Starting /dee2/code/volunteer_pipeline.sh SRR12161362 current disk space = 3087973810176 free memory = 1425239084 SRR12161362 SRAfilesize 6710684dcc6a18ee0c400ff15cb33263 SRR12161362.sra SRR12161362.sra file validated SRR12161362 is paired end SRR12161362 is conventional basespace SRR12161362 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161362_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52025 37.0 37.0 37.0 37.0 37.0 2 36.499 37.0 37.0 37.0 37.0 37.0 3 36.515 37.0 37.0 37.0 37.0 37.0 4 36.558 37.0 37.0 37.0 37.0 37.0 5 36.586 37.0 37.0 37.0 37.0 37.0 6 36.623 37.0 37.0 37.0 37.0 37.0 7 36.465 37.0 37.0 37.0 37.0 37.0 8 36.627 37.0 37.0 37.0 37.0 37.0 9 36.5855 37.0 37.0 37.0 37.0 37.0 10-14 36.595800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5231 37.0 37.0 37.0 37.0 37.0 20-24 36.513099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.5064 37.0 37.0 37.0 37.0 37.0 30-34 36.4441 37.0 37.0 37.0 37.0 37.0 35-39 36.393600000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.373 37.0 37.0 37.0 37.0 37.0 45-49 36.4228 37.0 37.0 37.0 37.0 37.0 50-54 36.3814 37.0 37.0 37.0 37.0 37.0 55-59 36.3572 37.0 37.0 37.0 37.0 37.0 60-64 36.4028 37.0 37.0 37.0 37.0 37.0 65-69 36.3114 37.0 37.0 37.0 37.0 37.0 70-74 36.3442 37.0 37.0 37.0 37.0 37.0 75-79 36.3287 37.0 37.0 37.0 37.0 37.0 80-84 36.335300000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2511 37.0 37.0 37.0 37.0 37.0 90-94 36.289300000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.275999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.263799999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1691 37.0 37.0 37.0 37.0 37.0 110-114 36.1874 37.0 37.0 37.0 37.0 37.0 115-119 36.1382 37.0 37.0 37.0 37.0 37.0 120-124 36.131299999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0835 37.0 37.0 37.0 37.0 37.0 130-134 36.087 37.0 37.0 37.0 37.0 37.0 135-139 35.9922 37.0 37.0 37.0 37.0 37.0 140-144 35.9765 37.0 37.0 37.0 37.0 37.0 145-149 35.9216 37.0 37.0 37.0 37.0 37.0 150-151 35.817 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 5.0 26 1.0 27 8.0 28 8.0 29 20.0 30 25.0 31 40.0 32 45.0 33 68.0 34 107.0 35 290.0 36 2977.0 37 405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.886471617904476 11.527881970492624 5.701425356339085 36.884221055263815 2 19.025 12.325 35.725 32.925 3 16.375 16.775000000000002 29.599999999999998 37.25 4 21.775 25.25 24.325 28.65 5 21.8 30.099999999999998 24.5 23.599999999999998 6 18.45 36.475 23.45 21.625 7 14.549999999999999 26.674999999999997 42.6 16.175 8 17.125 25.224999999999998 32.550000000000004 25.1 9 16.575 23.974999999999998 36.0 23.45 10-14 19.61 29.62 28.084999999999997 22.685 15-19 19.45 27.99 28.54 24.02 20-24 19.54 28.615000000000002 28.705000000000002 23.14 25-29 19.35 28.67 27.994999999999997 23.985 30-34 19.115 28.244999999999997 28.15 24.490000000000002 35-39 19.275000000000002 28.07 28.29 24.365000000000002 40-44 19.814999999999998 29.39 27.08 23.715 45-49 20.080000000000002 28.895 27.63 23.395 50-54 20.665 28.694999999999997 27.565 23.075000000000003 55-59 19.950000000000003 28.549999999999997 27.77 23.73 60-64 19.580000000000002 28.735 27.005000000000003 24.68 65-69 19.72 29.03 27.250000000000004 