22 1.5 23 1.0 24 4.0 25 5.0 26 6.0 27 5.5 28 8.0 29 14.0 30 15.5 31 21.0 32 29.0 33 31.5 34 34.5 35 53.5 36 75.5 37 89.5 38 112.5 39 147.5 40 169.5 41 190.0 42 236.5 43 264.0 44 265.0 45 275.0 46 271.0 47 258.5 48 246.0 49 210.0 50 169.0 51 147.0 52 130.0 53 106.5 54 90.5 55 81.0 56 64.0 57 41.5 58 28.0 59 22.5 60 12.5 61 6.5 62 8.0 63 6.5 64 4.0 65 2.0 66 1.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.5 95 1.5 96 1.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.89292440139899 87.25 2 5.380683346785042 10.0 3 0.43045466774280333 1.2 4 0.10761366693570083 0.4 5 0.053806833467850416 0.25 6 0.053806833467850416 0.3 7 0.026903416733925208 0.17500000000000002 8 0.026903416733925208 0.2 9 0.026903416733925208 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit AGGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit GGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 4.0125 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 5.175000000000001 0.0 0.0 0.0 0.0 134-135 5.612500000000001 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798484 spots for SRR12161358.sra Written 798484 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra Read 798467 spots for SRR12161358.sra Written 798467 spots for SRR12161358.sra SRR ids: ['SRR12161358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6pbwse6n SRR12161358.sra spots: 15969357 blocks: [[1, 798467], [798468, 1596934], [1596935, 2395401], [2395402, 3193868], [3193869, 3992335], [3992336, 4790802], [4790803, 5589269], [5589270, 6387736], [6387737, 7186203], [7186204, 7984670], [7984671, 8783137], [8783138, 9581604], [9581605, 10380071], [10380072, 11178538], [11178539, 11977005], [11977006, 12775472], [12775473, 13573939], [13573940, 14372406], [14372407, 15170873], [15170874, 15969357]] SRR12161358 file size 5405385 SRR12161358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161358 SRR12161358_1.fastq SRR12161358_2.fastq Input file: SRR12161358_1.fastq Paired file: SRR12161358_2.fastq trimmed: SRR12161358-trimmed-pair1.fastq, SRR12161358-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:50:41 2025 >> started Thu Feb 13 15:50:58 2025 >> done (17.559s) 15969357 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 5148 ( 0.03%) empty read pairs filtered out after trimming by size control 15964179 (99.97%) read pairs available; of these: 1549971 ( 9.71%) trimmed read pairs available after processing 14414208 (90.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 6 0.00% 23 13 0.00% 24 9 0.00% 25 5 0.00% 26 14 0.00% 27 12 0.00% 28 13 0.00% 29 16 0.00% 30 13 0.00% 31 20 0.00% 32 12 0.00% 33 16 0.00% 34 12 0.00% 35 15 0.00% 36 18 0.00% 37 17 0.00% 38 19 0.00% 39 15 0.00% 40 20 0.00% 41 26 0.00% 42 20 0.00% 43 27 0.00% 44 21 0.00% 45 30 0.00% 46 33 0.00% 47 33 0.00% 48 28 0.00% 49 45 0.00% 50 49 0.00% 51 40 0.00% 52 42 0.00% 53 54 0.00% 54 65 0.00% 55 70 0.00% 56 85 0.00% 57 85 0.00% 58 69 0.00% 59 112 0.00% 60 131 0.00% 61 139 0.00% 62 164 0.00% 63 179 0.00% 64 186 0.00% 65 218 0.00% 66 250 0.00% 67 291 0.00% 68 288 0.00% 69 347 0.00% 70 436 0.00% 71 485 0.00% 72 540 0.00% 73 627 0.00% 74 732 0.00% 75 771 0.00% 76 848 0.01% 77 915 0.01% 78 1041 0.01% 79 1211 0.01% 80 1415 0.01% 81 1643 0.01% 82 1815 0.01% 83 2150 0.01% 84 2333 0.01% 85 2555 0.02% 86 2922 0.02% 87 3085 0.02% 88 3426 0.02% 89 3753 0.02% 90 4112 0.03% 91 4577 0.03% 92 5044 0.03% 93 5659 0.04% 94 6189 0.04% 95 6736 0.04% 96 7094 0.04% 97 7510 0.05% 98 7949 0.05% 99 8567 0.05% 100 