Starting /dee2/code/volunteer_pipeline.sh SRR12161361 current disk space = 3088591147008 free memory = 1396689292 SRR12161361 SRAfilesize f876dfb7e7eb55732547f24c34895df0 SRR12161361.sra SRR12161361.sra file validated SRR12161361 is paired end SRR12161361 is conventional basespace SRR12161361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5575 37.0 37.0 37.0 37.0 37.0 2 36.3335 37.0 37.0 37.0 37.0 37.0 3 36.506 37.0 37.0 37.0 37.0 37.0 4 36.5665 37.0 37.0 37.0 37.0 37.0 5 36.546 37.0 37.0 37.0 37.0 37.0 6 36.573 37.0 37.0 37.0 37.0 37.0 7 36.4655 37.0 37.0 37.0 37.0 37.0 8 36.46 37.0 37.0 37.0 37.0 37.0 9 36.38 37.0 37.0 37.0 37.0 37.0 10-14 36.512 37.0 37.0 37.0 37.0 37.0 15-19 36.5192 37.0 37.0 37.0 37.0 37.0 20-24 36.482000000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.425799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.42399999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.438300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.352700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3586 37.0 37.0 37.0 37.0 37.0 50-54 36.3109 37.0 37.0 37.0 37.0 37.0 55-59 36.371 37.0 37.0 37.0 37.0 37.0 60-64 36.3656 37.0 37.0 37.0 37.0 37.0 65-69 36.3138 37.0 37.0 37.0 37.0 37.0 70-74 36.348699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.2286 37.0 37.0 37.0 37.0 37.0 80-84 36.293099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2132 37.0 37.0 37.0 37.0 37.0 90-94 36.2333 37.0 37.0 37.0 37.0 37.0 95-99 36.1934 37.0 37.0 37.0 37.0 37.0 100-104 36.1663 37.0 37.0 37.0 37.0 37.0 105-109 36.1403 37.0 37.0 37.0 37.0 37.0 110-114 36.115199999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1221 37.0 37.0 37.0 37.0 37.0 120-124 36.094300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.975100000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.028800000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9899 37.0 37.0 37.0 37.0 37.0 140-144 35.9077 37.0 37.0 37.0 37.0 37.0 145-149 35.8601 37.0 37.0 37.0 37.0 37.0 150-151 35.723 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 4.0 26 1.0 27 6.0 28 16.0 29 19.0 30 32.0 31 39.0 32 50.0 33 73.0 34 116.0 35 282.0 36 2960.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.57128564282141 11.830915457728866 5.777888944472236 39.81990995497749 2 20.05 12.8 34.2 32.95 3 15.925 16.275000000000002 27.675 40.125 4 21.7 23.674999999999997 24.2 30.425 5 24.075 29.349999999999998 23.9 22.675 6 21.2 33.7 23.549999999999997 21.55 7 15.925 27.200000000000003 38.85 18.025 8 17.275 27.85 32.800000000000004 22.075 9 18.075 24.85 35.175 21.9 10-14 19.405 29.34 27.85 23.405 15-19 19.46 28.26 27.36 24.92 20-24 20.34 28.875 26.845000000000002 23.94 25-29 20.21 28.660000000000004 27.3 23.830000000000002 30-34 19.53 28.910000000000004 27.015 24.545 35-39 20.105 27.955000000000002 27.395000000000003 24.545 40-44 20.21 28.63 27.07 24.09 45-49 20.13 28.46 26.634999999999998 24.775 50-54 20.605 28.095 27.02 24.279999999999998 55-59 20.28 28.425 26.950000000000003 24.345 60-64 20.04 28.305000000000003 27.22 24.435000000000002 65-69 20.64 28.23 26.945000000000004 24.185000000000002 70-74 20.665 28.345 26.63 24.36 75-79 20.09 27.665 27.83 24.415 80-84 20.52 28.325 27.0 24.154999999999998 85-89 20.3 28.26 27.095000000000002 24.345 90-94 19.575 27.97 27.43 25.025 95-99 20.825 27.49 27.465 24.22 100-104 20.805 28.04 26.965 24.19 105-109 20.69 28.01 27.24 24.060000000000002 110-114 20.985 28.189999999999998 26.96 23.865 115-119 21.135 27.97 27.065 23.830000000000002 120-124 20.72 28.015 27.015 24.25 125-129 21.11 27.55 27.445000000000004 23.895 130-134 20.94 27.565 27.275 24.22 