Starting /dee2/code/volunteer_pipeline.sh SRR12161366 current disk space = 3088083529728 free memory = 1416051128 SRR12161366 SRAfilesize 61b5230cec78e23361b216a2c7f317bd SRR12161366.sra SRR12161366.sra file validated SRR12161366 is paired end SRR12161366 is conventional basespace SRR12161366 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4665 37.0 37.0 37.0 37.0 37.0 2 36.4035 37.0 37.0 37.0 37.0 37.0 3 36.486 37.0 37.0 37.0 37.0 37.0 4 36.4675 37.0 37.0 37.0 37.0 37.0 5 36.5705 37.0 37.0 37.0 37.0 37.0 6 36.4605 37.0 37.0 37.0 37.0 37.0 7 36.486 37.0 37.0 37.0 37.0 37.0 8 36.612 37.0 37.0 37.0 37.0 37.0 9 36.495 37.0 37.0 37.0 37.0 37.0 10-14 36.562 37.0 37.0 37.0 37.0 37.0 15-19 36.4904 37.0 37.0 37.0 37.0 37.0 20-24 36.5199 37.0 37.0 37.0 37.0 37.0 25-29 36.45020000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.434999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.416900000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3978 37.0 37.0 37.0 37.0 37.0 45-49 36.365300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.360200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3639 37.0 37.0 37.0 37.0 37.0 60-64 36.3532 37.0 37.0 37.0 37.0 37.0 65-69 36.318799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3119 37.0 37.0 37.0 37.0 37.0 75-79 36.2768 37.0 37.0 37.0 37.0 37.0 80-84 36.287299999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.233799999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2485 37.0 37.0 37.0 37.0 37.0 95-99 36.1859 37.0 37.0 37.0 37.0 37.0 100-104 36.1625 37.0 37.0 37.0 37.0 37.0 105-109 36.1166 37.0 37.0 37.0 37.0 37.0 110-114 36.1308 37.0 37.0 37.0 37.0 37.0 115-119 36.112300000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.066599999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0445 37.0 37.0 37.0 37.0 37.0 130-134 35.9748 37.0 37.0 37.0 37.0 37.0 135-139 35.9286 37.0 37.0 37.0 37.0 37.0 140-144 35.8534 37.0 37.0 37.0 37.0 37.0 145-149 35.785000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.70975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 0.0 26 7.0 27 8.0 28 12.0 29 19.0 30 30.0 31 50.0 32 44.0 33 70.0 34 117.0 35 315.0 36 2948.0 37 378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.775 12.325 6.625 34.275 2 20.225 13.5 35.5 30.775000000000002 3 17.1 17.549999999999997 28.249999999999996 37.1 4 20.424999999999997 26.450000000000003 24.5 28.625 5 22.275 31.974999999999998 25.1 20.65 6 21.775 34.675 22.95 20.599999999999998 7 14.625 27.950000000000003 40.050000000000004 17.375 8 17.1 26.275 31.15 25.474999999999998 9 16.925 23.925 34.975 24.175 10-14 19.77 29.725 26.995 23.51 15-19 20.05 28.139999999999997 27.744999999999997 24.065 20-24 20.135 28.694999999999997 27.575 23.595 25-29 19.75 28.64 27.894999999999996 23.715 30-34 19.794999999999998 28.134999999999998 27.595 24.474999999999998 35-39 20.24 28.915000000000003 27.284999999999997 23.56 40-44 20.05 28.505000000000003 27.084999999999997 24.36 45-49 20.415 28.08 27.66 23.845 50-54 19.925 28.585 27.57 23.919999999999998 55-59 20.04 27.725 27.93 24.305 60-64 20.785 28.310000000000002 27.24 23.665 65-69 19.91 28.549999999999997 27.85 23.69 70-74 20.585 28.225 27.49 23.7 75-79 20.345 28.255000000000003 27.685 23.715 80-84 20.645 28.125 27.435 23.794999999999998 85-89 20.485 28.544999999999998 27.235 23.735 90-94 20.41 28.194999999999997 27.3 24.095 95-99 20.87 28.060000000000002 27.32 23.75 100-104 20.66 28.23 26.979999999999997 24.13 105-109 20.895 28.49 26.985 23.630000000000003 110-114 20.93 28.62 26.855 23.595 115-119 21.29 28.1 27.1 23.51 120-124 20.89 28.1 27.815 23.195 125-129 20.794999999999998 27.46 27.800000000000004 23.945 130-134 21.060000000000002 28.375 26.790000000000003 23.775 135-139 21.465 27.955000000000002 26.765 23.815 140-144 20.49 27.634999999999998 28.12 23.755000000000003 145-149 21.099999999999998 27.91 26.974999999999998 24.015 150-151 21.625 27.712500000000002 27.037499999999998 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 3.5 26 6.5 27 8.5 28 7.5 29 14.0 30 24.0 31 25.5 32 29.5 33 50.5 34 63.5 35 66.0 36 76.0 37 97.0 38 132.5 39 151.0 40 165.5 41 180.0 42 214.5 43 239.0 44 239.0 45 253.0 46 263.0 47 264.0 48 234.5 49 206.0 50 202.0 51 164.5 52 120.0 53 118.5 54 100.5 55 69.0 56 58.0 57 42.0 58 28.0 59 24.0 60 17.5 61 11.0 62 7.0 63 4.5 64 1.