Starting /dee2/code/volunteer_pipeline.sh SRR12161360 current disk space = 3088760393728 free memory = 1451369784 SRR12161360 SRAfilesize 2a7a56d119b11041c32850e87d09dacc SRR12161360.sra SRR12161360.sra file validated SRR12161360 is paired end SRR12161360 is conventional basespace SRR12161360 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6175 37.0 37.0 37.0 37.0 37.0 2 36.4185 37.0 37.0 37.0 37.0 37.0 3 36.5695 37.0 37.0 37.0 37.0 37.0 4 36.605 37.0 37.0 37.0 37.0 37.0 5 36.6335 37.0 37.0 37.0 37.0 37.0 6 36.6525 37.0 37.0 37.0 37.0 37.0 7 36.5235 37.0 37.0 37.0 37.0 37.0 8 36.5755 37.0 37.0 37.0 37.0 37.0 9 36.617 37.0 37.0 37.0 37.0 37.0 10-14 36.6262 37.0 37.0 37.0 37.0 37.0 15-19 36.559000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5202 37.0 37.0 37.0 37.0 37.0 25-29 36.515499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4985 37.0 37.0 37.0 37.0 37.0 35-39 36.436299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.415000000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4055 37.0 37.0 37.0 37.0 37.0 50-54 36.3657 37.0 37.0 37.0 37.0 37.0 55-59 36.3694 37.0 37.0 37.0 37.0 37.0 60-64 36.3724 37.0 37.0 37.0 37.0 37.0 65-69 36.3721 37.0 37.0 37.0 37.0 37.0 70-74 36.3788 37.0 37.0 37.0 37.0 37.0 75-79 36.319599999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3578 37.0 37.0 37.0 37.0 37.0 85-89 36.327 37.0 37.0 37.0 37.0 37.0 90-94 36.282 37.0 37.0 37.0 37.0 37.0 95-99 36.2559 37.0 37.0 37.0 37.0 37.0 100-104 36.223600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.2087 37.0 37.0 37.0 37.0 37.0 110-114 36.2278 37.0 37.0 37.0 37.0 37.0 115-119 36.1751 37.0 37.0 37.0 37.0 37.0 120-124 36.163 37.0 37.0 37.0 37.0 37.0 125-129 36.163799999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.155899999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.05200000000001 37.0 37.0 37.0 37.0 37.0 140-144 36.019600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.9781 37.0 37.0 37.0 37.0 37.0 150-151 35.810500000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 1.0 26 4.0 27 7.0 28 11.0 29 18.0 30 27.0 31 30.0 32 40.0 33 55.0 34 102.0 35 312.0 36 2942.0 37 447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.071071071071074 12.862862862862862 5.63063063063063 35.43543543543544 2 20.424999999999997 12.2 35.425000000000004 31.95 3 17.525 16.25 28.625 37.6 4 22.0 24.375 24.5 29.125 5 23.025000000000002 31.075000000000003 24.099999999999998 21.8 6 20.525 33.4 24.025 22.05 7 15.7 27.075 40.300000000000004 16.925 8 17.474999999999998 26.625 30.85 25.05 9 16.150000000000002 24.9 34.925 24.025 10-14 19.68 29.775000000000002 27.400000000000002 23.145 15-19 20.285 26.845000000000002 27.875 24.995 20-24 20.27 27.42 27.71 24.6 25-29 20.31 28.08 27.54 24.07 30-34 19.915 27.544999999999998 27.925 24.615000000000002 35-39 20.349999999999998 27.345000000000002 27.42 24.884999999999998 40-44 20.135 28.09 27.525 24.25 45-49 20.68 27.884999999999998 27.245 24.19 50-54 19.865 28.58 27.275 24.279999999999998 55-59 20.36 27.589999999999996 27.944999999999997 24.104999999999997 60-64 20.53 27.794999999999998 26.790000000000003 24.884999999999998 65-69 20.69 27.875 27.235 24.2 70-74 20.24 28.07 27.205000000000002 24.485 75-79 20.3 28.305000000000003 27.365000000000002 24.03 80-84 20.53 28.15 27.255000000000003 24.065 85-89 20.82 27.76 26.615 24.805 90-94 20.805 26.93 27.889999999999997 24.375 95-99 20.995 27.250000000000004 27.689999999999998 24.065 100-104 20.71 28.365000000000002 27.045 23.880000000000003 105-109 20.745 27.284999999999997 27.775 24.195 110-114 20.755000000000003 27.62 28.015 23.61 115-119 21.04 27.800000000000004 27.284999999999997 23.875 120-124 20.794999999999998 27.855 27.139999999999997 24.21 125-129 20.7 27.384999999999998 27.77 24.145 130-134 21.224999999999998 27.42 27.334999999999997 24.02 135-139 21.044999999999998 27.544999999999998 27.22 24.19 140-144 21.445 27.02 27.21 24.325 145-149 21.05 27.884999999999998 26.795 24.27 150-151 20.9875 26.687499999999996 27.1125 25.