Starting /dee2/code/volunteer_pipeline.sh SRR12161364 current disk space = 3087861633024 free memory = 1429686152 SRR12161364 SRAfilesize bc2a92c3b8f0b074d48e1858ea06b8a3 SRR12161364.sra SRR12161364.sra file validated SRR12161364 is paired end SRR12161364 is conventional basespace SRR12161364 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.556 37.0 37.0 37.0 37.0 37.0 2 36.4375 37.0 37.0 37.0 37.0 37.0 3 36.507 37.0 37.0 37.0 37.0 37.0 4 36.634 37.0 37.0 37.0 37.0 37.0 5 36.6135 37.0 37.0 37.0 37.0 37.0 6 36.6315 37.0 37.0 37.0 37.0 37.0 7 36.5485 37.0 37.0 37.0 37.0 37.0 8 36.5745 37.0 37.0 37.0 37.0 37.0 9 36.4955 37.0 37.0 37.0 37.0 37.0 10-14 36.5444 37.0 37.0 37.0 37.0 37.0 15-19 36.5382 37.0 37.0 37.0 37.0 37.0 20-24 36.507099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4705 37.0 37.0 37.0 37.0 37.0 30-34 36.5164 37.0 37.0 37.0 37.0 37.0 35-39 36.4833 37.0 37.0 37.0 37.0 37.0 40-44 36.422200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4017 37.0 37.0 37.0 37.0 37.0 50-54 36.368900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3978 37.0 37.0 37.0 37.0 37.0 60-64 36.3895 37.0 37.0 37.0 37.0 37.0 65-69 36.383799999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3809 37.0 37.0 37.0 37.0 37.0 75-79 36.330200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.327999999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3418 37.0 37.0 37.0 37.0 37.0 90-94 36.320100000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2414 37.0 37.0 37.0 37.0 37.0 100-104 36.1976 37.0 37.0 37.0 37.0 37.0 105-109 36.1882 37.0 37.0 37.0 37.0 37.0 110-114 36.139900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1629 37.0 37.0 37.0 37.0 37.0 120-124 36.14119999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0906 37.0 37.0 37.0 37.0 37.0 130-134 36.0364 37.0 37.0 37.0 37.0 37.0 135-139 36.0193 37.0 37.0 37.0 37.0 37.0 140-144 35.9745 37.0 37.0 37.0 37.0 37.0 145-149 35.9557 37.0 37.0 37.0 37.0 37.0 150-151 35.83425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 6.0 27 2.0 28 10.0 29 17.0 30 17.0 31 35.0 32 43.0 33 70.0 34 126.0 35 309.0 36 2938.0 37 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.57378689344672 11.505752876438219 4.577288644322161 36.343171585792895 2 20.599999999999998 11.725 35.725 31.95 3 16.975 18.6 28.625 35.8 4 21.375 26.150000000000002 24.95 27.525 5 22.75 31.8 24.2 21.25 6 19.025 34.699999999999996 24.625 21.65 7 16.0 24.975 41.975 17.05 8 16.675 25.874999999999996 32.074999999999996 25.374999999999996 9 17.2 23.775 34.875 24.15 10-14 20.32 29.409999999999997 27.58 22.689999999999998 15-19 19.74 28.215 27.994999999999997 24.05 20-24 20.48 28.194999999999997 27.439999999999998 23.885 25-29 19.900000000000002 28.34 27.68 24.08 30-34 19.48 29.065 26.950000000000003 24.505 35-39 19.605 28.610000000000003 27.694999999999997 24.09 40-44 20.805 28.43 26.72 24.044999999999998 45-49 20.255000000000003 28.310000000000002 27.66 23.775 50-54 20.29 28.09 27.615000000000002 24.005000000000003 55-59 20.86 27.310000000000002 27.834999999999997 23.995 60-64 20.9 28.23 27.12 23.75 65-69 20.285 28.23 27.150000000000002 24.335 70-74 20.705000000000002 28.415000000000003 26.695 24.185000000000002 75-79 20.165 28.244999999999997 27.700000000000003 23.89 80-84 20.225 27.675 28.185 23.915 85-89 20.43 28.475 27.200000000000003 23.895 90-94 20.95 27.76 27.169999999999998 24.12 95-99 20.28 27.975 27.685 24.060000000000002 100-104 20.87 27.744999999999997 27.71 23.674999999999997 105-109 20.26 27.750000000000004 27.665 24.325 110-114 20.580000000000002 28.095 27.79 23.535 115-119 20.915 27.91 27.415 23.76 120-124 20.91 27.845 27.315 23.93 125-129 20.66 27.689999999999998 27.52 24.13 130-134 21.060000000000002 28.310000000000002 