135-139 21.085 26.875 27.63 24.41 140-144 21.240000000000002 27.21 27.005000000000003 24.545 145-149 20.78 28.105000000000004 26.825 24.29 150-151 20.599999999999998 27.987499999999997 27.55 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.0 23 0.5 24 0.0 25 0.0 26 5.5 27 8.5 28 5.5 29 8.5 30 10.5 31 15.0 32 27.0 33 38.5 34 53.5 35 68.5 36 85.0 37 103.5 38 131.0 39 147.5 40 151.5 41 177.0 42 200.0 43 219.0 44 246.0 45 265.5 46 257.0 47 242.5 48 251.0 49 248.0 50 210.0 51 170.0 52 146.0 53 114.0 54 88.5 55 75.5 56 57.5 57 47.0 58 34.5 59 27.5 60 25.0 61 12.0 62 5.5 63 4.5 64 2.0 65 1.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.96838777660696 90.125 2 4.715489989462593 8.95 3 0.2897787144362487 0.8250000000000001 4 0.026343519494204423 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 3.0 0.0 0.0 0.0 0.0 138-139 3.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTTAT 10 0.006830828 145.0 9 >>END_MODULE SRR12161361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1675 37.0 37.0 37.0 37.0 37.0 2 35.8725 37.0 37.0 37.0 37.0 37.0 3 36.059 37.0 37.0 37.0 37.0 37.0 4 36.007 37.0 37.0 37.0 37.0 37.0 5 36.1035 37.0 37.0 37.0 37.0 37.0 6 36.0815 37.0 37.0 37.0 37.0 37.0 7 36.149 37.0 37.0 37.0 37.0 37.0 8 36.258 37.0 37.0 37.0 37.0 37.0 9 36.158 37.0 37.0 37.0 37.0 37.0 10-14 36.1882 37.0 37.0 37.0 37.0 37.0 15-19 36.1394 37.0 37.0 37.0 37.0 37.0 20-24 36.107299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0784 37.0 37.0 37.0 37.0 37.0 30-34 36.0733 37.0 37.0 37.0 37.0 37.0 35-39 36.0432 37.0 37.0 37.0 37.0 37.0 40-44 35.9599 37.0 37.0 37.0 37.0 37.0 45-49 35.97 37.0 37.0 37.0 37.0 37.0 50-54 35.9768 37.0 37.0 37.0 37.0 37.0 55-59 35.906499999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.8964 37.0 37.0 37.0 37.0 37.0 65-69 35.94 37.0 37.0 37.0 37.0 37.0 70-74 35.7924 37.0 37.0 37.0 37.0 37.0 75-79 35.7965 37.0 37.0 37.0 37.0 37.0 80-84 35.8677 37.0 37.0 37.0 37.0 37.0 85-89 35.902 37.0 37.0 37.0 37.0 37.0 90-94 35.787600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7493 37.0 37.0 37.0 37.0 37.0 100-104 35.766600000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7153 37.0 37.0 37.0 37.0 37.0 110-114 35.722500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6991 37.0 37.0 37.0 37.0 37.0 120-124 35.6482 37.0 37.0 37.0 37.0 37.0 125-129 35.6081 37.0 37.0 37.0 37.0 37.0 130-134 35.520599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.5232 37.0 37.0 37.0 37.0 37.0 140-144 35.508399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5711 37.0 37.0 37.0 37.0 37.0 150-151 34.9525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 3.0 16 1.0 17 0.0 18 0.0 19 2.0 20 3.0 21 4.0 22 4.0 23 6.0 24 9.0 25 6.0 26 7.0 27 12.0 28 19.0 29 35.0 30 25.0 31 33.0 32 55.0 33 111.0 34 194.0 35 579.0 36 2643.0 37 244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.75 24.75 9.675 25.825 2 27.200000000000003 27.975 29.299999999999997 15.525 3 20.825 27.825 31.0 20.349999999999998 4 23.35 34.675 22.775000000000002 19.2 5 25.275 36.475 21.575 16.675 6 21.3 38.85 22.325 17.525 7 22.575 22.875 36.175000000000004 18.375 8 21.4 26.424999999999997 28.050000000000004 24.125 9 22.3 24.125 29.975 23.599999999999998 10-14 23.21 29.59 26.195 21.005 15-19 23.505000000000003 28.035 27.015 21.445 20-24 23.525 28.785 26.884999999999998 20.805 25-29 23.36 28.34 27.334999999999997 20.965 30-34 23.56 27.735 27.485 21.22 35-39 23.09 28.255000000000003 26.795 21.86 40-44 23.0 28.53 27.075 21.395 45-49 23.655 27.884999999999998 27.395000000000003 21.065 50-54 23.244999999999997 27.76 27.644999999999996 21.349999999999998 55-59 