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.81892677768965 89.67500000000001 2 4.863864657679091 9.2 3 0.1586042823156225 0.44999999999999996 4 0.10573618821041501 0.4 5 0.026434047052603753 0.125 6 0.026434047052603753 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGTTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTA 6 0.15 No Hit GTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.5875 0.0 0.0 0.0 0.0 136-137 2.8625 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161366 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.238 37.0 37.0 37.0 37.0 37.0 2 35.875 37.0 37.0 37.0 37.0 37.0 3 35.99 37.0 37.0 37.0 37.0 37.0 4 36.1455 37.0 37.0 37.0 37.0 37.0 5 36.2645 37.0 37.0 37.0 37.0 37.0 6 36.1185 37.0 37.0 37.0 37.0 37.0 7 36.102 37.0 37.0 37.0 37.0 37.0 8 36.2455 37.0 37.0 37.0 37.0 37.0 9 36.225 37.0 37.0 37.0 37.0 37.0 10-14 36.159 37.0 37.0 37.0 37.0 37.0 15-19 36.16459999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.133799999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.1032 37.0 37.0 37.0 37.0 37.0 30-34 36.036 37.0 37.0 37.0 37.0 37.0 35-39 36.054700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0304 37.0 37.0 37.0 37.0 37.0 45-49 35.9697 37.0 37.0 37.0 37.0 37.0 50-54 36.0125 37.0 37.0 37.0 37.0 37.0 55-59 35.9217 37.0 37.0 37.0 37.0 37.0 60-64 35.891600000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9166 37.0 37.0 37.0 37.0 37.0 70-74 35.858799999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.785199999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.8497 37.0 37.0 37.0 37.0 37.0 85-89 35.76989999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.788 37.0 37.0 37.0 37.0 37.0 95-99 35.7563 37.0 37.0 37.0 37.0 37.0 100-104 35.7899 37.0 37.0 37.0 37.0 37.0 105-109 35.760400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6449 37.0 37.0 37.0 37.0 37.0 115-119 35.6554 37.0 37.0 37.0 37.0 37.0 120-124 35.6167 37.0 37.0 37.0 37.0 37.0 125-129 35.5356 37.0 37.0 37.0 37.0 37.0 130-134 35.497800000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.563900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.451 37.0 37.0 37.0 37.0 37.0 145-149 35.4307 37.0 37.0 37.0 37.0 37.0 150-151 34.9465 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 5.0 15 5.0 16 0.0 17 3.0 18 2.0 19 3.0 20 2.0 21 2.0 22 2.0 23 4.0 24 9.0 25 5.0 26 11.0 27 12.0 28 13.0 29 22.0 30 31.0 31 39.0 32 66.0 33 99.0 34 195.0 35 490.0 36 2675.0 37 298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.800000000000004 25.025 8.3 21.875 2 26.5 26.974999999999998 29.049999999999997 17.474999999999998 3 20.75 27.800000000000004 33.5 17.95 4 24.474999999999998 33.95 23.125 18.45 5 24.675 38.3 19.925 17.1 6 22.025 39.35 20.65 17.974999999999998 7 21.4 22.400000000000002 36.825 19.375 8 21.525 26.3 27.224999999999998 24.95 9 21.224999999999998 24.85 29.799999999999997 24.125 10-14 23.23 29.5 25.81 21.46 15-19 23.26 28.58 27.195000000000004 20.965 20-24 23.29 28.395 26.810000000000002 21.505 25-29 22.89 28.335 26.96 21.815 30-34 23.11 27.994999999999997 27.54 21.355 35-39 22.53 28.605000000000004 27.189999999999998 21.675 40-44 22.53 27.839999999999996 28.134999999999998 21.495 45-49 23.275000000000002 