Starting /dee2/code/volunteer_pipeline.sh SRR12161365 current disk space = 3088838840320 free memory = 1445000868 SRR12161365 SRAfilesize 578048effa0bf68e937ed89fc8e7c16f SRR12161365.sra SRR12161365.sra file validated SRR12161365 is paired end SRR12161365 is conventional basespace SRR12161365 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.599 37.0 37.0 37.0 37.0 37.0 2 36.458 37.0 37.0 37.0 37.0 37.0 3 36.547 37.0 37.0 37.0 37.0 37.0 4 36.5775 37.0 37.0 37.0 37.0 37.0 5 36.6355 37.0 37.0 37.0 37.0 37.0 6 36.58 37.0 37.0 37.0 37.0 37.0 7 36.5345 37.0 37.0 37.0 37.0 37.0 8 36.572 37.0 37.0 37.0 37.0 37.0 9 36.5485 37.0 37.0 37.0 37.0 37.0 10-14 36.5866 37.0 37.0 37.0 37.0 37.0 15-19 36.5346 37.0 37.0 37.0 37.0 37.0 20-24 36.4956 37.0 37.0 37.0 37.0 37.0 25-29 36.4737 37.0 37.0 37.0 37.0 37.0 30-34 36.4597 37.0 37.0 37.0 37.0 37.0 35-39 36.4226 37.0 37.0 37.0 37.0 37.0 40-44 36.4384 37.0 37.0 37.0 37.0 37.0 45-49 36.4191 37.0 37.0 37.0 37.0 37.0 50-54 36.393800000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.420399999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.4 37.0 37.0 37.0 37.0 37.0 65-69 36.336 37.0 37.0 37.0 37.0 37.0 70-74 36.351800000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2919 37.0 37.0 37.0 37.0 37.0 80-84 36.3264 37.0 37.0 37.0 37.0 37.0 85-89 36.2566 37.0 37.0 37.0 37.0 37.0 90-94 36.2838 37.0 37.0 37.0 37.0 37.0 95-99 36.2047 37.0 37.0 37.0 37.0 37.0 100-104 36.219100000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1907 37.0 37.0 37.0 37.0 37.0 110-114 36.1591 37.0 37.0 37.0 37.0 37.0 115-119 36.1813 37.0 37.0 37.0 37.0 37.0 120-124 36.057 37.0 37.0 37.0 37.0 37.0 125-129 36.071099999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.0526 37.0 37.0 37.0 37.0 37.0 135-139 35.9651 37.0 37.0 37.0 37.0 37.0 140-144 35.9325 37.0 37.0 37.0 37.0 37.0 145-149 35.8471 37.0 37.0 37.0 37.0 37.0 150-151 35.771 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 0.0 25 1.0 26 2.0 27 3.0 28 10.0 29 23.0 30 25.0 31 32.0 32 49.0 33 59.0 34 130.0 35 297.0 36 2974.0 37 392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.345172586293145 11.85592796398199 5.877938969484743 41.92096048024012 2 17.9 12.875 35.625 33.6 3 16.575 15.0 28.025 40.400000000000006 4 22.1 23.275000000000002 23.724999999999998 30.9 5 23.0 29.5 24.625 22.875 6 20.424999999999997 34.35 22.775000000000002 22.45 7 16.150000000000002 26.174999999999997 40.325 17.349999999999998 8 17.575 26.075 31.624999999999996 24.725 9 16.85 23.025000000000002 34.975 25.15 10-14 19.365 30.15 26.86 23.625 15-19 19.725 28.21 27.615000000000002 24.45 20-24 19.81 28.549999999999997 27.900000000000002 23.74 25-29 19.62 28.349999999999998 27.35 24.68 30-34 19.509999999999998 28.15 28.050000000000004 24.29 35-39 20.03 28.444999999999997 27.63 23.895 40-44 19.985 28.689999999999998 26.915 24.41 45-49 20.32 28.52 27.12 24.04 50-54 19.615 28.449999999999996 27.565 24.37 55-59 19.91 28.165000000000003 27.334999999999997 24.59 60-64 20.47 28.88 26.905 23.745 65-69 19.965 28.575 27.150000000000002 24.310000000000002 70-74 20.3 28.515 26.700000000000003 24.485 75-79 20.31 27.810000000000002 27.98 23.9 80-84 20.14 28.335 27.42 