Starting /dee2/code/volunteer_pipeline.sh SRR12161363 current disk space = 3088141877248 free memory = 1405270296 SRR12161363 SRAfilesize 674abea7b8650d110885f5c19b7d07f0 SRR12161363.sra SRR12161363.sra file validated SRR12161363 is paired end SRR12161363 is conventional basespace SRR12161363 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.55775 37.0 37.0 37.0 37.0 37.0 2 36.3965 37.0 37.0 37.0 37.0 37.0 3 36.422 37.0 37.0 37.0 37.0 37.0 4 36.572 37.0 37.0 37.0 37.0 37.0 5 36.591 37.0 37.0 37.0 37.0 37.0 6 36.5565 37.0 37.0 37.0 37.0 37.0 7 36.4595 37.0 37.0 37.0 37.0 37.0 8 36.5645 37.0 37.0 37.0 37.0 37.0 9 36.4915 37.0 37.0 37.0 37.0 37.0 10-14 36.5445 37.0 37.0 37.0 37.0 37.0 15-19 36.527 37.0 37.0 37.0 37.0 37.0 20-24 36.4834 37.0 37.0 37.0 37.0 37.0 25-29 36.4491 37.0 37.0 37.0 37.0 37.0 30-34 36.4533 37.0 37.0 37.0 37.0 37.0 35-39 36.4154 37.0 37.0 37.0 37.0 37.0 40-44 36.362300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4002 37.0 37.0 37.0 37.0 37.0 50-54 36.318 37.0 37.0 37.0 37.0 37.0 55-59 36.287 37.0 37.0 37.0 37.0 37.0 60-64 36.2956 37.0 37.0 37.0 37.0 37.0 65-69 36.347899999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2822 37.0 37.0 37.0 37.0 37.0 75-79 36.243900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.298700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2119 37.0 37.0 37.0 37.0 37.0 90-94 36.2775 37.0 37.0 37.0 37.0 37.0 95-99 36.2176 37.0 37.0 37.0 37.0 37.0 100-104 36.2222 37.0 37.0 37.0 37.0 37.0 105-109 36.0735 37.0 37.0 37.0 37.0 37.0 110-114 36.11749999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.054 37.0 37.0 37.0 37.0 37.0 120-124 36.0903 37.0 37.0 37.0 37.0 37.0 125-129 36.0654 37.0 37.0 37.0 37.0 37.0 130-134 36.0477 37.0 37.0 37.0 37.0 37.0 135-139 35.969899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8914 37.0 37.0 37.0 37.0 37.0 145-149 35.88629999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.639250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 8.0 28 10.0 29 21.0 30 29.0 31 38.0 32 60.0 33 82.0 34 115.0 35 304.0 36 2912.0 37 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.485871467866964 11.977994498624655 5.85146286571643 38.68467116779195 2 19.1 12.65 35.825 32.425 3 17.224999999999998 16.0 27.775 39.0 4 22.025 24.2 24.525 29.25 5 23.45 29.825000000000003 23.9 22.825 6 19.275000000000002 33.95 24.425 22.35 7 16.75 24.8 40.875 17.575 8 17.675 26.724999999999998 31.075000000000003 24.525 9 16.675 24.2 36.35 22.775000000000002 10-14 19.0 29.360000000000003 28.084999999999997 23.555 15-19 19.55 27.700000000000003 28.4 24.349999999999998 20-24 20.105 28.16 28.349999999999998 23.385 25-29 19.84 27.875 28.575 23.71 30-34 19.705000000000002 28.765 27.425 24.104999999999997 35-39 20.275000000000002 28.77 27.284999999999997 23.669999999999998 40-44 19.665 28.389999999999997 27.700000000000003 24.245 45-49 20.015 28.405 27.389999999999997 24.19 50-54 19.86 27.775 27.79 24.575 55-59 20.135 28.665000000000003 27.345000000000002 23.855 60-64 19.91 27.93 27.96 24.2 65-69 20.175 28.275 27.575 23.974999999999998 70-74 20.095 28.720000000000002 27.575 23.61 75-79 19.865 28.315 27.575 24.245 80-84 20.65 27.884999999999998 27.47 23.995 85-89 19.794999999999998 28.904999999999998 27.565 23.735 90-94 20.34 28.08 27.63 23.95 95-99 20.535 27.79 27.97 23.705000000000002 100-104 20.035 28.835 27.32 23.810000000000002 105-109 20.085 28.449999999999996 27.384999999999998 24.08 110-114 20.845 28.605000000000004 27.29 23.26 115-119 21.005 27.994999999999997 27.560000000000002 23.44 120-124 20.485 28.585 27.325 23.605 125-129 20.77 27.99 27.595 23.645 130-134 19.645000000000003 28.044999999999998 28.275 24.035 135-139 20.27 27.625 28.310000000000002 23.794999999999998 140-144 20.93 27.62 27.705000000000002 23.745 145-149 20.560000000000002 27.91 27.615000000000002 23.915 150-151 20.075000000000003 28.849999999999998 27.3875 23.