Starting /dee2/code/volunteer_pipeline.sh SRR12161359 current disk space = 3087966310400 free memory = 1498565920 SRR12161359 SRAfilesize 157ee377f508bccaac38160ca64a9ed7 SRR12161359.sra SRR12161359.sra file validated SRR12161359 is paired end SRR12161359 is conventional basespace SRR12161359 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4725 37.0 37.0 37.0 37.0 37.0 2 36.474 37.0 37.0 37.0 37.0 37.0 3 36.54 37.0 37.0 37.0 37.0 37.0 4 36.548 37.0 37.0 37.0 37.0 37.0 5 36.578 37.0 37.0 37.0 37.0 37.0 6 36.467 37.0 37.0 37.0 37.0 37.0 7 36.5515 37.0 37.0 37.0 37.0 37.0 8 36.5465 37.0 37.0 37.0 37.0 37.0 9 36.4755 37.0 37.0 37.0 37.0 37.0 10-14 36.5646 37.0 37.0 37.0 37.0 37.0 15-19 36.5476 37.0 37.0 37.0 37.0 37.0 20-24 36.4629 37.0 37.0 37.0 37.0 37.0 25-29 36.4525 37.0 37.0 37.0 37.0 37.0 30-34 36.4165 37.0 37.0 37.0 37.0 37.0 35-39 36.37330000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.367599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3885 37.0 37.0 37.0 37.0 37.0 50-54 36.333600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2854 37.0 37.0 37.0 37.0 37.0 60-64 36.29880000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2743 37.0 37.0 37.0 37.0 37.0 70-74 36.2654 37.0 37.0 37.0 37.0 37.0 75-79 36.249 37.0 37.0 37.0 37.0 37.0 80-84 36.286 37.0 37.0 37.0 37.0 37.0 85-89 36.191300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.21509999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1839 37.0 37.0 37.0 37.0 37.0 100-104 36.123400000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0961 37.0 37.0 37.0 37.0 37.0 110-114 36.1276 37.0 37.0 37.0 37.0 37.0 115-119 36.12 37.0 37.0 37.0 37.0 37.0 120-124 36.0805 37.0 37.0 37.0 37.0 37.0 125-129 36.031800000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0635 37.0 37.0 37.0 37.0 37.0 135-139 35.9599 37.0 37.0 37.0 37.0 37.0 140-144 35.88290000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.776700000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.7185 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 2.0 25 4.0 26 4.0 27 8.0 28 14.0 29 21.0 30 26.0 31 40.0 32 62.0 33 57.0 34 130.0 35 284.0 36 2921.0 37 423.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.42121060530265 12.406203101550775 6.128064032016009 39.04452226113057 2 18.925 13.100000000000001 35.199999999999996 32.775 3 16.275000000000002 15.575 28.575 39.574999999999996 4 19.75 24.0 25.35 30.9 5 22.925 31.175000000000004 23.849999999999998 22.05 6 21.65 33.225 23.025000000000002 22.1 7 15.825 25.974999999999998 40.325 17.875 8 17.95 26.700000000000003 30.55 24.8 9 16.375 25.275 34.525 23.825 10-14 19.650000000000002 29.330000000000002 27.37 23.65 15-19 20.02 28.13 27.61 24.240000000000002 20-24 20.23 28.355000000000004 27.900000000000002 23.515 25-29 20.244999999999997 27.905 27.24 24.610000000000003 30-34 20.02 28.725 26.96 24.295 35-39 20.32 28.365000000000002 27.46 23.855 40-44 20.23 28.54 27.060000000000002 24.169999999999998 45-49 20.04 28.515 27.49 23.955000000000002 50-54 20.885 27.67 27.52 23.925 55-59 20.69 28.235 27.22 23.855 60-64 20.630000000000003 27.534999999999997 27.77 24.065 65-69 20.375 28.804999999999996 26.815 24.005000000000003 70-74 20.73 28.194999999999997 27.075 24.0 75-79 20.595 27.51 27.35 24.545 80-84 20.66 27.825 27.589999999999996 23.925 85-89 20.28 27.79 27.29 24.64 90-94 20.46 27.62 27.975 23.945 95-99 21.05 27.950000000000003 26.974999999999998 24.025 100-104 20.705000000000002 28.470000000000002 27.105 23.72 105-109 21.89 26.88 27.625 23.605 110-114 20.82 27.689999999999998 27.425 24.065 115-119 21.044999999999998 26.91 27.450000000000003 24.595 120-124 20.785 27.1 27.845 24.27 125-129 20.265 28.065 26.895000000000003 24.775 130-134 21.265 26.93 27.22 24.585 135-139 21.224999999999998 27.785 26.529999999999998 24.46 140-144 21.275 27.855 26.619999999999997 24.25 145-149 21.27 27.735 26.88 24.115000000000002 150-151 21.75 28.299999999999997 26.325 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.5 22 1.0 23 0.5 24 1.5 25 2.0 26 3.5 27 5.0 28 4.5 29 11.0 30 18.5 31 23.5 32 28.5 33 38.0 34 56.0 35 64.0 36 82.5 37 105.0 38 127.5 39 152.5 40 168.0 41 175.5 42 199.0 43 223.0 44 241.5 45 253.5 46 244.5 47 248.0 48 243.0 49 221.0 50 198.5 51 172.5 52 147.0 53 118.5 54 97.5 55 83.0 56 67.0 57 50.0 58 32.0 59 24.5 60 18.0 61 11.5 62 11.5 63 8.5 64 2.0 65 2.0 66 1.0 67 0.