24.104999999999997 85-89 20.185 28.51 27.529999999999998 23.775 90-94 20.845 28.355000000000004 26.99 23.810000000000002 95-99 20.155 28.21 28.07 23.565 100-104 20.150000000000002 28.52 26.740000000000002 24.59 105-109 20.745 27.794999999999998 27.415 24.044999999999998 110-114 20.845 28.315 27.77 23.07 115-119 20.575 28.34 27.339999999999996 23.745 120-124 20.54 28.53 27.0 23.93 125-129 20.455000000000002 27.694999999999997 27.52 24.33 130-134 21.12 27.395000000000003 28.095 23.39 135-139 20.87 27.54 27.57 24.02 140-144 20.76 27.71 27.705000000000002 23.825 145-149 20.555 28.17 27.51 23.765 150-151 20.45 28.1625 27.3625 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 1.0 25 4.0 26 8.5 27 10.0 28 10.0 29 10.5 30 15.5 31 28.0 32 36.0 33 40.0 34 53.5 35 72.5 36 84.0 37 97.5 38 115.0 39 130.0 40 166.0 41 204.5 42 240.5 43 244.5 44 242.5 45 249.5 46 250.0 47 252.5 48 231.5 49 212.5 50 184.5 51 160.5 52 140.5 53 114.5 54 97.0 55 73.0 56 53.0 57 43.5 58 32.5 59 26.0 60 22.0 61 15.0 62 6.0 63 2.0 64 2.0 65 4.0 66 4.0 67 1.5 68 1.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.07376185458376 90.225 2 4.504741833508956 8.55 3 0.39515279241306644 1.125 4 0.026343519494204423 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.0625 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.0875 0.025 0.0 0.0 0.0 86-87 0.125 0.025 0.0 0.0 0.0 88-89 0.125 0.025 0.0 0.0 0.0 90-91 0.1375 0.025 0.0 0.0 0.0 92-93 0.1875 0.025 0.0 0.0 0.0 94-95 0.25 0.025 0.0 0.0 0.0 96-97 0.2875 0.025 0.0 0.0 0.0 98-99 0.3375 0.025 0.0 0.0 0.0 100-101 0.3875 0.025 0.0 0.0 0.0 102-103 0.4 0.025 0.0 0.0 0.0 104-105 0.425 0.025 0.0 0.0 0.0 106-107 0.4375 0.025 0.0 0.0 0.0 108-109 0.475 0.025 0.0 0.0 0.0 110-111 0.575 0.025 0.0 0.0 0.0 112-113 0.6875 0.025 0.0 0.0 0.0 114-115 0.8125 0.025 0.0 0.0 0.0 116-117 0.9 0.025 0.0 0.0 0.0 118-119 0.9874999999999999 0.025 0.0 0.0 0.0 120-121 1.125 0.025 0.0 0.0 0.0 122-123 1.2125 0.025 0.0 0.0 0.0 124-125 1.4 0.025 0.0 0.0 0.0 126-127 1.625 0.025 0.0 0.0 0.0 128-129 1.75 0.025 0.0 0.0 0.0 130-131 1.9 0.025 0.0 0.0 0.0 132-133 2.2 0.025 0.0 0.0 0.0 134-135 2.4000000000000004 0.025 0.0 0.0 0.0 136-137 2.6625 0.025 0.0 0.0 0.0 138-139 2.825 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161365 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3455 37.0 37.0 37.0 37.0 37.0 2 36.1185 37.0 37.0 37.0 37.0 37.0 3 36.177 37.0 37.0 37.0 37.0 37.0 4 36.0755 37.0 37.0 37.0 37.0 37.0 5 36.2055 37.0 37.0 37.0 37.0 37.0 6 36.234 37.0 37.0 37.0 37.0 37.0 7 36.1925 37.0 37.0 37.0 37.0 37.0 8 36.2975 37.0 37.0 37.0 37.0 37.0 9 36.283 37.0 37.0 37.0 37.0 37.0 10-14 36.24309999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2249 37.0 37.0 37.0 37.0 37.0 20-24 36.228 37.0 37.0 37.0 37.0 37.0 25-29 36.195899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.178000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1785 37.0 37.0 37.0 37.0 37.0 40-44 36.1406 37.0 37.0 37.0 37.0 37.0 45-49 36.1323 37.0 37.0 37.0 37.0 37.0 50-54 36.0732 37.0 37.0 37.0 37.0 37.0 55-59 36.0419 37.0 37.0 37.0 37.0 37.0 60-64 36.0138 37.0 37.0 37.0 37.0 37.0 65-69 35.9765 37.0 37.0 37.0 37.0 37.0 70-74 35.9476 37.0 37.0 37.0 37.0 37.0 