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 0.0 22 1.0 23 1.0 24 1.0 25 3.5 26 3.5 27 4.5 28 10.5 29 15.0 30 12.0 31 18.0 32 30.5 33 39.0 34 47.5 35 50.0 36 78.0 37 98.0 38 113.5 39 149.5 40 177.0 41 193.0 42 201.5 43 217.0 44 237.0 45 247.0 46 249.5 47 246.5 48 245.0 49 237.5 50 202.5 51 164.5 52 133.0 53 106.0 54 94.0 55 89.5 56 76.5 57 55.5 58 40.0 59 34.5 60 23.0 61 11.5 62 8.5 63 5.0 64 2.0 65 4.0 66 4.0 67 3.5 68 4.5 69 2.5 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.91675560298826 88.0 2 5.496264674493063 10.299999999999999 3 0.5602988260405549 1.575 4 0.0 0.0 5 0.026680896478121666 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.3375000000000004 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161360 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161360_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.213 37.0 37.0 37.0 37.0 37.0 2 35.907 37.0 37.0 37.0 37.0 37.0 3 36.034 37.0 37.0 37.0 37.0 37.0 4 36.1395 37.0 37.0 37.0 37.0 37.0 5 36.124 37.0 37.0 37.0 37.0 37.0 6 36.1165 37.0 37.0 37.0 37.0 37.0 7 36.0415 37.0 37.0 37.0 37.0 37.0 8 36.198 37.0 37.0 37.0 37.0 37.0 9 36.261 37.0 37.0 37.0 37.0 37.0 10-14 36.2588 37.0 37.0 37.0 37.0 37.0 15-19 36.2174 37.0 37.0 37.0 37.0 37.0 20-24 36.13420000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.105 37.0 37.0 37.0 37.0 37.0 30-34 36.134499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0566 37.0 37.0 37.0 37.0 37.0 40-44 36.05649999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.0177 37.0 37.0 37.0 37.0 37.0 50-54 36.0469 37.0 37.0 37.0 37.0 37.0 55-59 35.989700000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9517 37.0 37.0 37.0 37.0 37.0 65-69 35.9651 37.0 37.0 37.0 37.0 37.0 70-74 35.8528 37.0 37.0 37.0 37.0 37.0 75-79 35.8255 37.0 37.0 37.0 37.0 37.0 80-84 35.9356 37.0 37.0 37.0 37.0 37.0 85-89 35.7796 37.0 37.0 37.0 37.0 37.0 90-94 35.796899999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8053 37.0 37.0 37.0 37.0 37.0 100-104 35.8184 37.0 37.0 37.0 37.0 37.0 105-109 35.7445 37.0 37.0 37.0 37.0 37.0 110-114 35.733900000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.6913 37.0 37.0 37.0 37.0 37.0 120-124 35.7008 37.0 37.0 37.0 37.0 37.0 125-129 35.5886 37.0 37.0 37.0 37.0 37.0 130-134 35.4452 37.0 37.0 37.0 34.6 37.0 135-139 35.566199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4555 37.0 37.0 37.0 37.0 37.0 145-149 35.5423 37.0 37.0 37.0 37.0 37.0 150-151 35.01225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 1.0 20 2.0 21 2.0 22 3.0 23 0.0 24 7.0 25 12.0 26 8.0 27 7.0 28 23.0 29 17.0 30 24.0 31 41.0 32 78.0 33 106.0 34 172.0 35 585.0 36 2651.0 37 249.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.699999999999996 26.474999999999998 7.875 23.95 2 27.800000000000004 27.500000000000004 28.425 16.275000000000002 3 21.15 27.675 31.225 19.950000000000003 4 23.3 34.599999999999994 23.775 18.325 5 25.275 36.775000000000006 21.5 16.45 6 19.475 39.574999999999996 21.6 19.35 7 20.474999999999998 22.825 38.025 18.675 8 21.475 25.924999999999997 27.05 25.55 9 22.6 24.425 28.95 24.025 10-14 23.385 28.865000000000002 26.669999999999998 21.08 15-19 23.155 28.165000000000003 27.29 21.39 20-24 22.900000000000002 28.265 27.415 21.42 25-29 23.01 27.950000000000003 27.894999999999996 21.145 30-34 23.044999999999998 27.735 27.939999999999998 21.279999999999998 35-39 23.375 27.49 27.36 21.775 40-44 22.865 27.725 28.244999999999997 21.165 45-49 23.345 27.6 27.55 21.505 50-54 23.62 28.225 26.61 21.545 55-59 23.36 27.284999999999997 27.725 21.63 60-64 23.78 27.43 27.355 21.435000000000002 65-69 