23.53 27.41 27.534999999999997 21.525 60-64 23.445 27.405 27.54 21.61 65-69 23.945 27.205000000000002 27.439999999999998 21.41 70-74 23.62 27.41 27.27 21.7 75-79 23.785 27.650000000000002 26.745 21.82 80-84 23.93 27.98 26.119999999999997 21.97 85-89 23.14 27.57 27.495000000000005 21.795 90-94 24.165 27.950000000000003 26.5 21.385 95-99 23.915 27.229999999999997 27.295 21.560000000000002 100-104 23.565 27.74 27.345000000000002 21.349999999999998 105-109 23.91 27.325 27.334999999999997 21.43 110-114 23.755000000000003 27.63 27.495000000000005 21.12 115-119 23.95 27.944999999999997 27.58 20.525 120-124 24.335 28.055000000000003 26.705000000000002 20.905 125-129 24.505 27.534999999999997 27.595 20.365 130-134 24.765 27.48 26.584999999999997 21.17 135-139 24.560000000000002 26.91 27.62 20.91 140-144 24.57 27.99 27.185 20.255000000000003 145-149 24.685000000000002 27.889999999999997 26.540000000000003 20.885 150-151 25.4875 27.037499999999998 27.287499999999998 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 1.0 26 3.0 27 6.0 28 8.5 29 8.5 30 10.5 31 18.0 32 25.5 33 32.5 34 40.0 35 53.0 36 76.5 37 107.0 38 125.5 39 138.0 40 158.0 41 188.5 42 217.0 43 247.0 44 278.5 45 263.5 46 260.0 47 263.5 48 228.5 49 210.5 50 208.0 51 183.0 52 138.0 53 103.0 54 87.5 55 72.0 56 52.5 57 45.0 58 33.5 59 24.0 60 20.5 61 14.0 62 9.5 63 8.5 64 7.0 65 2.0 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.70899470899471 89.5 2 4.841269841269842 9.15 3 0.3968253968253968 1.125 4 0.026455026455026457 0.1 5 0.026455026455026457 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412057 spots for SRR12161361.sra Written 412057 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra Read 412048 spots for SRR12161361.sra Written 412048 spots for SRR12161361.sra SRR ids: ['SRR12161361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mtl8pet1 SRR12161361.sra spots: 8240969 blocks: [[1, 412048], [412049, 824096], [824097, 1236144], [1236145, 1648192], [1648193, 2060240], [2060241, 2472288], [2472289, 2884336], [2884337, 3296384], [3296385, 3708432], [3708433, 4120480], [4120481, 4532528], [4532529, 4944576], [4944577, 5356624], [5356625, 5768672], [5768673, 6180720], [6180721, 6592768], [6592769, 7004816], [7004817, 7416864], [7416865, 7828912], [7828913, 8240969]] SRR12161361 file size 2782377 SRR12161361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161361 SRR12161361_1.fastq SRR12161361_2.fastq Input file: SRR12161361_1.fastq Paired file: SRR12161361_2.fastq trimmed: SRR12161361-trimmed-pair1.fastq, SRR12161361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:05:49 2025 >> started Thu Feb 13 18:05:58 2025 >> done (9.304s) 8240969 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 5131 ( 0.06%) empty read pairs filtered out after trimming by size control 8235830 (99.94%) read pairs available; of these: 518326 ( 6.29%) trimmed read pairs available after processing 7717504 (93.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 0 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 1 0.00% 29 6 0.00% 30 6 0.00% 31 3 0.00% 32 2 0.00% 33 11 0.00% 34 2 0.00% 35 3 0.00% 36 8 0.00% 37 7 0.00% 38 6 0.00% 39 6 0.00% 40 8 0.00% 41 11 0.00% 42 5 0.00% 43 7 0.00% 44 6 0.00% 45 2 0.00% 46 14 0.00% 47 8 0.00% 48 5 0.00% 49 15 0.00% 50 16 0.00% 51 24 0.00% 52 14 0.00% 53 15 0.00% 54 13 0.00% 55 17 0.00% 56 27 0.00% 57 21 0.00% 58 37 0.00% 59 24 0.00% 60 30 0.00% 61 39 0.00% 62 44 0.00% 63 43 0.00% 64 58 0.00% 65 58 0.00% 66 56 0.00% 67 70 0.00% 68 76 0.00% 69 96 0.00% 70 107 0.00% 71 130 0.00% 72 135 0.00% 73 150 0.00% 74 175 0.00% 75 190 0.00% 76 232 0.00% 77 