75-79 35.9442 37.0 37.0 37.0 37.0 37.0 80-84 36.017 37.0 37.0 37.0 37.0 37.0 85-89 35.9476 37.0 37.0 37.0 37.0 37.0 90-94 35.897000000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.862199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8421 37.0 37.0 37.0 37.0 37.0 105-109 35.8805 37.0 37.0 37.0 37.0 37.0 110-114 35.756299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7953 37.0 37.0 37.0 37.0 37.0 120-124 35.725199999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.6482 37.0 37.0 37.0 37.0 37.0 130-134 35.5735 37.0 37.0 37.0 37.0 37.0 135-139 35.6662 37.0 37.0 37.0 37.0 37.0 140-144 35.560199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.569900000000004 37.0 37.0 37.0 37.0 37.0 150-151 34.989000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 4.0 16 0.0 17 1.0 18 0.0 19 0.0 20 2.0 21 0.0 22 2.0 23 7.0 24 7.0 25 4.0 26 9.0 27 10.0 28 16.0 29 17.0 30 30.0 31 37.0 32 72.0 33 75.0 34 191.0 35 507.0 36 2697.0 37 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 24.275 9.825000000000001 27.224999999999998 2 28.199999999999996 27.400000000000002 28.125 16.275000000000002 3 20.549999999999997 28.925 30.675 19.85 4 23.875 35.525 22.825 17.775 5 24.25 36.9 21.9 16.950000000000003 6 20.375 39.875 22.650000000000002 17.1 7 20.8 22.95 37.15 19.1 8 20.674999999999997 27.075 26.775 25.474999999999998 9 23.525 23.849999999999998 30.099999999999998 22.525000000000002 10-14 23.535 29.18 26.125 21.16 15-19 23.275000000000002 28.720000000000002 27.305 20.7 20-24 23.055 28.999999999999996 26.935 21.01 25-29 23.02 28.205000000000002 27.544999999999998 21.23 30-34 22.830000000000002 28.16 27.875 21.135 35-39 22.395 27.54 28.17 21.895 40-44 23.07 27.265 28.18 21.485000000000003 45-49 22.715 27.500000000000004 28.02 21.765 50-54 22.720000000000002 28.000000000000004 27.765 21.515 55-59 22.645 27.375 28.134999999999998 21.845 60-64 23.175 28.294999999999998 27.3 21.23 65-69 23.765 27.46 27.47 21.305 70-74 23.974999999999998 28.044999999999998 26.815 21.165 75-79 22.865 28.275 27.345000000000002 21.515 80-84 22.875 27.715 27.365000000000002 22.045 85-89 23.544999999999998 27.66 27.22 21.575 90-94 23.715 28.294999999999998 27.139999999999997 20.849999999999998 95-99 23.555 27.82 27.42 21.205 100-104 23.79 27.765 27.445000000000004 21.0 105-109 23.26 27.37 28.189999999999998 21.18 110-114 23.825 27.68 27.605 20.89 115-119 24.14 27.6 27.565 20.695 120-124 23.455000000000002 27.88 27.605 21.060000000000002 125-129 24.355 28.425 26.68 20.54 130-134 24.605 27.21 27.675 20.51 135-139 24.215 27.22 27.665 20.9 140-144 24.08 28.18 26.8 20.94 145-149 24.495 27.76 27.295 20.45 150-151 25.2375 28.525 26.674999999999997 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.5 8 1.5 9 1.