23.815 27.46 27.084999999999997 21.64 70-74 23.265 27.905 26.715 22.115000000000002 75-79 23.44 28.04 26.900000000000002 21.62 80-84 23.57 28.26 26.529999999999998 21.64 85-89 24.375 27.689999999999998 26.105 21.83 90-94 23.805 28.58 26.529999999999998 21.085 95-99 24.0 27.155 27.435 21.41 100-104 23.77 27.665 27.49 21.075 105-109 23.655 27.465 27.505000000000003 21.375 110-114 23.880000000000003 27.815 27.47 20.835 115-119 24.610000000000003 27.245 27.33 20.815 120-124 24.43 27.72 26.845000000000002 21.005 125-129 23.965 27.88 26.400000000000002 21.755 130-134 24.335 27.405 27.075 21.185000000000002 135-139 24.685000000000002 27.884999999999998 26.61 20.82 140-144 24.745 27.794999999999998 27.155 20.305 145-149 24.975 27.705000000000002 26.38 20.94 150-151 25.474999999999998 27.400000000000002 27.35 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 1.0 23 4.5 24 4.5 25 3.0 26 5.0 27 5.5 28 7.0 29 10.0 30 14.0 31 19.5 32 28.5 33 38.0 34 42.5 35 56.0 36 76.5 37 98.5 38 133.0 39 159.5 40 177.5 41 193.5 42 214.0 43 244.0 44 257.5 45 256.0 46 261.0 47 252.0 48 219.0 49 210.0 50 186.0 51 150.0 52 131.5 53 106.5 54 87.5 55 69.5 56 53.0 57 46.5 58 42.5 59 31.0 60 24.0 61 19.0 62 13.5 63 10.5 64 6.5 65 4.5 66 2.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 1.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.25747863247864 88.225 2 5.0747863247863245 9.5 3 0.5341880341880342 1.5 4 0.05341880341880342 0.2 5 0.02670940170940171 0.125 6 0.0 0.0 7 0.02670940170940171 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02670940170940171 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 11 0.27499999999999997 No Hit GAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.3375000000000004 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGCCG 10 0.006830828 145.0 145 >>END_MODULE Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916700 spots for SRR12161360.sra Written 916700 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra Read 916688 spots for SRR12161360.sra Written 916688 spots for SRR12161360.sra SRR ids: ['SRR12161360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3knzkibm SRR12161360.sra spots: 18333772 blocks: [[1, 916688], [916689, 1833376], [1833377, 2750064], [2750065, 3666752], [3666753, 4583440], [4583441, 5500128], [5500129, 6416816], [6416817, 7333504], [7333505, 8250192], [8250193, 9166880], [9166881, 10083568], [10083569, 11000256], [11000257, 11916944], [11916945, 12833632], [12833633, 13750320], [13750321, 14667008], [14667009, 15583696], [15583697, 16500384], [16500385, 17417072], [17417073, 18333772]] SRR12161360 file size 6208917 SRR12161360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161360 SRR12161360_1.fastq SRR12161360_2.fastq Input file: SRR12161360_1.fastq Paired file: SRR12161360_2.fastq trimmed: SRR12161360-trimmed-pair1.fastq, SRR12161360-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:59:45 2025 >> started Thu Feb 13 18:00:07 2025 >> done (21.691s) 18333772 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 7908 ( 0.04%) empty read pairs filtered out after trimming by size control 18325835 (99.96%) read pairs available; of these: 932952 ( 5.09%) trimmed read pairs available after processing 17392883 (94.