24.0 70-74 20.825 28.815 27.41 22.95 75-79 19.830000000000002 28.235 28.04 23.895 80-84 20.175 29.175 27.155 23.494999999999997 85-89 20.16 28.435 27.825 23.580000000000002 90-94 20.27 28.044999999999998 27.965 23.72 95-99 19.975 28.38 27.644999999999996 24.0 100-104 20.275000000000002 28.749999999999996 27.950000000000003 23.025000000000002 105-109 19.919999999999998 27.794999999999998 28.134999999999998 24.15 110-114 20.51 28.21 27.73 23.549999999999997 115-119 20.525 29.26 27.185 23.03 120-124 20.349999999999998 28.775000000000002 27.68 23.195 125-129 20.865000000000002 28.965000000000003 26.99 23.18 130-134 21.18 28.34 27.48 23.0 135-139 20.5 28.87 26.905 23.724999999999998 140-144 20.485 28.815 26.889999999999997 23.810000000000002 145-149 20.44 28.715000000000003 27.305 23.54 150-151 20.7 27.787499999999998 27.325 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.0 20 0.5 21 0.0 22 0.5 23 2.0 24 4.0 25 4.5 26 4.5 27 9.5 28 9.5 29 11.5 30 21.5 31 23.0 32 34.5 33 58.5 34 58.0 35 57.5 36 90.0 37 110.0 38 125.0 39 153.0 40 185.5 41 231.0 42 248.0 43 251.5 44 275.5 45 268.5 46 255.0 47 260.0 48 242.0 49 195.5 50 161.5 51 140.0 52 117.0 53 97.0 54 69.0 55 50.0 56 46.0 57 40.5 58 24.5 59 16.0 60 14.5 61 10.0 62 5.5 63 2.5 64 1.5 65 2.0 66 2.5 67 2.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.64655632674854 87.7 2 5.95301655098772 11.15 3 0.37373198077949815 1.05 4 0.026695141484249865 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0125 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.037500000000000006 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.05 0.0 0.0 0.025 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.0625 0.0 0.0 0.025 0.0 98-99 0.125 0.0 0.0 0.025 0.0 100-101 0.125 0.0 0.0 0.025 0.0 102-103 0.1375 0.0 0.0 0.025 0.0 104-105 0.175 0.0 0.0 0.025 0.0 106-107 0.175 0.0 0.0 0.025 0.0 108-109 0.1875 0.0 0.0 0.025 0.0 110-111 0.30000000000000004 0.0 0.0 0.025 0.0 112-113 0.44999999999999996 0.0 0.0 0.025 0.0 114-115 0.5 0.0 0.0 0.025 0.0 116-117 0.5874999999999999 0.0 0.0 0.025 0.0 118-119 0.675 0.0 0.0 0.025 0.0 120-121 0.7375 0.0 0.0 0.025 0.0 122-123 0.8500000000000001 0.0 0.0 0.025 0.0 124-125 1.1124999999999998 0.0 0.0 0.025 0.0 126-127 1.3875 0.0 0.0 0.025 0.0 128-129 1.625 0.0 0.0 0.025 0.0 130-131 1.8 0.0 0.0 0.025 0.0 132-133 1.9500000000000002 0.0 0.0 0.025 0.0 134-135 2.1125 0.0 0.0 0.025 0.0 136-137 2.4 0.0 0.0 0.025 0.0 138-139 2.8625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAATA 10 0.006830828 145.0 9 GCATTTA 10 0.006830828 145.0 3 >>END_MODULE SRR12161362 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161362_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9995 37.0 37.0 37.0 37.0 37.0 2 35.689 37.0 37.0 37.0 37.0 37.0 3 35.984 37.0 37.0 37.0 37.0 37.0 4 35.985 37.0 37.0 37.0 37.0 37.0 5 36.05 37.0 37.0 37.0 37.0 37.0 6 36.109 37.0 37.0 37.0 37.0 37.0 7 35.9475 37.0 37.0 37.0 37.0 37.0 8 36.1195 37.0 37.0 37.0 37.0 37.0 9 36.113 37.0 37.0 37.0 37.0 37.0 10-14 36.108000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1173 37.0 37.0 37.0 37.0 37.0 20-24 36.0658 37.0 37.0 37.0 37.0 37.0 25-29 35.9929 37.0 37.0 37.0 37.0 37.0 30-34 35.9965 37.0 37.0 37.0 37.0 37.0 