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 2.0 20 1.5 21 1.0 22 1.5 23 3.0 24 3.0 25 3.5 26 4.0 27 4.0 28 4.5 29 8.5 30 15.5 31 19.0 32 27.0 33 37.5 34 50.0 35 63.0 36 73.0 37 101.5 38 136.5 39 154.5 40 184.0 41 214.0 42 229.0 43 234.0 44 252.5 45 276.5 46 269.0 47 249.0 48 247.5 49 218.5 50 167.0 51 138.5 52 117.5 53 107.5 54 91.0 55 76.5 56 57.0 57 35.5 58 27.5 59 23.0 60 16.0 61 10.5 62 7.0 63 2.5 64 3.0 65 3.0 66 2.0 67 1.0 68 1.5 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.20910534674431 89.925 2 4.076230809952356 7.7 3 0.5823186871360508 1.6500000000000001 4 0.07940709370037057 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02646903123345686 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02646903123345686 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 10 0.25 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.2125000000000004 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.7249999999999996 0.0 0.0 0.0 0.0 138-139 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATAG 10 0.006830828 145.0 8 CACTGCA 10 0.006830828 145.0 5 GAGCACT 10 0.006830828 145.0 2 GCACTGC 10 0.006830828 145.0 4 GCATAGC 10 0.006830828 145.0 9 >>END_MODULE Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755644 spots for SRR12161365.sra Written 755644 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra Read 755642 spots for SRR12161365.sra Written 755642 spots for SRR12161365.sra SRR ids: ['SRR12161365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fw3shqlq SRR12161365.sra spots: 15112842 blocks: [[1, 755642], [755643, 1511284], [1511285, 2266926], [2266927, 3022568], [3022569, 3778210], [3778211, 4533852], [4533853, 5289494], [5289495, 6045136], [6045137, 6800778], [6800779, 7556420], [7556421, 8312062], [8312063, 9067704], [9067705, 9823346], [9823347, 10578988], [10578989, 11334630], [11334631, 12090272], [12090273, 12845914], [12845915, 13601556], [13601557, 14357198], [14357199, 15112842]] SRR12161365 file size 5114304 SRR12161365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161365 SRR12161365_1.fastq SRR12161365_2.fastq Input file: SRR12161365_1.fastq Paired file: SRR12161365_2.fastq trimmed: SRR12161365-trimmed-pair1.fastq, SRR12161365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:02:19 2025 >> started Thu Feb 13 16:02:36 2025 >> done (16.826s) 15112842 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 2712 ( 0.02%) empty read pairs filtered out after trimming by size control 15110116 (99.98%) read pairs available; of these: 700369 ( 4.64%) trimmed read pairs available after processing 14409747 (95.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 8 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 8 0.00% 27 8 0.00% 28 13 0.00% 29 8 0.00% 30 7 0.00% 31 13 0.00% 32 10 0.00% 33 2 0.00% 34 7 0.00% 35 13 0.00% 36 11 0.00% 37 6 0.00% 38 7 0.00% 39 11 0.00% 40 10 0.00% 41 18 0.00% 42 20 0.00% 43 9 0.00% 44 16 0.00% 45 20 0.00% 46 12 0.00% 47 21 0.00% 48 18 0.00% 49 17 0.00% 50 16 0.00% 51 32 0.00% 52 36 0.00% 53 21 0.00% 54 26 0.00% 55 19 0.00% 56 24 0.00% 57 34 0.00% 58 34 0.00% 59 42 0.00% 60 47 0.00% 61 60 0.00% 62 53 0.00% 63 78 0.00% 64 63 0.00% 65 86 0.00% 66 103 0.00% 67 99 0.00% 68 115 0.00% 69 145 0.00% 70 176 0.00% 71 178 0.00% 72 177 0.00% 73 242 0.00% 74 244 0.00% 75 296 0.00% 76 307 0.00% 77 327 0.00% 78 365 0.00% 79 417 0.00% 80 434 0.00% 81 560 0.00% 82 611 0.00% 83 703 0.00% 84 774 0.01% 85 831 0.01% 86 937 0.01% 87 1031 0.01% 88 1120 0.01% 89 1281 0.01% 90 1312 0.01% 91 1444 0.01% 92 1639 0.01% 93 1779 0.01% 94 2043 0.01% 95 2174 0.01% 96 2384 0.02% 97 2547 0.02% 98 