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 5 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 8 0.00% 25 10 0.00% 26 8 0.00% 27 19 0.00% 28 10 0.00% 29 9 0.00% 30 9 0.00% 31 6 0.00% 32 13 0.00% 33 10 0.00% 34 17 0.00% 35 11 0.00% 36 12 0.00% 37 18 0.00% 38 13 0.00% 39 7 0.00% 40 14 0.00% 41 13 0.00% 42 12 0.00% 43 14 0.00% 44 15 0.00% 45 24 0.00% 46 22 0.00% 47 18 0.00% 48 16 0.00% 49 26 0.00% 50 22 0.00% 51 27 0.00% 52 33 0.00% 53 24 0.00% 54 34 0.00% 55 31 0.00% 56 40 0.00% 57 50 0.00% 58 43 0.00% 59 46 0.00% 60 44 0.00% 61 61 0.00% 62 76 0.00% 63 86 0.00% 64 63 0.00% 65 98 0.00% 66 95 0.00% 67 117 0.00% 68 142 0.00% 69 148 0.00% 70 160 0.00% 71 188 0.00% 72 193 0.00% 73 244 0.00% 74 238 0.00% 75 285 0.00% 76 338 0.00% 77 395 0.00% 78 417 0.00% 79 431 0.00% 80 501 0.00% 81 607 0.00% 82 708 0.00% 83 741 0.00% 84 856 0.00% 85 925 0.01% 86 1042 0.01% 87 1156 0.01% 88 1319 0.01% 89 1394 0.01% 90 1519 0.01% 91 1708 0.01% 92 1877 0.01% 93 2138 0.01% 94 2338 0.01% 95 2719 0.01% 96 2894 0.02% 97 3181 0.02% 98 3358 0.02% 99 3603 0.02% 100 3916 0.02% 101 4243 0.02% 102 4533 0.02% 103 4764 0.03% 104 5439 0.03% 105 5566 0.03% 106 5952 0.03% 107 6290 0.03% 108 6677 0.04% 109 7062 0.04% 110 7392 0.04% 111 7977 0.04% 112 8490 0.05% 113 9017 0.05% 114 9512 0.05% 115 10066 0.05% 116 10602 0.06% 117 11129 0.06% 118 11512 0.06% 119 12103 0.07% 120 12774 0.07% 121 13222 0.07% 122 13674 0.07% 123 14551 0.08% 124 15348 0.08% 125 16132 0.09% 126 16759 0.09% 127 17540 0.10% 128 18138 0.10% 129 18507 0.10% 130 19344 0.11% 131 19856 0.11% 132 20799 0.11% 133 21807 0.12% 134 22579 0.12% 135 23399 0.13% 136 24187 0.13% 137 25026 0.14% 138 25744 0.14% 139 26890 0.15% 140 27117 0.15% 141 28173 0.15% 142 29136 0.16% 143 30085 0.16% 144 31938 0.17% 145 32873 0.18% 146 33228 0.18% 147 34045 0.19% 148 35523 0.19% 149 35620 0.19% 150 37566 0.20% 151 17392883 94.91% 18325835 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.93 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=18.84 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGG criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=20 prefix-density=1.17 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=10.81 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12161360 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:00:57 Started mapping on | Feb 13 18:00:57 Finished on | Feb 13 18:02:58 Mapping speed, Million of reads per hour | 545.23 Number of input reads | 18325835 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17008275 Uniquely mapped reads % | 92.81% Average mapped length | 298.77 Number of splices: Total | 17531707 Number of splices: Annotated (sjdb) | 17191008 Number of splices: GT/AG | 17164911 Number of splices: GC/AG | 308039 Number of splices: AT/AC | 9953 Number of splices: Non-canonical | 48804 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431847 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 356508 % of reads mapped to too many loci | 1.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 885713 885713 885713 N_multimapping 431847 431847 431847 N_noFeature 768278 16735685 832192 N_ambiguous 313297 1682 103573 UnstrandedReadsAssigned:15926700 PositiveStrandReadsAssigned:270908 NegativeStrandReadsAssigned:16072510 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161360 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161360-trimmed-pair1.fastq SRR12161360-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,325,835 reads, 16,199,663 reads pseudoaligned [quant] estimated average fragment length: 272.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR12161360.ke.tsv 34699 SRR12161360.se.tsv 87100 total ==> SRR12161360.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.85 399 10.7703 Potri.005G024800.1.v4.1 1035 763.846 194 11.9758 Potri.004G059700.1.v4.1 961 690.053 7 0.478327 Potri.007G009000.2.v4.1 1416 1144.85 0 0 Potri.003G141000.2.v4.1 2943 2671.85 571 10.0771 Potri.016G087400.1.v4.1 270 70.6968 645.432 430.488 Potri.015G069301.1.v4.1 564 306.136 0 0 Potri.010G195200.1.v4.1 1773 1501.85 34 1.06749 Potri.012G127500.1.v4.1 977 705.967 189 12.6237 ==> SRR12161360.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 214 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 10 Potri.001G452600.v4.1 31 SRR12161360 completed mapping pipeline successfully