27.37 23.26 135-139 21.14 28.035 26.775 24.05 140-144 20.685000000000002 28.294999999999998 27.265 23.755000000000003 145-149 20.89 27.689999999999998 27.384999999999998 24.035 150-151 21.275 28.7375 26.7625 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 2.0 25 3.0 26 4.5 27 6.5 28 10.5 29 13.5 30 16.5 31 14.5 32 21.5 33 32.0 34 50.5 35 70.0 36 82.0 37 96.5 38 109.0 39 130.5 40 179.5 41 214.0 42 223.5 43 232.5 44 252.0 45 270.0 46 276.5 47 266.5 48 241.0 49 221.0 50 193.5 51 169.5 52 142.0 53 116.0 54 85.0 55 65.5 56 62.0 57 42.5 58 24.5 59 17.5 60 10.5 61 8.0 62 6.5 63 3.5 64 2.0 65 1.5 66 3.0 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 93.69826435246996 87.725 2 5.8210947930574095 10.9 3 0.4539385847797063 1.275 4 0.0267022696929239 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161364 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161364_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2205 37.0 37.0 37.0 37.0 37.0 2 35.783 37.0 37.0 37.0 37.0 37.0 3 35.8795 37.0 37.0 37.0 37.0 37.0 4 35.9435 37.0 37.0 37.0 37.0 37.0 5 35.9885 37.0 37.0 37.0 37.0 37.0 6 36.121 37.0 37.0 37.0 37.0 37.0 7 35.8875 37.0 37.0 37.0 37.0 37.0 8 36.2125 37.0 37.0 37.0 37.0 37.0 9 36.134 37.0 37.0 37.0 37.0 37.0 10-14 36.130900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1631 37.0 37.0 37.0 37.0 37.0 20-24 36.10379999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0875 37.0 37.0 37.0 37.0 37.0 30-34 36.048500000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.998799999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9377 37.0 37.0 37.0 37.0 37.0 45-49 35.988800000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.955000000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8729 37.0 37.0 37.0 37.0 37.0 60-64 35.859700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8095 37.0 37.0 37.0 37.0 37.0 70-74 35.80030000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.6842 37.0 37.0 37.0 37.0 37.0 80-84 35.8194 37.0 37.0 37.0 37.0 37.0 85-89 35.719100000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.7016 37.0 37.0 37.0 37.0 37.0 95-99 35.692699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.721199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7119 37.0 37.0 37.0 37.0 37.0 110-114 35.56009999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.5831 37.0 37.0 37.0 37.0 37.0 120-124 35.6118 37.0 37.0 37.0 37.0 37.0 125-129 35.4226 37.0 37.0 37.0 37.0 37.0 130-134 35.37 37.0 37.0 37.0 32.2 37.0 135-139 35.42700000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.3733 37.0 37.0 37.0 37.0 37.0 145-149 35.405 37.0 37.0 37.0 37.0 37.0 150-151 34.9 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 1.0 15 2.0 16 4.0 17 1.0 18 2.0 19 1.0 20 0.0 21 4.0 22 3.0 23 5.0 24 6.0 25 4.0 26 4.0 27 12.0 28 16.0 29 34.0 30 38.0 31 54.0 32 90.0 33 107.0 34 192.0 35 597.0 36 2624.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 23.925 8.0 22.675 2 28.275 26.125 28.575 17.025000000000002 3 22.025 27.650000000000002 31.7 18.625 4 23.474999999999998 36.325 22.0 18.2 5 24.775 36.449999999999996 22.0 16.775000000000002 6 20.424999999999997 40.375 21.325 17.875 7 21.3 22.375 36.95 19.375 8 20.125 25.974999999999998 28.449999999999996 25.45 9 21.85 25.324999999999996 29.95 22.875 10-14 23.155 28.77 26.88 21.195 15-19 23.0 28.32 27.195000000000004 21.485000000000003 20-24 22.830000000000002 28.46 27.26 21.45 25-29 22.689999999999998 28.794999999999998 26.965 21.55 30-34 23.53 27.800000000000004 28.055000000000003 20.615 35-39 22.24 27.834999999999997 28.28 21.645 40-44 22.75 27.474999999999998 28.395 21.38 45-49 23.35 27.584999999999997 27.615000000000002 21.45 50-54 22.86 27.725 27.87 21.545 55-59 23.395 27.415 