27.775 27.275 21.675 50-54 23.200000000000003 28.139999999999997 27.435 21.224999999999998 55-59 23.615 27.145000000000003 27.6 21.64 60-64 23.7 27.455000000000002 27.845 21.0 65-69 23.945 26.985 27.445000000000004 21.625 70-74 23.555 28.01 27.11 21.325 75-79 23.64 27.275 27.529999999999998 21.555 80-84 23.64 27.575 26.8 21.985 85-89 23.205000000000002 27.750000000000004 27.250000000000004 21.795 90-94 23.215 27.99 27.08 21.715 95-99 23.835 27.395000000000003 27.339999999999996 21.43 100-104 23.885 28.044999999999998 26.875 21.195 105-109 23.765 27.615000000000002 26.979999999999997 21.64 110-114 24.044999999999998 27.72 27.295 20.94 115-119 24.325 27.800000000000004 26.900000000000002 20.974999999999998 120-124 24.005000000000003 27.155 27.685 21.154999999999998 125-129 24.775 27.425 27.095000000000002 20.705000000000002 130-134 24.834999999999997 28.205000000000002 26.44 20.52 135-139 24.675 27.55 27.065 20.71 140-144 24.485 27.55 27.295 20.669999999999998 145-149 24.75 27.889999999999997 27.034999999999997 20.325 150-151 25.15 28.075 26.7125 20.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 2.5 23 2.5 24 1.0 25 1.5 26 1.0 27 2.5 28 6.0 29 9.5 30 16.5 31 24.0 32 24.0 33 25.5 34 43.0 35 65.0 36 80.0 37 97.5 38 122.5 39 135.5 40 160.5 41 224.5 42 240.5 43 232.5 44 270.5 45 284.0 46 287.0 47 253.5 48 219.5 49 217.5 50 189.5 51 144.0 52 110.0 53 111.0 54 98.5 55 67.5 56 51.5 57 43.0 58 31.0 59 27.5 60 21.0 61 13.5 62 8.5 63 2.5 64 3.0 65 3.5 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.05291005291005 89.825 2 4.338624338624339 8.200000000000001 3 0.4761904761904762 1.35 4 0.10582010582010583 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026455026455026457 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCTG 10 0.006830828 145.0 4 GTGAATC 10 0.006830828 145.0 2 >>END_MODULE Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519891 spots for SRR12161366.sra Written 519891 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra Read 519874 spots for SRR12161366.sra Written 519874 spots for SRR12161366.sra SRR ids: ['SRR12161366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ekcsyknq SRR12161366.sra spots: 10397497 blocks: [[1, 519874], [519875, 1039748], [1039749, 1559622], [1559623, 2079496], [2079497, 2599370], [2599371, 3119244], [3119245, 3639118], [3639119, 4158992], [4158993, 4678866], [4678867, 5198740], [5198741, 5718614], [5718615, 6238488], [6238489, 6758362], [6758363, 7278236], [7278237, 7798110], [7798111, 8317984], [8317985, 8837858], [8837859, 9357732], [9357733, 9877606], [9877607, 10397497]] SRR12161366 file size 3511823 SRR12161366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161366 SRR12161366_1.fastq SRR12161366_2.fastq Input file: SRR12161366_1.fastq Paired file: SRR12161366_2.fastq trimmed: SRR12161366-trimmed-pair1.fastq, SRR12161366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:23:55 2025 >> started Thu Feb 13 18:24:08 2025 >> done (12.816s) 10397497 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1698 ( 0.02%) empty read pairs filtered out after trimming by size control 10395779 (99.98%) read pairs available; of these: 561778 ( 5.40%) trimmed read pairs available after processing 9834001 (94.