Starting /dee2/code/volunteer_pipeline.sh SRR12161368 current disk space = 3087692005376 free memory = 1463881548 SRR12161368 SRAfilesize 95552d77ee7e4d6c0a1342143cc25157 SRR12161368.sra SRR12161368.sra file validated SRR12161368 is paired end SRR12161368 is conventional basespace SRR12161368 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.574 37.0 37.0 37.0 37.0 37.0 2 36.35 37.0 37.0 37.0 37.0 37.0 3 36.5125 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.5985 37.0 37.0 37.0 37.0 37.0 6 36.562 37.0 37.0 37.0 37.0 37.0 7 36.434 37.0 37.0 37.0 37.0 37.0 8 36.6035 37.0 37.0 37.0 37.0 37.0 9 36.556 37.0 37.0 37.0 37.0 37.0 10-14 36.596199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.510799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5098 37.0 37.0 37.0 37.0 37.0 25-29 36.4388 37.0 37.0 37.0 37.0 37.0 30-34 36.448899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4173 37.0 37.0 37.0 37.0 37.0 40-44 36.3612 37.0 37.0 37.0 37.0 37.0 45-49 36.423700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3237 37.0 37.0 37.0 37.0 37.0 55-59 36.3619 37.0 37.0 37.0 37.0 37.0 60-64 36.4049 37.0 37.0 37.0 37.0 37.0 65-69 36.318599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2857 37.0 37.0 37.0 37.0 37.0 75-79 36.2743 37.0 37.0 37.0 37.0 37.0 80-84 36.3007 37.0 37.0 37.0 37.0 37.0 85-89 36.2394 37.0 37.0 37.0 37.0 37.0 90-94 36.2641 37.0 37.0 37.0 37.0 37.0 95-99 36.222699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.18429999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1264 37.0 37.0 37.0 37.0 37.0 110-114 36.194399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.134 37.0 37.0 37.0 37.0 37.0 120-124 36.0921 37.0 37.0 37.0 37.0 37.0 125-129 36.038599999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.0285 37.0 37.0 37.0 37.0 37.0 135-139 36.020599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.9599 37.0 37.0 37.0 37.0 37.0 145-149 35.9327 37.0 37.0 37.0 37.0 37.0 150-151 35.693749999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 4.0 26 5.0 27 11.0 28 12.0 29 18.0 30 26.0 31 27.0 32 48.0 33 68.0 34 126.0 35 273.0 36 2963.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.724999999999994 14.374999999999998 4.5249999999999995 30.375000000000004 2 21.7 13.875000000000002 35.15 29.275000000000002 3 16.475 20.125 31.125000000000004 32.275 4 21.125 29.325000000000003 24.9 24.65 5 21.95 33.7 24.45 19.900000000000002 6 19.525000000000002 36.475 24.025 19.975 7 15.375 26.05 42.725 15.85 8 16.5 25.15 32.875 25.474999999999998 9 16.8 23.425 33.900000000000006 25.874999999999996 10-14 20.044999999999998 28.744999999999997 26.935 24.275 15-19 20.435 28.37 27.51 23.685000000000002 20-24 19.365 28.475 27.865000000000002 24.295 25-29 19.91 27.85 27.97 24.27 30-34 20.47 27.93 27.41 24.19 35-39 19.950000000000003 28.96 27.355 23.735 40-44 20.255000000000003 28.15 27.91 23.685000000000002 45-49 19.62 28.194999999999997 27.584999999999997 24.6 50-54 20.115 28.58 27.450000000000003 23.855 55-59 19.05 28.144999999999996 27.975 24.83 60-64 19.759999999999998 28.32 27.389999999999997 24.529999999999998 65-69 19.71 28.005000000000003 27.88 24.404999999999998 70-74 20.23 28.24 27.58 23.95 75-79 19.869999999999997 28.99 27.250000000000004 23.89 80-84 19.869999999999997 28.71 27.18 24.240000000000002 85-89 20.46 27.994999999999997 27.615000000000002 23.93 90-94 20.580000000000002 28.345 27.250000000000004 23.825 95-99 20.544999999999998 27.97 27.57 23.915 100-104 20.200000000000003 28.025 27.750000000000004 24.025 