35-39 36.0133 37.0 37.0 37.0 37.0 37.0 40-44 35.94970000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.932100000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.9443 37.0 37.0 37.0 37.0 37.0 55-59 35.865899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7474 37.0 37.0 37.0 37.0 37.0 65-69 35.813300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.773399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6822 37.0 37.0 37.0 37.0 37.0 80-84 35.7422 37.0 37.0 37.0 37.0 37.0 85-89 35.6746 37.0 37.0 37.0 37.0 37.0 90-94 35.5918 37.0 37.0 37.0 37.0 37.0 95-99 35.5947 37.0 37.0 37.0 37.0 37.0 100-104 35.605399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.583000000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.5273 37.0 37.0 37.0 37.0 37.0 115-119 35.5335 37.0 37.0 37.0 37.0 37.0 120-124 35.457 37.0 37.0 37.0 37.0 37.0 125-129 35.4327 37.0 37.0 37.0 37.0 37.0 130-134 35.3324 37.0 37.0 37.0 34.6 37.0 135-139 35.4316 37.0 37.0 37.0 37.0 37.0 140-144 35.305 37.0 37.0 37.0 34.6 37.0 145-149 35.3588 37.0 37.0 37.0 34.6 37.0 150-151 34.88675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 1.0 15 2.0 16 0.0 17 0.0 18 3.0 19 1.0 20 1.0 21 3.0 22 2.0 23 5.0 24 6.0 25 16.0 26 6.0 27 16.0 28 17.0 29 20.0 30 32.0 31 45.0 32 95.0 33 127.0 34 245.0 35 644.0 36 2516.0 37 193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.075 24.5 8.674999999999999 20.75 2 27.825 26.1 29.925 16.150000000000002 3 21.825 27.950000000000003 31.95 18.275 4 22.725 35.449999999999996 24.375 17.45 5 24.8 36.8 20.75 17.65 6 20.549999999999997 39.675 21.425 18.35 7 18.85 23.075000000000003 37.9 20.175 8 21.475 26.25 27.750000000000004 24.525 9 22.775000000000002 23.674999999999997 30.575000000000003 22.975 10-14 22.795 30.145 26.505000000000003 20.555 15-19 22.98 27.67 28.355000000000004 20.995 20-24 22.835 29.054999999999996 27.495000000000005 20.615 25-29 22.545 28.725 28.28 20.45 30-34 22.900000000000002 27.875 28.21 21.015 35-39 23.055 27.810000000000002 28.215 20.919999999999998 40-44 23.015 27.96 27.83 21.195 45-49 22.48 28.244999999999997 28.349999999999998 20.925 50-54 22.64 28.155 28.044999999999998 21.16 55-59 23.465 28.035 27.66 20.84 60-64 23.26 27.6 28.000000000000004 21.14 65-69 23.465 28.294999999999998 28.175 20.064999999999998 70-74 23.45 28.42 27.125 21.005 75-79 22.95 28.384999999999998 27.975 20.69 80-84 23.005 28.025 28.33 20.64 85-89 23.93 27.575 28.26 20.235 90-94 23.810000000000002 27.794999999999998 27.744999999999997 20.65 95-99 23.635 27.555000000000003 27.845 20.965 100-104 23.799999999999997 28.060000000000002 27.92 20.22 105-109 23.93 28.105000000000004 27.85 20.115 110-114 23.64 28.199999999999996 28.015 20.145 115-119 24.435000000000002 28.23 27.505000000000003 19.830000000000002 120-124 23.794999999999998 27.38 28.455000000000002 20.369999999999997 125-129 24.615000000000002 27.779999999999998 27.72 19.885 130-134 23.855 28.405 27.76 19.98 135-139 24.035 28.050000000000004 27.83 20.085 140-144 24.125 28.215 27.155 20.505000000000003 145-149 24.615000000000002 28.044999999999998 27.455000000000002 19.885 150-151 23.875 27.425 28.050000000000004 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.5 24 2.5 25 2.0 26 4.5 27 6.0 28 8.5 29 15.0 30 16.5 31 20.5 32 29.0 33 41.5 34 60.5 35 82.0 36 91.0 37 106.5 38 147.5 39 180.5 40 200.5 41 222.0 42 248.5 43 263.0 44 265.5 45 267.0 46 254.5 47 229.0 48 209.5 49 197.5 50 181.0 51 141.5 52 109.0 53 91.0 54 74.5 55 57.0 56 43.0 57 35.5 58 19.5 59 16.5 60 13.5 61 6.0 62 5.0 63 3.5 64 2.5 65 2.0 66 1.5 67 1.