Starting /dee2/code/volunteer_pipeline.sh SRR12161367 current disk space = 3087740801024 free memory = 1426306316 SRR12161367 SRAfilesize af7dfb3191db3a779b843b4ead0a6223 SRR12161367.sra SRR12161367.sra file validated SRR12161367 is paired end SRR12161367 is conventional basespace SRR12161367 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6015 37.0 37.0 37.0 37.0 37.0 2 36.4805 37.0 37.0 37.0 37.0 37.0 3 36.473 37.0 37.0 37.0 37.0 37.0 4 36.489 37.0 37.0 37.0 37.0 37.0 5 36.5625 37.0 37.0 37.0 37.0 37.0 6 36.5395 37.0 37.0 37.0 37.0 37.0 7 36.426 37.0 37.0 37.0 37.0 37.0 8 36.5345 37.0 37.0 37.0 37.0 37.0 9 36.4965 37.0 37.0 37.0 37.0 37.0 10-14 36.5308 37.0 37.0 37.0 37.0 37.0 15-19 36.51520000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.514599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4801 37.0 37.0 37.0 37.0 37.0 30-34 36.4298 37.0 37.0 37.0 37.0 37.0 35-39 36.4176 37.0 37.0 37.0 37.0 37.0 40-44 36.4174 37.0 37.0 37.0 37.0 37.0 45-49 36.3276 37.0 37.0 37.0 37.0 37.0 50-54 36.36559999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.294 37.0 37.0 37.0 37.0 37.0 60-64 36.247899999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.2392 37.0 37.0 37.0 37.0 37.0 70-74 36.22709999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2272 37.0 37.0 37.0 37.0 37.0 80-84 36.2699 37.0 37.0 37.0 37.0 37.0 85-89 36.2377 37.0 37.0 37.0 37.0 37.0 90-94 36.21169999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2119 37.0 37.0 37.0 37.0 37.0 100-104 36.2016 37.0 37.0 37.0 37.0 37.0 105-109 36.080600000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.10119999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0924 37.0 37.0 37.0 37.0 37.0 120-124 36.076299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9879 37.0 37.0 37.0 37.0 37.0 130-134 35.98909999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.881299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.9264 37.0 37.0 37.0 37.0 37.0 145-149 35.8158 37.0 37.0 37.0 37.0 37.0 150-151 35.68475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 0.0 24 2.0 25 1.0 26 3.0 27 8.0 28 16.0 29 19.0 30 32.0 31 32.0 32 51.0 33 78.0 34 144.0 35 304.0 36 2877.0 37 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.05 12.075 6.1 33.775 2 19.675 13.4 33.475 33.45 3 17.05 17.299999999999997 33.475 32.175 4 21.55 26.400000000000002 25.1 26.950000000000003 5 22.05 32.2 24.125 21.625 6 20.1 36.8 23.0 20.1 7 14.524999999999999 26.5 42.275 16.7 8 17.424999999999997 25.624999999999996 32.25 24.7 9 17.45 23.05 35.025 24.474999999999998 10-14 19.35 30.56 26.640000000000004 23.45 15-19 19.555 27.950000000000003 28.505000000000003 23.990000000000002 20-24 20.145 28.565 27.944999999999997 23.345 25-29 20.169999999999998 29.09 27.01 23.73 30-34 19.564999999999998 28.925 27.325 24.185000000000002 35-39 20.0 28.970000000000002 27.63 23.400000000000002 40-44 20.085 29.360000000000003 27.05 23.505000000000003 45-49 19.919999999999998 27.915 27.62 24.545 50-54 19.805 28.549999999999997 27.305 24.34 55-59 19.685 28.075 28.04 24.2 60-64 20.335 28.975 26.99 23.7 65-69 20.775 28.64 27.005000000000003 23.580000000000002 70-74 20.555 28.28 27.700000000000003 23.465 75-79 20.775 27.74 27.744999999999997 23.74 80-84 20.695 28.52 27.415 23.369999999999997 85-89 20.26 28.205000000000002 27.455000000000002 24.08 90-94 20.865000000000002 28.46 27.445000000000004 23.23 95-99 20.53 28.345 27.54 23.585 100-104 21.095 28.34 26.875 23.69 105-109 21.584999999999997 28.15 26.900000000000002 23.365 110-114 21.45 27.24 28.235 23.075000000000003 115-119 20.645 27.965 27.88 23.51 120-124 20.955 28.194999999999997 27.450000000000003 23.400000000000002 125-129 20.915 28.04 27.18 23.865 130-134 21.145 28.87 26.479999999999997 23.505000000000003 135-139 21.325 27.705000000000002 27.150000000000002 23.82 140-144 21.085 28.095 26.82 24.0 145-149 21.385 28.105000000000004 27.060000000000002 23.45 150-151 20.599999999999998 27.55 27.6125 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 3.0 24 3.0 25 3.0 26 5.0 27 8.0 28 10.0 29 11.0 30 20.5 31 28.5 32 36.0 33 47.0 34 59.0 35 73.5 36 90.5 37 117.5 38 135.0 39 154.0 40 174.0 41 189.0 42 232.0 43 251.5 44 246.5 45 263.5 46 259.0 47 240.0 48 220.0 49 203.0 50 183.5 51 145.0 52 117.0 53 101.0 54 80.5 55 67.0 56 56.0 57 39.5 58 30.0 59 26.5 60 20.5 61 12.0 62 5.5 63 3.0 64 3.0 65 3.0 66 6.5 67 6.5 68 3.