27.689999999999998 21.5 60-64 22.495 28.03 27.63 21.845 65-69 22.975 27.250000000000004 27.845 21.93 70-74 23.355 27.125 27.79 21.73 75-79 22.975 27.35 27.955000000000002 21.72 80-84 23.150000000000002 28.015 27.205000000000002 21.63 85-89 23.294999999999998 27.495000000000005 27.63 21.58 90-94 22.994999999999997 27.825 27.42 21.759999999999998 95-99 23.46 28.060000000000002 27.1 21.38 100-104 23.810000000000002 27.384999999999998 27.529999999999998 21.275 105-109 23.86 27.794999999999998 27.305 21.04 110-114 22.965 27.750000000000004 28.08 21.205 115-119 23.375 27.794999999999998 27.04 21.790000000000003 120-124 23.855 27.339999999999996 27.884999999999998 20.919999999999998 125-129 23.825 27.575 27.105 21.495 130-134 23.575 27.825 27.46 21.14 135-139 24.235 27.77 27.034999999999997 20.96 140-144 24.38 27.825 27.279999999999998 20.515 145-149 24.595 27.465 26.775 21.165 150-151 25.412499999999998 28.249999999999996 25.974999999999998 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 1.0 25 2.0 26 2.5 27 3.0 28 8.0 29 13.0 30 14.0 31 17.0 32 25.0 33 35.5 34 47.5 35 59.5 36 79.0 37 116.0 38 139.0 39 154.0 40 183.5 41 195.5 42 234.5 43 275.5 44 266.5 45 263.0 46 265.5 47 244.5 48 222.0 49 201.0 50 175.5 51 146.5 52 116.5 53 98.5 54 90.0 55 82.5 56 63.0 57 42.5 58 28.0 59 18.5 60 11.0 61 9.0 62 9.0 63 6.0 64 3.5 65 2.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 1.0 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.5 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.75837128315028 87.5 2 5.625502276989017 10.5 3 0.42860969729440135 1.2 4 0.08036431824270024 0.3 5 0.10715242432360034 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.175 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGAA 10 0.006830828 145.0 6 >>END_MODULE Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942213 spots for SRR12161364.sra Written 942213 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra Read 942209 spots for SRR12161364.sra Written 942209 spots for SRR12161364.sra SRR ids: ['SRR12161364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0s0s999q SRR12161364.sra spots: 18844184 blocks: [[1, 942209], [942210, 1884418], [1884419, 2826627], [2826628, 3768836], [3768837, 4711045], [4711046, 5653254], [5653255, 6595463], [6595464, 7537672], [7537673, 8479881], [8479882, 9422090], [9422091, 10364299], [10364300, 11306508], [11306509, 12248717], [12248718, 13190926], [13190927, 14133135], [14133136, 15075344], [15075345, 16017553], [16017554, 16959762], [16959763, 17901971], [17901972, 18844184]] SRR12161364 file size 6382377 SRR12161364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161364 SRR12161364_1.fastq SRR12161364_2.fastq Input file: SRR12161364_1.fastq Paired file: SRR12161364_2.fastq trimmed: SRR12161364-trimmed-pair1.fastq, SRR12161364-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:35:15 2025 >> started Thu Feb 13 18:35:34 2025 >> done (19.637s) 18844184 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 1198 ( 0.01%) empty read pairs filtered out after trimming by size control 18842956 (99.99%) read pairs available; of these: 817267 ( 4.34%) trimmed read pairs available after processing 18025689 (95.