2781 0.02% 99 2929 0.02% 100 3162 0.02% 101 3278 0.02% 102 3626 0.02% 103 3826 0.03% 104 4125 0.03% 105 4385 0.03% 106 4721 0.03% 107 5006 0.03% 108 5214 0.03% 109 5320 0.04% 110 5740 0.04% 111 6062 0.04% 112 6365 0.04% 113 6677 0.04% 114 7195 0.05% 115 7366 0.05% 116 7738 0.05% 117 8176 0.05% 118 8559 0.06% 119 8925 0.06% 120 9473 0.06% 121 9868 0.07% 122 10483 0.07% 123 10711 0.07% 124 11099 0.07% 125 11538 0.08% 126 12396 0.08% 127 12788 0.08% 128 13408 0.09% 129 13644 0.09% 130 14391 0.10% 131 14730 0.10% 132 15118 0.10% 133 15969 0.11% 134 16710 0.11% 135 17213 0.11% 136 17817 0.12% 137 18499 0.12% 138 18923 0.13% 139 20059 0.13% 140 20454 0.14% 141 21349 0.14% 142 22098 0.15% 143 22602 0.15% 144 23615 0.16% 145 24364 0.16% 146 25048 0.17% 147 25425 0.17% 148 26514 0.18% 149 27043 0.18% 150 28064 0.19% 151 14409747 95.36% 15110116 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=10.23 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.4 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=21 prefix-density=0.99 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=132.67 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=19.6 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCA SRR12161365 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:03:22 Started mapping on | Feb 13 16:03:23 Finished on | Feb 13 16:05:02 Mapping speed, Million of reads per hour | 549.46 Number of input reads | 15110116 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14252421 Uniquely mapped reads % | 94.32% Average mapped length | 299.03 Number of splices: Total | 14544105 Number of splices: Annotated (sjdb) | 14232716 Number of splices: GT/AG | 14253525 Number of splices: GC/AG | 239091 Number of splices: AT/AC | 12242 Number of splices: Non-canonical | 39247 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385949 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 126619 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471746 471746 471746 N_multimapping 385949 385949 385949 N_noFeature 487970 14079599 539056 N_ambiguous 216754 1076 94287 UnstrandedReadsAssigned:13547697 PositiveStrandReadsAssigned:171746 NegativeStrandReadsAssigned:13619078 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161365-trimmed-pair1.fastq SRR12161365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,110,116 reads, 13,703,139 reads pseudoaligned [quant] estimated average fragment length: 275.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR12161365.ke.tsv 34699 SRR12161365.se.tsv 87100 total ==> SRR12161365.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.86 386 13.5132 Potri.005G024800.1.v4.1 1035 760.86 289 23.1887 Potri.004G059700.1.v4.1 961 686.982 77 6.84271 Potri.007G009000.2.v4.1 1416 1141.86 0 0 Potri.003G141000.2.v4.1 2943 2668.86 453.894 10.3827 Potri.016G087400.1.v4.1 270 69.5927 908.597 797.059 Potri.015G069301.1.v4.1 564 303.97 0 0 Potri.010G195200.1.v4.1 1773 1498.86 8 0.325846 Potri.012G127500.1.v4.1 977 702.947 646 56.1039 ==> SRR12161365.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 118 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12161365 completed mapping pipeline successfully