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.66277217206586 89.125 2 4.779607010090282 9.0 3 0.4514073287307488 1.275 4 0.02655337227827934 0.1 5 0.05310674455655868 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02655337227827934 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCGCGTAT 10 0.25 TruSeq Adapter, Index 13 (97% over 37bp) GCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.0250000000000004 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161367 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.326 37.0 37.0 37.0 37.0 37.0 2 35.8835 37.0 37.0 37.0 37.0 37.0 3 35.943 37.0 37.0 37.0 37.0 37.0 4 35.975 37.0 37.0 37.0 37.0 37.0 5 36.102 37.0 37.0 37.0 37.0 37.0 6 36.066 37.0 37.0 37.0 37.0 37.0 7 35.953 37.0 37.0 37.0 37.0 37.0 8 35.955 37.0 37.0 37.0 37.0 37.0 9 36.109 37.0 37.0 37.0 37.0 37.0 10-14 35.9677 37.0 37.0 37.0 37.0 37.0 15-19 35.9322 37.0 37.0 37.0 37.0 37.0 20-24 35.9453 37.0 37.0 37.0 37.0 37.0 25-29 35.8455 37.0 37.0 37.0 37.0 37.0 30-34 35.8075 37.0 37.0 37.0 37.0 37.0 35-39 35.8198 37.0 37.0 37.0 37.0 37.0 40-44 35.785000000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.7601 37.0 37.0 37.0 37.0 37.0 50-54 35.7493 37.0 37.0 37.0 37.0 37.0 55-59 35.6582 37.0 37.0 37.0 37.0 37.0 60-64 35.6155 37.0 37.0 37.0 37.0 37.0 65-69 35.6979 37.0 37.0 37.0 37.0 37.0 70-74 35.63119999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.57439999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.6067 37.0 37.0 37.0 37.0 37.0 85-89 35.5637 37.0 37.0 37.0 37.0 37.0 90-94 35.5516 37.0 37.0 37.0 37.0 37.0 95-99 35.578700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.5563 37.0 37.0 37.0 37.0 37.0 105-109 35.5831 37.0 37.0 37.0 37.0 37.0 110-114 35.519400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.4795 37.0 37.0 37.0 37.0 37.0 120-124 35.4417 37.0 37.0 37.0 37.0 37.0 125-129 35.3359 37.0 37.0 37.0 34.6 37.0 130-134 35.304 37.0 37.0 37.0 34.6 37.0 135-139 35.306200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.1691 37.0 37.0 37.0 29.8 37.0 145-149 35.2586 37.0 37.0 37.0 37.0 37.0 150-151 34.659 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 8.0 14 7.0 15 6.0 16 3.0 17 3.0 18 7.0 19 3.0 20 6.0 21 9.0 22 4.0 23 14.0 24 20.0 25 10.0 26 5.0 27 16.0 28 17.0 29 22.0 30 32.0 31 38.0 32 59.0 33 106.0 34 195.0 35 522.0 36 2578.0 37 308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.475 24.825 7.6499999999999995 19.05 2 29.5 24.525 28.125 17.849999999999998 3 22.875 27.474999999999998 32.35 17.299999999999997 4 25.55 34.025 22.3 18.125 5 26.125 36.675000000000004 19.8 17.4 6 23.05 39.2 20.575 17.175 7 21.05 22.6 37.425000000000004 18.925 8 21.4 26.5 26.900000000000002 25.2 9 22.5 26.150000000000002 27.800000000000004 23.549999999999997 10-14 24.099999999999998 29.270000000000003 25.53 21.099999999999998 15-19 23.585 28.02 27.145000000000003 21.25 20-24 23.755000000000003 28.415000000000003 27.065 20.765 25-29 23.79 27.905 27.900000000000002 20.405 30-34 22.78 28.665000000000003 27.744999999999997 20.810000000000002 35-39 22.655 28.860000000000003 27.065 21.42 40-44 23.62 28.365000000000002 27.145000000000003 20.87 45-49 23.294999999999998 28.645 27.189999999999998 20.87 50-54 23.36 28.244999999999997 27.46 20.935000000000002 55-59 23.69 27.82 27.42 21.07 60-64 23.56 28.165000000000003 27.169999999999998 21.105 65-69 23.865 27.634999999999998 27.415 21.085 70-74 23.505000000000003 28.110000000000003 27.29 21.095 75-79 