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 2 0.00% 21 6 0.00% 22 4 0.00% 23 6 0.00% 24 5 0.00% 25 10 0.00% 26 8 0.00% 27 17 0.00% 28 20 0.00% 29 15 0.00% 30 15 0.00% 31 13 0.00% 32 12 0.00% 33 17 0.00% 34 10 0.00% 35 12 0.00% 36 16 0.00% 37 17 0.00% 38 12 0.00% 39 20 0.00% 40 18 0.00% 41 18 0.00% 42 18 0.00% 43 10 0.00% 44 14 0.00% 45 28 0.00% 46 20 0.00% 47 22 0.00% 48 22 0.00% 49 28 0.00% 50 32 0.00% 51 33 0.00% 52 26 0.00% 53 29 0.00% 54 43 0.00% 55 47 0.00% 56 44 0.00% 57 38 0.00% 58 53 0.00% 59 62 0.00% 60 58 0.00% 61 70 0.00% 62 71 0.00% 63 92 0.00% 64 89 0.00% 65 90 0.00% 66 127 0.00% 67 126 0.00% 68 141 0.00% 69 178 0.00% 70 190 0.00% 71 194 0.00% 72 259 0.00% 73 260 0.00% 74 307 0.00% 75 332 0.00% 76 394 0.00% 77 336 0.00% 78 438 0.00% 79 462 0.00% 80 511 0.00% 81 648 0.00% 82 729 0.00% 83 838 0.00% 84 976 0.01% 85 932 0.00% 86 1070 0.01% 87 1206 0.01% 88 1280 0.01% 89 1444 0.01% 90 1577 0.01% 91 1765 0.01% 92 1954 0.01% 93 2154 0.01% 94 2358 0.01% 95 2628 0.01% 96 2678 0.01% 97 2904 0.02% 98 3182 0.02% 99 3457 0.02% 100 3672 0.02% 101 3960 0.02% 102 4297 0.02% 103 4733 0.03% 104 5057 0.03% 105 5260 0.03% 106 5524 0.03% 107 5806 0.03% 108 6074 0.03% 109 6348 0.03% 110 6797 0.04% 111 7145 0.04% 112 7705 0.04% 113 7857 0.04% 114 8543 0.05% 115 8931 0.05% 116 9407 0.05% 117 9997 0.05% 118 10274 0.05% 119 10514 0.06% 120 10907 0.06% 121 11265 0.06% 122 12303 0.07% 123 12827 0.07% 124 13391 0.07% 125 14136 0.08% 126 14610 0.08% 127 15054 0.08% 128 15459 0.08% 129 15998 0.08% 130 16617 0.09% 131 17218 0.09% 132 17786 0.09% 133 18935 0.10% 134 19398 0.10% 135 20487 0.11% 136 21170 0.11% 137 21525 0.11% 138 22306 0.12% 139 22911 0.12% 140 23370 0.12% 141 23900 0.13% 142 24992 0.13% 143 26128 0.14% 144 27366 0.15% 145 28265 0.15% 146 29087 0.15% 147 29398 0.16% 148 30261 0.16% 149 31058 0.16% 150 31882 0.17% 151 18025689 95.66% 18842956 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.98 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=8.94 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.0 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=19 prefix-density=1.21 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=42.20 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12161364 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:36:15 Started mapping on | Feb 13 18:36:15 Finished on | Feb 13 18:37:58 Mapping speed, Million of reads per hour | 658.59 Number of input reads | 18842956 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17617985 Uniquely mapped reads % | 93.50% Average mapped length | 298.95 Number of splices: Total | 18209283 Number of splices: Annotated (sjdb) | 17851737 Number of splices: GT/AG | 17824921 Number of splices: GC/AG | 324089 Number of splices: AT/AC | 13545 Number of splices: Non-canonical | 46728 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458193 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 56583 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 766778 766778 766778 N_multimapping 458193 458193 458193 N_noFeature 505201 17404004 568030 N_ambiguous 260689 846 109099 UnstrandedReadsAssigned:16852095 PositiveStrandReadsAssigned:213135 NegativeStrandReadsAssigned:16940856 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161364 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161364-trimmed-pair1.fastq SRR12161364-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,842,956 reads, 17,056,890 reads pseudoaligned [quant] estimated average fragment length: 283.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR12161364.ke.tsv 34699 SRR12161364.se.tsv 87100 total ==> SRR12161364.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.5 474 13.9027 Potri.005G024800.1.v4.1 1035 752.498 246 16.6408 Potri.004G059700.1.v4.1 961 678.766 61 4.57462 Potri.007G009000.2.v4.1 1416 1133.5 0 0 Potri.003G141000.2.v4.1 2943 2660.5 420.218 8.04002 Potri.016G087400.1.v4.1 270 69.9477 981 713.906 Potri.015G069301.1.v4.1 564 298.528 0 0 Potri.010G195200.1.v4.1 1773 1490.5 5 0.170759 Potri.012G127500.1.v4.1 977 694.592 666 48.8079 ==> SRR12161364.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 132 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR12161364 completed mapping pipeline successfully