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0197628458498 90.14999999999999 2 4.63768115942029 8.799999999999999 3 0.2898550724637681 0.8250000000000001 4 0.026350461133069828 0.1 5 0.026350461133069828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACGAAGCAACCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.2625 0.0 0.0 0.0 0.0 134-135 4.8625 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161359 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161359_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.294 37.0 37.0 37.0 37.0 37.0 2 36.098 37.0 37.0 37.0 37.0 37.0 3 36.176 37.0 37.0 37.0 37.0 37.0 4 36.0585 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.2385 37.0 37.0 37.0 37.0 37.0 7 36.1515 37.0 37.0 37.0 37.0 37.0 8 36.1955 37.0 37.0 37.0 37.0 37.0 9 36.167 37.0 37.0 37.0 37.0 37.0 10-14 36.2016 37.0 37.0 37.0 37.0 37.0 15-19 36.2119 37.0 37.0 37.0 37.0 37.0 20-24 36.192099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1618 37.0 37.0 37.0 37.0 37.0 30-34 36.1109 37.0 37.0 37.0 37.0 37.0 35-39 36.1029 37.0 37.0 37.0 37.0 37.0 40-44 36.081399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.020500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.0482 37.0 37.0 37.0 37.0 37.0 55-59 35.914100000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9373 37.0 37.0 37.0 37.0 37.0 65-69 35.940200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9124 37.0 37.0 37.0 37.0 37.0 75-79 35.829499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9102 37.0 37.0 37.0 37.0 37.0 85-89 35.890100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.840799999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8353 37.0 37.0 37.0 37.0 37.0 100-104 35.8471 37.0 37.0 37.0 37.0 37.0 105-109 35.8269 37.0 37.0 37.0 37.0 37.0 110-114 35.8043 37.0 37.0 37.0 37.0 37.0 115-119 35.7759 37.0 37.0 37.0 37.0 37.0 120-124 35.7677 37.0 37.0 37.0 37.0 37.0 125-129 35.598800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.568599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6235 37.0 37.0 37.0 37.0 37.0 140-144 35.50169999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.550599999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.98475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 4.0 15 2.0 16 2.0 17 0.0 18 1.0 19 2.0 20 4.0 21 5.0 22 2.0 23 7.0 24 6.0 25 11.0 26 9.0 27 5.0 28 14.0 29 24.0 30 22.0 31 42.0 32 46.0 33 113.0 34 171.0 35 456.0 36 2763.0 37 284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.025 27.775 8.774999999999999 23.425 2 30.125 27.075 26.85 15.950000000000001 3 21.275 29.075 31.1 18.55 4 24.05 35.0 23.175 17.775 5 25.6 36.825 20.25 17.325 6 22.025 39.675 20.549999999999997 17.75 7 20.825 22.5 37.275000000000006 19.400000000000002 8 22.35 25.275 27.6 24.775 9 23.5 24.224999999999998 29.025000000000002 23.25 10-14 23.97 29.770000000000003 25.585 20.674999999999997 15-19 23.71 28.125 26.919999999999998 21.245 20-24 24.065 28.095 27.229999999999997 20.61 25-29 23.075000000000003 27.884999999999998 27.639999999999997 21.4 30-34 23.369999999999997 28.349999999999998 27.045 21.235 35-39 23.44 28.134999999999998 26.745 21.68 40-44 23.195 28.485 27.3 21.02 45-49 23.035 28.095 27.51 21.36 50-54 23.724999999999998 27.694999999999997 27.345000000000002 21.235 55-59 23.82 27.27 27.305 21.605 60-64 23.515 27.089999999999996 