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.09103007718925 88.375 2 5.509715198296513 10.35 3 0.2927867979771094 0.8250000000000001 4 0.07985094490284801 0.3 5 0.0 0.0 6 0.026616981634282673 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.35 0.0 0.0 0.0 0.0 138-139 2.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra Read 1008840 spots for SRR12161362.sra Written 1008840 spots for SRR12161362.sra Read 1008824 spots for SRR12161362.sra Written 1008824 spots for SRR12161362.sra SRR ids: ['SRR12161362.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z5qui7x7 SRR12161362.sra spots: 20176496 blocks: [[1, 1008824], [1008825, 2017648], [2017649, 3026472], [3026473, 4035296], [4035297, 5044120], [5044121, 6052944], [6052945, 7061768], [7061769, 8070592], [8070593, 9079416], [9079417, 10088240], [10088241, 11097064], [11097065, 12105888], [12105889, 13114712], [13114713, 14123536], [14123537, 15132360], [15132361, 16141184], [16141185, 17150008], [17150009, 18158832], [18158833, 19167656], [19167657, 20176496]] SRR12161362 file size 6835155 SRR12161362 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161362 SRR12161362_1.fastq SRR12161362_2.fastq Input file: SRR12161362_1.fastq Paired file: SRR12161362_2.fastq trimmed: SRR12161362-trimmed-pair1.fastq, SRR12161362-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:30:29 2025 >> started Thu Feb 13 18:30:51 2025 >> done (22.572s) 20176496 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 2639 ( 0.01%) empty read pairs filtered out after trimming by size control 20173797 (99.99%) read pairs available; of these: 1081867 ( 5.36%) trimmed read pairs available after processing 19091930 (94.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 7 0.00% 21 10 0.00% 22 6 0.00% 23 13 0.00% 24 11 0.00% 25 21 0.00% 26 15 0.00% 27 19 0.00% 28 10 0.00% 29 12 0.00% 30 9 0.00% 31 16 0.00% 32 14 0.00% 33 20 0.00% 34 14 0.00% 35 18 0.00% 36 9 0.00% 37 20 0.00% 38 15 0.00% 39 19 0.00% 40 19 0.00% 41 25 0.00% 42 16 0.00% 43 15 0.00% 44 27 0.00% 45 39 0.00% 46 28 0.00% 47 27 0.00% 48 26 0.00% 49 37 0.00% 50 40 0.00% 51 34 0.00% 52 43 0.00% 53 41 0.00% 54 36 0.00% 55 44 0.00% 56 40 0.00% 57 55 0.00% 58 58 0.00% 59 75 0.00% 60 98 0.00% 61 97 0.00% 62 85 0.00% 63 106 0.00% 64 107 0.00% 65 108 0.00% 66 154 0.00% 67 135 0.00% 68 153 0.00% 69 176 0.00% 70 223 0.00% 71 217 0.00% 72 294 0.00% 73 289 0.00% 74 335 0.00% 75 352 0.00% 76 412 0.00% 77 477 0.00% 78 526 0.00% 79 516 0.00% 80 683 0.00% 81 724 0.00% 82 793 0.00% 83 939 0.00% 84 1066 0.01% 85 1124 0.01% 86 1309 0.01% 87 1428 0.01% 88 1538 0.01% 89 1663 0.01% 90 1918 0.01% 91 2105 0.01% 92 2424 0.01% 93 2543 0.01% 94 2871 0.01% 95 3285 0.02% 96 3365 0.02% 97 3590 0.02% 98 3943 0.02% 99 4248 0.02% 100 4607 0.02% 101 4983 0.02% 102 5566 0.03% 103 5922 0.03% 104 6389 0.03% 105 6856 0.03% 106 7224 0.04% 107 7674 