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 8 0.00% 25 16 0.00% 26 8 0.00% 27 9 0.00% 28 6 0.00% 29 8 0.00% 30 11 0.00% 31 10 0.00% 32 6 0.00% 33 13 0.00% 34 9 0.00% 35 5 0.00% 36 11 0.00% 37 8 0.00% 38 8 0.00% 39 6 0.00% 40 10 0.00% 41 7 0.00% 42 11 0.00% 43 10 0.00% 44 11 0.00% 45 14 0.00% 46 17 0.00% 47 13 0.00% 48 16 0.00% 49 23 0.00% 50 9 0.00% 51 20 0.00% 52 16 0.00% 53 21 0.00% 54 19 0.00% 55 16 0.00% 56 27 0.00% 57 27 0.00% 58 31 0.00% 59 33 0.00% 60 47 0.00% 61 46 0.00% 62 51 0.00% 63 48 0.00% 64 67 0.00% 65 50 0.00% 66 69 0.00% 67 65 0.00% 68 73 0.00% 69 109 0.00% 70 107 0.00% 71 108 0.00% 72 132 0.00% 73 153 0.00% 74 172 0.00% 75 195 0.00% 76 209 0.00% 77 220 0.00% 78 254 0.00% 79 298 0.00% 80 347 0.00% 81 405 0.00% 82 429 0.00% 83 463 0.00% 84 528 0.01% 85 626 0.01% 86 686 0.01% 87 753 0.01% 88 770 0.01% 89 861 0.01% 90 975 0.01% 91 1127 0.01% 92 1221 0.01% 93 1373 0.01% 94 1461 0.01% 95 1744 0.02% 96 1755 0.02% 97 1852 0.02% 98 2119 0.02% 99 2173 0.02% 100 2359 0.02% 101 2548 0.02% 102 2883 0.03% 103 3094 0.03% 104 3210 0.03% 105 3547 0.03% 106 3668 0.04% 107 3875 0.04% 108 4044 0.04% 109 4310 0.04% 110 4458 0.04% 111 4700 0.05% 112 5125 0.05% 113 5474 0.05% 114 5705 0.05% 115 6154 0.06% 116 6412 0.06% 117 6758 0.07% 118 6820 0.07% 119 7216 0.07% 120 7596 0.07% 121 8096 0.08% 122 8511 0.08% 123 8882 0.09% 124 9506 0.09% 125 9654 0.09% 126 10107 0.10% 127 10461 0.10% 128 10752 0.10% 129 11078 0.11% 130 11553 0.11% 131 11967 0.12% 132 12656 0.12% 133 13199 0.13% 134 13437 0.13% 135 14354 0.14% 136 14371 0.14% 137 15076 0.15% 138 15520 0.15% 139 16108 0.15% 140 15914 0.15% 141 16762 0.16% 142 17595 0.17% 143 17735 0.17% 144 19084 0.18% 145 19754 0.19% 146 20178 0.19% 147 20320 0.20% 148 21038 0.20% 149 21236 0.20% 150 22258 0.21% 151 9834001 94.60% 10395779 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=0.98 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=8.57 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.2 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGA criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=1.16 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=27 fanout-score=17.26 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=4.9 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12161366 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:25:02 Started mapping on | Feb 13 18:25:02 Finished on | Feb 13 18:26:08 Mapping speed, Million of reads per hour | 567.04 Number of input reads | 10395779 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9287836 Uniquely mapped reads % | 89.34% Average mapped length | 295.11 Number of splices: Total | 9663006 Number of splices: Annotated (sjdb) | 9465651 Number of splices: GT/AG | 9459812 Number of splices: GC/AG | 168880 Number of splices: AT/AC | 7723 Number of splices: Non-canonical | 26591 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231747 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 52552 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.73% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 876196 876196 876196 N_multimapping 231747 231747 231747 N_noFeature 270341 9167327 302050 N_ambiguous 167659 643 78485 UnstrandedReadsAssigned:8849836 PositiveStrandReadsAssigned:119866 NegativeStrandReadsAssigned:8907301 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161366-trimmed-pair1.fastq SRR12161366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,395,779 reads, 9,341,439 reads pseudoaligned [quant] estimated average fragment length: 265.526 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52401 SRR12161366.ke.tsv 34699 SRR12161366.se.tsv 87100 total ==> SRR12161366.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.47 207 9.91755 Potri.005G024800.1.v4.1 1035 770.474 167 18.2092 Potri.004G059700.1.v4.1 961 696.629 24 2.8943 Potri.007G009000.2.v4.1 1416 1151.47 0 0 Potri.003G141000.2.v4.1 2943 2678.47 341.302 10.705 Potri.016G087400.1.v4.1 270 74.4211 544.068 614.173 Potri.015G069301.1.v4.1 564 312.622 0 0 Potri.010G195200.1.v4.1 1773 1508.47 4 0.222769 Potri.012G127500.1.v4.1 977 712.57 124 14.6193 ==> SRR12161366.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 230 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12161366 completed mapping pipeline successfully