27.74 21.654999999999998 65-69 23.635 27.875 27.295 21.195 70-74 23.965 27.634999999999998 26.834999999999997 21.565 75-79 23.630000000000003 28.444999999999997 26.619999999999997 21.305 80-84 24.025 27.955000000000002 26.35 21.67 85-89 23.915 27.51 26.8 21.775 90-94 24.42 28.22 26.245 21.115000000000002 95-99 24.095 27.57 27.229999999999997 21.105 100-104 24.26 28.315 26.38 21.044999999999998 105-109 24.05 27.58 27.48 20.89 110-114 24.57 27.985 27.07 20.375 115-119 24.775 28.315 26.340000000000003 20.57 120-124 24.065 27.834999999999997 27.465 20.635 125-129 24.875 27.76 26.790000000000003 20.575 130-134 25.064999999999998 27.295 27.250000000000004 20.39 135-139 25.080000000000002 27.215 27.32 20.385 140-144 24.95 27.935 26.595000000000002 20.52 145-149 25.835 27.889999999999997 26.765 19.509999999999998 150-151 26.437500000000004 28.525 25.624999999999996 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 2.0 6 2.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 2.5 25 1.5 26 1.0 27 2.0 28 3.5 29 6.5 30 11.5 31 19.5 32 23.0 33 31.0 34 46.5 35 65.0 36 75.0 37 95.5 38 124.0 39 154.5 40 188.5 41 196.5 42 208.5 43 242.5 44 261.0 45 255.5 46 270.0 47 255.5 48 230.5 49 208.5 50 181.5 51 168.0 52 130.5 53 106.0 54 91.0 55 78.5 56 60.5 57 42.0 58 31.5 59 28.5 60 23.5 61 12.0 62 10.5 63 6.5 64 6.0 65 4.5 66 2.5 67 2.0 68 1.0 69 1.0 70 1.0 71 1.5 72 1.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 1.0 90 1.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.14767932489451 90.2 2 4.430379746835443 8.4 3 0.290084388185654 0.8250000000000001 4 0.05274261603375527 0.2 5 0.07911392405063292 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 2.0250000000000004 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.775 0.0 0.0 0.0 0.0 132-133 4.324999999999999 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.3875 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTATG 10 0.006830828 145.0 9 >>END_MODULE Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915515 spots for SRR12161359.sra Written 915515 spots for SRR12161359.sra Read 915532 spots for SRR12161359.sra Written 915532 spots for SRR12161359.sra SRR ids: ['SRR12161359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b60cet3t SRR12161359.sra spots: 18310317 blocks: [[1, 915515], [915516, 1831030], [1831031, 2746545], [2746546, 3662060], [3662061, 4577575], [4577576, 5493090], [5493091, 6408605], [6408606, 7324120], [7324121, 8239635], [8239636, 9155150], [9155151, 10070665], [10070666, 10986180], [10986181, 11901695], [11901696, 12817210], [12817211, 13732725], [13732726, 14648240], [14648241, 15563755], [15563756, 16479270], [16479271, 17394785], [17394786, 18310317]] SRR12161359 file size 6200946 SRR12161359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161359 SRR12161359_1.fastq SRR12161359_2.fastq Input file: SRR12161359_1.fastq Paired file: SRR12161359_2.fastq trimmed: SRR12161359-trimmed-pair1.fastq, SRR12161359-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:29:55 2025 >> started Thu Feb 13 18:30:16 2025 >> done (20.837s) 18310317 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 33225 ( 0.18%) empty read pairs filtered out after trimming by size control 18277066 (99.82%) read pairs available; of these: 1632010 ( 8.93%) trimmed read pairs available after processing 16645056 (91.