0.04% 108 7901 0.04% 109 8344 0.04% 110 9005 0.04% 111 9694 0.05% 112 10308 0.05% 113 10618 0.05% 114 11608 0.06% 115 11990 0.06% 116 12598 0.06% 117 13187 0.07% 118 13823 0.07% 119 14015 0.07% 120 15044 0.07% 121 15475 0.08% 122 16466 0.08% 123 17271 0.09% 124 18409 0.09% 125 18675 0.09% 126 19843 0.10% 127 20241 0.10% 128 20750 0.10% 129 21494 0.11% 130 22429 0.11% 131 23067 0.11% 132 24052 0.12% 133 25243 0.13% 134 26116 0.13% 135 27458 0.14% 136 28145 0.14% 137 28543 0.14% 138 29340 0.15% 139 30524 0.15% 140 31228 0.15% 141 32071 0.16% 142 33240 0.16% 143 34157 0.17% 144 36108 0.18% 145 37179 0.18% 146 38391 0.19% 147 39197 0.19% 148 39633 0.20% 149 40388 0.20% 150 41945 0.21% 151 19091930 94.64% 20173797 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.35 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=50.68 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.3 sequence=CCAACAAAGCAGCAGGAAATACAAGACGCTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=33 prefix-density=0.45 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=64.98 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=9.3 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR12161362 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:31:36 Started mapping on | Feb 13 18:31:36 Finished on | Feb 13 18:33:39 Mapping speed, Million of reads per hour | 590.45 Number of input reads | 20173797 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18818437 Uniquely mapped reads % | 93.28% Average mapped length | 298.41 Number of splices: Total | 18837687 Number of splices: Annotated (sjdb) | 18341849 Number of splices: GT/AG | 18465482 Number of splices: GC/AG | 296173 Number of splices: AT/AC | 14866 Number of splices: Non-canonical | 61166 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507791 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 110642 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 847569 847569 847569 N_multimapping 507791 507791 507791 N_noFeature 751703 18577123 825939 N_ambiguous 285933 1359 118167 UnstrandedReadsAssigned:17780801 PositiveStrandReadsAssigned:239955 NegativeStrandReadsAssigned:17874331 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161362 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161362-trimmed-pair1.fastq SRR12161362-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,173,797 reads, 17,961,936 reads pseudoaligned [quant] estimated average fragment length: 280.621 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR12161362.ke.tsv 34699 SRR12161362.se.tsv 87100 total ==> SRR12161362.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.38 785 21.5359 Potri.005G024800.1.v4.1 1035 755.379 494 31.1889 Potri.004G059700.1.v4.1 961 681.627 3 0.2099 Potri.007G009000.2.v4.1 1416 1136.38 0 0 Potri.003G141000.2.v4.1 2943 2663.38 1019 18.2465 Potri.016G087400.1.v4.1 270 72.1665 1223 808.218 Potri.015G069301.1.v4.1 564 301.988 0 0 Potri.010G195200.1.v4.1 1773 1493.38 39 1.24547 Potri.012G127500.1.v4.1 977 697.478 417 28.513 ==> SRR12161362.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 433 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 26 SRR12161362 completed mapping pipeline successfully