252 0.00% 78 251 0.00% 79 287 0.00% 80 339 0.00% 81 430 0.01% 82 450 0.01% 83 482 0.01% 84 553 0.01% 85 688 0.01% 86 673 0.01% 87 801 0.01% 88 838 0.01% 89 944 0.01% 90 1071 0.01% 91 1181 0.01% 92 1270 0.02% 93 1455 0.02% 94 1626 0.02% 95 1654 0.02% 96 1856 0.02% 97 1951 0.02% 98 2093 0.03% 99 2323 0.03% 100 2492 0.03% 101 2718 0.03% 102 2774 0.03% 103 3082 0.04% 104 3253 0.04% 105 3451 0.04% 106 3693 0.04% 107 3756 0.05% 108 4150 0.05% 109 4469 0.05% 110 4515 0.05% 111 4886 0.06% 112 5169 0.06% 113 5405 0.07% 114 5621 0.07% 115 5784 0.07% 116 6170 0.07% 117 6542 0.08% 118 6926 0.08% 119 6996 0.08% 120 7392 0.09% 121 7609 0.09% 122 8020 0.10% 123 8373 0.10% 124 8451 0.10% 125 8946 0.11% 126 9459 0.11% 127 9779 0.12% 128 10229 0.12% 129 10572 0.13% 130 10726 0.13% 131 11048 0.13% 132 11480 0.14% 133 12008 0.15% 134 12485 0.15% 135 12819 0.16% 136 13161 0.16% 137 13507 0.16% 138 13775 0.17% 139 14562 0.18% 140 14818 0.18% 141 15216 0.18% 142 15537 0.19% 143 15922 0.19% 144 16584 0.20% 145 17270 0.21% 146 17408 0.21% 147 17767 0.22% 148 18195 0.22% 149 18726 0.23% 150 19102 0.23% 151 7717504 93.71% 8235830 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=17 prefix-density=0.92 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.36 sequence-density-rank=15 fanout-score=7.81 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=4.6 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=23 prefix-density=1.08 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=107.54 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.0 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACCGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAG SRR12161361 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:06:41 Started mapping on | Feb 13 18:06:42 Finished on | Feb 13 18:07:55 Mapping speed, Million of reads per hour | 406.15 Number of input reads | 8235830 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 7609016 Uniquely mapped reads % | 92.39% Average mapped length | 298.18 Number of splices: Total | 7466226 Number of splices: Annotated (sjdb) | 7328431 Number of splices: GT/AG | 7315398 Number of splices: GC/AG | 127990 Number of splices: AT/AC | 5627 Number of splices: Non-canonical | 17211 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234377 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 72081 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 392437 392437 392437 N_multimapping 234377 234377 234377 N_noFeature 206208 7520185 228064 N_ambiguous 123876 407 56634 UnstrandedReadsAssigned:7278932 PositiveStrandReadsAssigned:88424 NegativeStrandReadsAssigned:7324318 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161361-trimmed-pair1.fastq SRR12161361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,235,830 reads, 7,393,225 reads pseudoaligned [quant] estimated average fragment length: 267.873 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR12161361.ke.tsv 34699 SRR12161361.se.tsv 87100 total ==> SRR12161361.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.13 183 11.5837 Potri.005G024800.1.v4.1 1035 768.127 122 17.6052 Potri.004G059700.1.v4.1 961 694.246 22 3.51256 Potri.007G009000.2.v4.1 1416 1149.13 0 0 Potri.003G141000.2.v4.1 2943 2676.13 166 6.87568 Potri.016G087400.1.v4.1 270 74.191 415 620.028 Potri.015G069301.1.v4.1 564 311.534 0 0 Potri.010G195200.1.v4.1 1773 1506.13 1 0.0735958 Potri.012G127500.1.v4.1 977 710.192 864 134.85 ==> SRR12161361.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 103 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12161361 completed mapping pipeline successfully