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 6 0.00% 21 8 0.00% 22 6 0.00% 23 13 0.00% 24 15 0.00% 25 9 0.00% 26 14 0.00% 27 11 0.00% 28 16 0.00% 29 11 0.00% 30 18 0.00% 31 20 0.00% 32 23 0.00% 33 27 0.00% 34 20 0.00% 35 23 0.00% 36 21 0.00% 37 14 0.00% 38 18 0.00% 39 21 0.00% 40 26 0.00% 41 14 0.00% 42 20 0.00% 43 17 0.00% 44 23 0.00% 45 21 0.00% 46 19 0.00% 47 28 0.00% 48 35 0.00% 49 35 0.00% 50 20 0.00% 51 29 0.00% 52 44 0.00% 53 44 0.00% 54 51 0.00% 55 62 0.00% 56 59 0.00% 57 82 0.00% 58 75 0.00% 59 91 0.00% 60 105 0.00% 61 121 0.00% 62 133 0.00% 63 131 0.00% 64 176 0.00% 65 169 0.00% 66 191 0.00% 67 242 0.00% 68 249 0.00% 69 297 0.00% 70 330 0.00% 71 415 0.00% 72 424 0.00% 73 488 0.00% 74 516 0.00% 75 571 0.00% 76 694 0.00% 77 775 0.00% 78 789 0.00% 79 959 0.01% 80 1045 0.01% 81 1235 0.01% 82 1404 0.01% 83 1634 0.01% 84 1730 0.01% 85 1947 0.01% 86 2208 0.01% 87 2442 0.01% 88 2605 0.01% 89 2994 0.02% 90 3327 0.02% 91 3725 0.02% 92 4138 0.02% 93 4558 0.02% 94 5046 0.03% 95 5522 0.03% 96 5896 0.03% 97 6461 0.04% 98 6814 0.04% 99 7202 0.04% 100 8030 0.04% 101 8243 0.05% 102 9457 0.05% 103 9905 0.05% 104 10667 0.06% 105 11372 0.06% 106 12213 0.07% 107 12660 0.07% 108 13408 0.07% 109 14081 0.08% 110 14938 0.08% 111 15633 0.09% 112 16616 0.09% 113 17238 0.09% 114 18508 0.10% 115 19584 0.11% 116 20107 0.11% 117 21101 0.12% 118 22344 0.12% 119 22664 0.12% 120 24235 0.13% 121 24866 0.14% 122 25990 0.14% 123 27015 0.15% 124 28212 0.15% 125 29015 0.16% 126 30189 0.17% 127 31425 0.17% 128 32421 0.18% 129 33266 0.18% 130 34739 0.19% 131 35023 0.19% 132 36570 0.20% 133 37761 0.21% 134 39048 0.21% 135 40611 0.22% 136 41240 0.23% 137 42069 0.23% 138 43472 0.24% 139 45111 0.25% 140 45040 0.25% 141 47042 0.26% 142 48240 0.26% 143 49360 0.27% 144 51713 0.28% 145 52600 0.29% 146 53244 0.29% 147 54503 0.30% 148 55450 0.30% 149 55874 0.31% 150 57073 0.31% 151 16645056 91.07% 18277066 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.73 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=22 fanout-score=8.44 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=3.1 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=19 prefix-density=0.84 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=12.35 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.8 sequence=ACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12161359 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:30:57 Started mapping on | Feb 13 18:30:57 Finished on | Feb 13 18:33:18 Mapping speed, Million of reads per hour | 466.65 Number of input reads | 18277066 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16828152 Uniquely mapped reads % | 92.07% Average mapped length | 297.11 Number of splices: Total | 17501719 Number of splices: Annotated (sjdb) | 17170947 Number of splices: GT/AG | 17137906 Number of splices: GC/AG | 299324 Number of splices: AT/AC | 12548 Number of splices: Non-canonical | 51941 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430008 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 213615 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1018906 1018906 1018906 N_multimapping 430008 430008 430008 N_noFeature 590003 16548580 660474 N_ambiguous 322197 1476 112031 UnstrandedReadsAssigned:15915952 PositiveStrandReadsAssigned:278096 NegativeStrandReadsAssigned:16055647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161359 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161359-trimmed-pair1.fastq SRR12161359-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,277,066 reads, 16,257,769 reads pseudoaligned [quant] estimated average fragment length: 253.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR12161359.ke.tsv 34699 SRR12161359.se.tsv 87100 total ==> SRR12161359.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.44 696 18.3274 Potri.005G024800.1.v4.1 1035 782.438 615 36.54 Potri.004G059700.1.v4.1 961 708.59 20 1.31213 Potri.007G009000.2.v4.1 1416 1163.44 0 0 Potri.003G141000.2.v4.1 2943 2690.44 420 7.25721 Potri.016G087400.1.v4.1 270 79.8913 917.423 533.843 Potri.015G069301.1.v4.1 564 323.236 0 0 Potri.010G195200.1.v4.1 1773 1520.44 33 1.00899 Potri.012G127500.1.v4.1 977 724.498 187 11.9991 ==> SRR12161359.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 29 Potri.001G452600.v4.1 18 SRR12161359 completed mapping pipeline successfully