24.005000000000003 27.825 27.060000000000002 21.11 80-84 23.78 27.834999999999997 27.165 21.22 85-89 24.355 27.994999999999997 27.275 20.375 90-94 23.875 28.475 27.025 20.625 95-99 24.295 28.28 27.189999999999998 20.235 100-104 24.195 27.700000000000003 27.3 20.805 105-109 23.880000000000003 27.99 27.474999999999998 20.655 110-114 23.990000000000002 28.165000000000003 27.075 20.77 115-119 24.805 28.035 27.355 19.805 120-124 25.15 28.110000000000003 27.045 19.695 125-129 25.255 28.349999999999998 26.16 20.235 130-134 25.330000000000002 27.589999999999996 26.729999999999997 20.349999999999998 135-139 25.224999999999998 27.855 26.86 20.06 140-144 25.35 27.944999999999997 26.82 19.885 145-149 25.669999999999998 27.905 26.515 19.91 150-151 26.625 28.5625 25.8625 18.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.5 5 1.5 6 1.0 7 1.0 8 1.5 9 1.0 10 0.5 11 0.5 12 1.0 13 1.5 14 1.0 15 1.0 16 2.0 17 2.0 18 4.0 19 4.0 20 2.5 21 2.0 22 1.0 23 2.5 24 3.5 25 2.0 26 3.5 27 5.0 28 6.0 29 9.0 30 12.0 31 17.5 32 21.5 33 37.5 34 45.0 35 56.5 36 83.5 37 107.0 38 133.5 39 159.5 40 197.0 41 221.5 42 239.0 43 251.5 44 262.5 45 263.5 46 258.0 47 252.5 48 233.5 49 199.0 50 150.5 51 128.5 52 117.5 53 98.0 54 81.0 55 67.0 56 49.0 57 36.0 58 31.0 59 26.0 60 18.5 61 11.0 62 7.0 63 6.5 64 6.5 65 2.5 66 0.5 67 1.0 68 2.5 69 3.0 70 3.5 71 2.5 72 1.0 73 1.0 74 1.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.5 91 1.0 92 1.0 93 1.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.5 100 10.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.735435595938 88.625 2 4.676643506146446 8.75 3 0.347407803313736 0.975 4 0.08017103153393908 0.3 5 0.053447354355959376 0.25 6 0.026723677177979688 0.15 7 0.0 0.0 8 0.026723677177979688 0.2 9 0.0 0.0 >10 0.053447354355959376 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGCAGATCAAGCAAAGCTTAAACACTAATTAATCATGGCAACCAGCTCAG 6 0.15 No Hit GAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACA 5 0.125 No Hit GAGCAGATCAAGCAAAGCTTAAACACTAATTAATCATGGCAACCAGCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.525 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 4.949999999999999 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTCG 10 0.006830828 145.0 8 TTGCTGT 10 0.006830828 145.0 8 >>END_MODULE Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709772 spots for SRR12161367.sra Written 709772 spots for SRR12161367.sra Read 709790 spots for SRR12161367.sra Written 709790 spots for SRR12161367.sra SRR ids: ['SRR12161367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wz8io7qj SRR12161367.sra spots: 14195458 blocks: [[1, 709772], [709773, 1419544], [1419545, 2129316], [2129317, 2839088], [2839089, 3548860], [3548861, 4258632], [4258633, 4968404], [4968405, 5678176], [5678177, 6387948], [6387949, 7097720], [7097721, 7807492], [7807493, 8517264], [8517265, 9227036], [9227037, 9936808], [9936809, 10646580], [10646581, 11356352], [11356353, 12066124], [12066125, 12775896], [12775897, 13485668], [13485669, 14195458]] SRR12161367 file size 4802537 SRR12161367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161367 SRR12161367_1.fastq SRR12161367_2.fastq Input file: SRR12161367_1.fastq Paired file: SRR12161367_2.fastq trimmed: SRR12161367-trimmed-pair1.fastq, SRR12161367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:42:30 2025 >> started Thu Feb 13 18:42:48 2025 >> done (17.706s) 14195458 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 50116 ( 0.35%) empty read pairs filtered out after trimming by size control 14145294 (99.65%) read pairs available; of these: 1254158 ( 8.87%) trimmed read pairs available after processing 12891136 (91.