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.0 24 2.0 25 2.0 26 2.0 27 2.0 28 5.0 29 13.5 30 19.0 31 22.0 32 25.5 33 37.0 34 46.5 35 64.5 36 94.0 37 119.0 38 140.5 39 157.0 40 178.0 41 192.5 42 209.5 43 235.5 44 262.0 45 261.5 46 266.5 47 276.5 48 268.5 49 235.0 50 186.5 51 154.5 52 118.0 53 91.5 54 73.5 55 54.5 56 35.5 57 31.5 58 33.5 59 23.5 60 18.0 61 12.5 62 6.0 63 6.0 64 4.5 65 2.5 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.54973821989529 91.25 2 4.214659685863874 8.05 3 0.20942408376963353 0.6 4 0.026178010471204192 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 2.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161363 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161363_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.267 37.0 37.0 37.0 37.0 37.0 2 35.8965 37.0 37.0 37.0 37.0 37.0 3 35.928 37.0 37.0 37.0 37.0 37.0 4 36.076 37.0 37.0 37.0 37.0 37.0 5 36.1095 37.0 37.0 37.0 37.0 37.0 6 36.1285 37.0 37.0 37.0 37.0 37.0 7 36.0755 37.0 37.0 37.0 37.0 37.0 8 36.1505 37.0 37.0 37.0 37.0 37.0 9 36.1395 37.0 37.0 37.0 37.0 37.0 10-14 36.1868 37.0 37.0 37.0 37.0 37.0 15-19 36.1372 37.0 37.0 37.0 37.0 37.0 20-24 36.1416 37.0 37.0 37.0 37.0 37.0 25-29 36.1571 37.0 37.0 37.0 37.0 37.0 30-34 36.0869 37.0 37.0 37.0 37.0 37.0 35-39 36.0981 37.0 37.0 37.0 37.0 37.0 40-44 36.0221 37.0 37.0 37.0 37.0 37.0 45-49 36.004900000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.011199999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.978300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.909299999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9294 37.0 37.0 37.0 37.0 37.0 70-74 35.795 37.0 37.0 37.0 37.0 37.0 75-79 35.8097 37.0 37.0 37.0 37.0 37.0 80-84 35.8668 37.0 37.0 37.0 37.0 37.0 85-89 35.838499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8005 37.0 37.0 37.0 37.0 37.0 95-99 35.7748 37.0 37.0 37.0 37.0 37.0 100-104 35.789899999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7358 37.0 37.0 37.0 37.0 37.0 110-114 35.661300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6902 37.0 37.0 37.0 37.0 37.0 120-124 35.6407 37.0 37.0 37.0 37.0 37.0 125-129 35.521100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.4465 37.0 37.0 37.0 37.0 37.0 135-139 35.47710000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.47070000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.4573 37.0 37.0 37.0 37.0 37.0 150-151 35.039500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 0.0 16 0.0 17 2.0 18 0.0 19 2.0 20 1.0 21 4.0 22 7.0 23 6.0 24 8.0 25 7.0 26 4.0 27 12.0 28 18.0 29 24.0 30 32.0 31 54.0 32 59.0 33 124.0 34 196.0 35 564.0 36 2610.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6 24.7 9.15 24.55 2 26.150000000000002 29.049999999999997 29.599999999999998 15.2 3 20.3 27.3 33.225 19.175 4 22.775000000000002 34.65 23.775 18.8 5 25.2 37.1 22.5 15.2 6 21.125 40.050000000000004 21.7 17.125 7 20.625 21.925 38.4 19.05 8 21.25 27.525 27.525 23.7 9 21.5 26.6 28.725 23.175 10-14 23.225 30.145 25.915 20.715 15-19 22.59 29.25 27.334999999999997 20.825 20-24 22.925 29.054999999999996 27.415 20.605 25-29 22.96 28.52 27.785 20.735 30-34 22.425 28.77 27.83 20.974999999999998 35-39 22.220000000000002 28.185 28.34 21.255 40-44 23.11 27.67 28.395 20.825 45-49 23.225 28.02 27.944999999999997 20.810000000000002 50-54 22.805 28.255000000000003 27.875 21.065 55-59 22.57 28.01 28.17 21.25 60-64 23.3 