9234 0.06% 101 9780 0.06% 102 10962 0.07% 103 11321 0.07% 104 12060 0.08% 105 12848 0.08% 106 13459 0.08% 107 13829 0.09% 108 14511 0.09% 109 15145 0.09% 110 15563 0.10% 111 16388 0.10% 112 17572 0.11% 113 18035 0.11% 114 19272 0.12% 115 20005 0.13% 116 20748 0.13% 117 21824 0.14% 118 22104 0.14% 119 22710 0.14% 120 24048 0.15% 121 24593 0.15% 122 25466 0.16% 123 26667 0.17% 124 27896 0.17% 125 28560 0.18% 126 29691 0.19% 127 30212 0.19% 128 31004 0.19% 129 31428 0.20% 130 31681 0.20% 131 32647 0.20% 132 33463 0.21% 133 34799 0.22% 134 35792 0.22% 135 36635 0.23% 136 37460 0.23% 137 37971 0.24% 138 38843 0.24% 139 40138 0.25% 140 40281 0.25% 141 41115 0.26% 142 41800 0.26% 143 43578 0.27% 144 44822 0.28% 145 45667 0.29% 146 46312 0.29% 147 46342 0.29% 148 47734 0.30% 149 47543 0.30% 150 48870 0.31% 151 14414208 90.29% 15964179 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=1.09 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=14.50 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.9 sequence=GGTGGAAGATCACGAAGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATT criterion=sequence-density sequence-density=1.44 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=22 prefix-density=1.45 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=104.48 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=18.0 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAG SRR12161358 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:51:43 Started mapping on | Feb 13 15:51:43 Finished on | Feb 13 15:53:50 Mapping speed, Million of reads per hour | 452.53 Number of input reads | 15964179 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14669359 Uniquely mapped reads % | 91.89% Average mapped length | 296.30 Number of splices: Total | 14553562 Number of splices: Annotated (sjdb) | 14264318 Number of splices: GT/AG | 14250493 Number of splices: GC/AG | 250443 Number of splices: AT/AC | 11871 Number of splices: Non-canonical | 40755 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430977 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 156824 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.18% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 863843 863843 863843 N_multimapping 430977 430977 430977 N_noFeature 446293 14465345 499926 N_ambiguous 258231 770 107372 UnstrandedReadsAssigned:13964835 PositiveStrandReadsAssigned:203244 NegativeStrandReadsAssigned:14062061 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161358 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161358-trimmed-pair1.fastq SRR12161358-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,964,179 reads, 14,266,054 reads pseudoaligned [quant] estimated average fragment length: 257.443 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR12161358.ke.tsv 34699 SRR12161358.se.tsv 87100 total ==> SRR12161358.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.56 327 10.2085 Potri.005G024800.1.v4.1 1035 778.557 232 16.3873 Potri.004G059700.1.v4.1 961 704.778 101 7.88095 Potri.007G009000.2.v4.1 1416 1159.56 0 0 Potri.003G141000.2.v4.1 2943 2686.56 344.207 7.04585 Potri.016G087400.1.v4.1 270 83.4034 1046 689.695 Potri.015G069301.1.v4.1 564 321.636 0 0 Potri.010G195200.1.v4.1 1773 1516.56 2 0.0725238 Potri.012G127500.1.v4.1 977 720.664 2877 219.541 ==> SRR12161358.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 65 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12161358 completed mapping pipeline successfully