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 0 0.00% 21 7 0.00% 22 10 0.00% 23 7 0.00% 24 4 0.00% 25 9 0.00% 26 19 0.00% 27 5 0.00% 28 17 0.00% 29 15 0.00% 30 17 0.00% 31 13 0.00% 32 13 0.00% 33 15 0.00% 34 12 0.00% 35 17 0.00% 36 14 0.00% 37 17 0.00% 38 19 0.00% 39 22 0.00% 40 20 0.00% 41 10 0.00% 42 27 0.00% 43 25 0.00% 44 22 0.00% 45 23 0.00% 46 21 0.00% 47 43 0.00% 48 32 0.00% 49 26 0.00% 50 31 0.00% 51 40 0.00% 52 66 0.00% 53 47 0.00% 54 53 0.00% 55 54 0.00% 56 72 0.00% 57 75 0.00% 58 83 0.00% 59 100 0.00% 60 134 0.00% 61 125 0.00% 62 160 0.00% 63 175 0.00% 64 180 0.00% 65 208 0.00% 66 224 0.00% 67 260 0.00% 68 252 0.00% 69 325 0.00% 70 356 0.00% 71 403 0.00% 72 524 0.00% 73 575 0.00% 74 597 0.00% 75 633 0.00% 76 743 0.01% 77 844 0.01% 78 894 0.01% 79 1073 0.01% 80 1227 0.01% 81 1474 0.01% 82 1702 0.01% 83 1888 0.01% 84 2020 0.01% 85 2244 0.02% 86 2442 0.02% 87 2564 0.02% 88 2865 0.02% 89 3082 0.02% 90 3545 0.03% 91 3798 0.03% 92 4314 0.03% 93 4777 0.03% 94 5167 0.04% 95 5643 0.04% 96 5899 0.04% 97 6279 0.04% 98 6461 0.05% 99 7025 0.05% 100 7775 0.05% 101 8081 0.06% 102 8964 0.06% 103 9622 0.07% 104 10323 0.07% 105 10654 0.08% 106 11198 0.08% 107 11303 0.08% 108 11633 0.08% 109 12145 0.09% 110 12740 0.09% 111 13681 0.10% 112 14464 0.10% 113 15354 0.11% 114 16051 0.11% 115 16739 0.12% 116 16996 0.12% 117 17665 0.12% 118 17915 0.13% 119 18231 0.13% 120 19134 0.14% 121 19861 0.14% 122 20979 0.15% 123 21723 0.15% 124 23113 0.16% 125 23439 0.17% 126 24177 0.17% 127 24231 0.17% 128 24669 0.17% 129 24407 0.17% 130 25318 0.18% 131 25983 0.18% 132 26903 0.19% 133 28350 0.20% 134 28855 0.20% 135 29946 0.21% 136 30197 0.21% 137 31141 0.22% 138 30940 0.22% 139 32058 0.23% 140 31550 0.22% 141 32442 0.23% 142 33176 0.23% 143 34152 0.24% 144 35573 0.25% 145 36557 0.26% 146 37398 0.26% 147 37397 0.26% 148 38059 0.27% 149 37683 0.27% 150 38980 0.28% 151 12891136 91.13% 14145294 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=35.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=31 prefix-density=1.23 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=92.72 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161367 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:43:32 Started mapping on | Feb 13 18:43:32 Finished on | Feb 13 18:45:30 Mapping speed, Million of reads per hour | 431.55 Number of input reads | 14145294 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13009047 Uniquely mapped reads % | 91.97% Average mapped length | 296.48 Number of splices: Total | 12999670 Number of splices: Annotated (sjdb) | 12701282 Number of splices: GT/AG | 12745499 Number of splices: GC/AG | 198125 Number of splices: AT/AC | 8959 Number of splices: Non-canonical | 47087 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296186 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 63230 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.20% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 840061 840061 840061 N_multimapping 296186 296186 296186 N_noFeature 451145 12785985 509551 N_ambiguous 249427 891 84270 UnstrandedReadsAssigned:12308475 PositiveStrandReadsAssigned:222171 NegativeStrandReadsAssigned:12415226 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161367-trimmed-pair1.fastq SRR12161367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,145,294 reads, 12,476,579 reads pseudoaligned [quant] estimated average fragment length: 265.628 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR12161367.ke.tsv 34699 SRR12161367.se.tsv 87100 total ==> SRR12161367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.37 321 11.111 Potri.005G024800.1.v4.1 1035 770.372 242 19.0651 Potri.004G059700.1.v4.1 961 696.564 37 3.22377 Potri.007G009000.2.v4.1 1416 1151.37 0 0 Potri.003G141000.2.v4.1 2943 2678.37 444 10.0609 Potri.016G087400.1.v4.1 270 81.2933 474.544 354.278 Potri.015G069301.1.v4.1 564 315.299 0 0 Potri.010G195200.1.v4.1 1773 1508.37 26.6123 1.07077 Potri.012G127500.1.v4.1 977 712.469 291 24.7885 ==> SRR12161367.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 206 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12161367 completed mapping pipeline successfully