26.86 28.105000000000004 21.735 65-69 23.25 27.275 27.994999999999997 21.48 70-74 23.195 28.415000000000003 27.655 20.735 75-79 23.09 28.33 27.029999999999998 21.55 80-84 23.24 28.470000000000002 27.055 21.235 85-89 23.54 27.900000000000002 27.284999999999997 21.275 90-94 23.375 27.575 27.515 21.535 95-99 23.41 27.735 27.83 21.025 100-104 23.105 28.18 27.85 20.865000000000002 105-109 23.195 27.615000000000002 28.34 20.849999999999998 110-114 23.535 28.535 27.155 20.775 115-119 23.835 27.639999999999997 27.134999999999998 21.39 120-124 23.46 28.285 27.805000000000003 20.45 125-129 23.5 27.305 28.435 20.76 130-134 23.275000000000002 28.17 27.365000000000002 21.19 135-139 23.735 28.050000000000004 27.810000000000002 20.405 140-144 23.515 27.889999999999997 27.794999999999998 20.8 145-149 24.14 27.925 26.875 21.060000000000002 150-151 24.85 27.3625 28.0625 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.5 19 1.0 20 2.0 21 3.5 22 3.0 23 3.5 24 5.0 25 4.5 26 6.5 27 10.5 28 11.5 29 13.5 30 16.0 31 18.0 32 24.0 33 39.0 34 49.5 35 58.5 36 77.5 37 97.5 38 127.5 39 164.0 40 204.5 41 241.5 42 244.5 43 252.0 44 255.5 45 258.0 46 272.5 47 267.0 48 234.5 49 222.5 50 189.0 51 121.5 52 102.0 53 89.5 54 76.5 55 64.5 56 46.5 57 32.0 58 17.0 59 12.0 60 13.5 61 10.5 62 7.0 63 5.5 64 5.5 65 3.0 66 2.5 67 1.0 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52121529596647 91.175 2 4.243059193294918 8.1 3 0.18334206390780514 0.525 4 0.05238344683080147 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.8625 0.0 0.0 0.0 0.0 138-139 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGGCT 10 0.006830828 145.0 1 TGGGCTT 10 0.006830828 145.0 2 GGGCTTT 10 0.006830828 145.0 3 >>END_MODULE Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716738 spots for SRR12161363.sra Written 716738 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra Read 716734 spots for SRR12161363.sra Written 716734 spots for SRR12161363.sra SRR ids: ['SRR12161363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ec5cn0_d SRR12161363.sra spots: 14334684 blocks: [[1, 716734], [716735, 1433468], [1433469, 2150202], [2150203, 2866936], [2866937, 3583670], [3583671, 4300404], [4300405, 5017138], [5017139, 5733872], [5733873, 6450606], [6450607, 7167340], [7167341, 7884074], [7884075, 8600808], [8600809, 9317542], [9317543, 10034276], [10034277, 10751010], [10751011, 11467744], [11467745, 12184478], [12184479, 12901212], [12901213, 13617946], [13617947, 14334684]] SRR12161363 file size 4849852 SRR12161363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161363 SRR12161363_1.fastq SRR12161363_2.fastq Input file: SRR12161363_1.fastq Paired file: SRR12161363_2.fastq trimmed: SRR12161363-trimmed-pair1.fastq, SRR12161363-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:21:31 2025 >> started Thu Feb 13 18:21:47 2025 >> done (16.057s) 14334684 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 942 ( 0.01%) empty read pairs filtered out after trimming by size control 14333729 (99.99%) read pairs available; of these: 579771 ( 4.04%) trimmed read pairs available after processing 13753958 (95.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 6 0.00% 22 5 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 12 0.00% 28 6 0.00% 29 8 0.00% 30 3 0.00% 31 9 0.00% 32 4 0.00% 33 5 0.00% 34 4 0.00% 35 4 0.00% 36 15 0.00% 37 9 0.00% 38 10 0.00% 39 8 0.00% 40 6 0.00% 41 8 0.00% 42 9 0.00% 43 5 0.00% 44 16 0.00% 45 16 0.00% 46 15 0.00% 47 12 0.00% 48 14 0.00% 49 23 0.00% 50 20 0.00% 51 14 0.00% 52 27 0.00% 53 22 0.00% 54 20 0.00% 55 23 0.00% 56 31 0.00% 57 26 0.00% 58 26 0.00% 59 41 0.00% 60 49 0.00% 61 61 0.00% 62 50 0.00% 63 64 0.00% 64 61 0.00% 65 76 0.00% 66 83 0.00% 67 80 0.00% 68 85 0.00% 69 84 0.00% 70 123 0.00% 71 145 0.00% 72 137 0.00% 73 189 0.00% 74 189 0.00% 75 217 0.00% 76 243 0.00% 77 282 0.00% 78 293 0.00% 79 327 0.00% 80 349 0.00% 81 414 0.00% 82 440 0.00% 83 528 0.00% 84 532 0.00% 85 585 0.00% 86 710 0.00% 87 764 0.01% 88 893 0.01% 89 922 0.01% 90 1063 0.01% 91 1156 0.01% 92 1356 0.01% 93 1382 0.01% 94 1600 0.01% 95 1731 0.01% 96 1832 0.01% 97 1989 0.01% 98 2172 0.02% 99 2243 0.02% 100 2452 0.02% 101 2693 0.02% 102 2866 0.02% 103 3099 0.02% 104 3290 0.02% 105 3568 0.02% 106 3812 0.03% 107 3860 0.03% 108 4140 0.03% 109 4399 0.03% 110 4691 0.03% 111 5052 0.04% 112 5356 0.04% 113 5493 0.04% 114 5833 0.04% 115 6055 0.04% 116 6661 0.05% 117 6688 0.05% 118 7170 0.05% 119 7473 0.05% 120 7846 0.05% 121 8262 0.06% 122 8456 0.06% 123 9066 0.06% 124 9295 0.06% 125 9784 0.07% 126 10309 0.07% 127 10667 0.07% 128 11097 0.08% 129 11456 0.08% 130 12013 0.08% 131 12313 0.09% 132 12756 0.09% 133 13407 0.09% 134 13856 0.10% 135 14442 0.10% 136 14933 0.10% 137 15312 0.11% 138 15787 0.11% 139 16363 0.11% 140 16933 0.12% 141 17581 0.12% 142 18367 0.13% 143 18889 0.13% 144 19595 0.14% 145 20212 0.14% 146 20688 0.14% 147 21369 0.15% 148 22222 0.16% 149 22349 0.16% 150 23493 0.16% 151 13753958 95.96% 14333729 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=10.54 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.5 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=21 prefix-density=0.69 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=32.93 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=7.5 sequence=GCAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12161363 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:22:35 Started mapping on | Feb 13 18:22:35 Finished on | Feb 13 18:24:24 Mapping speed, Million of reads per hour | 473.41 Number of input reads | 14333729 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13507367 Uniquely mapped reads % | 94.23% Average mapped length | 299.16 Number of splices: Total | 13986899 Number of splices: Annotated (sjdb) | 13680618 Number of splices: GT/AG | 13711979 Number of splices: GC/AG | 226065 Number of splices: AT/AC | 10591 Number of splices: Non-canonical | 38264 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322505 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 75259 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 503857 503857 503857 N_multimapping 322505 322505 322505 N_noFeature 475410 13349862 525836 N_ambiguous 200131 978 92471 UnstrandedReadsAssigned:12831826 PositiveStrandReadsAssigned:156527 NegativeStrandReadsAssigned:12889060 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161363 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161363-trimmed-pair1.fastq SRR12161363-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,333,729 reads, 12,940,502 reads pseudoaligned [quant] estimated average fragment length: 289.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR12161363.ke.tsv 34699 SRR12161363.se.tsv 87100 total ==> SRR12161363.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.77 570 23.1573 Potri.005G024800.1.v4.1 1035 746.771 330 31.0547 Potri.004G059700.1.v4.1 961 672.996 37 3.86359 Potri.007G009000.2.v4.1 1416 1127.77 0 0 Potri.003G141000.2.v4.1 2943 2654.77 587 15.5386 Potri.016G087400.1.v4.1 270 68.3193 843 867.133 Potri.015G069301.1.v4.1 564 295.178 0 0 Potri.010G195200.1.v4.1 1773 1484.77 37 1.75123 Potri.012G127500.1.v4.1 977 688.88 254 25.9115 ==> SRR12161363.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 23 SRR12161363 completed mapping pipeline successfully