105-109 20.415 27.125 27.87 24.59 110-114 20.655 27.92 27.36 24.065 115-119 20.549999999999997 28.1 27.334999999999997 24.015 120-124 20.669999999999998 27.925 27.07 24.335 125-129 20.335 27.794999999999998 27.565 24.305 130-134 20.19 27.639999999999997 27.41 24.759999999999998 135-139 21.46 27.76 27.16 23.62 140-144 20.265 27.815 27.74 24.18 145-149 20.465 27.685 27.705000000000002 24.145 150-151 21.425 27.925 26.724999999999998 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 4.0 26 5.5 27 8.5 28 12.0 29 12.0 30 14.5 31 22.0 32 26.0 33 36.0 34 55.0 35 76.5 36 96.0 37 107.5 38 111.0 39 142.0 40 174.5 41 196.5 42 220.0 43 244.0 44 264.0 45 265.0 46 265.5 47 259.5 48 233.5 49 216.0 50 207.5 51 168.0 52 125.5 53 98.0 54 81.0 55 64.5 56 48.5 57 41.5 58 29.0 59 18.5 60 15.5 61 9.5 62 4.5 63 3.5 64 3.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 93.36188436830835 87.2 2 6.316916488222699 11.799999999999999 3 0.24089935760171305 0.675 4 0.05353319057815846 0.2 5 0.02676659528907923 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.2 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138-139 2.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTGT 10 0.006830828 145.0 9 GCCAATT 10 0.006830828 145.0 1 CATCATC 20 3.5877043E-4 108.75 2 >>END_MODULE SRR12161368 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.155 37.0 37.0 37.0 37.0 37.0 2 35.5005 37.0 37.0 37.0 37.0 37.0 3 35.7865 37.0 37.0 37.0 37.0 37.0 4 35.8245 37.0 37.0 37.0 37.0 37.0 5 36.0955 37.0 37.0 37.0 37.0 37.0 6 35.8705 37.0 37.0 37.0 37.0 37.0 7 35.989 37.0 37.0 37.0 37.0 37.0 8 35.9845 37.0 37.0 37.0 37.0 37.0 9 36.039 37.0 37.0 37.0 37.0 37.0 10-14 36.0994 37.0 37.0 37.0 37.0 37.0 15-19 36.0641 37.0 37.0 37.0 37.0 37.0 20-24 36.0381 37.0 37.0 37.0 37.0 37.0 25-29 35.9714 37.0 37.0 37.0 37.0 37.0 30-34 35.9012 37.0 37.0 37.0 37.0 37.0 35-39 35.922 37.0 37.0 37.0 37.0 37.0 40-44 35.883799999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.8117 37.0 37.0 37.0 37.0 37.0 50-54 35.849900000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.771100000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.711400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.7961 37.0 37.0 37.0 37.0 37.0 70-74 35.6144 37.0 37.0 37.0 37.0 37.0 75-79 35.6235 37.0 37.0 37.0 37.0 37.0 80-84 35.733000000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.6552 37.0 37.0 37.0 37.0 37.0 90-94 35.5793 37.0 37.0 37.0 37.0 37.0 95-99 35.6202 37.0 37.0 37.0 37.0 37.0 100-104 35.5447 37.0 37.0 37.0 37.0 37.0 105-109 35.6166 37.0 37.0 37.0 37.0 37.0 110-114 35.563900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.5172 37.0 37.0 37.0 37.0 37.0 120-124 35.5061 37.0 37.0 37.0 37.0 37.0 125-129 35.3765 37.0 37.0 37.0 32.2 37.0 130-134 35.3525 37.0 37.0 37.0 34.6 37.0 135-139 35.4154 37.0 37.0 37.0 37.0 37.0 140-144 35.2557 37.0 37.0 37.0 29.8 37.0 145-149 35.3489 37.0 37.0 37.0 34.6 37.0 150-151 34.69525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 8.0 15 3.0 16 0.0 17 1.0 18 1.0 19 0.0 20 7.0 21 1.0 22 5.0 23 4.0 24 7.0 25 9.0 26 11.0 27 13.0 28 20.0 29 28.0 30 25.0 31 55.0 32 88.0 33 134.0 34 233.0 35 642.0 36 2512.0 37 191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.325 24.25 6.950000000000001 20.474999999999998 2 27.150000000000002 25.775 30.25 16.825000000000003 3 21.05 27.700000000000003 33.15 18.099999999999998 4 22.55 34.849999999999994 22.925 19.675 5 23.575 39.925 19.5 17.0 6 22.875 39.75 20.525 16.85 7 19.525000000000002 22.95 36.825 20.7 8 20.4 25.900000000000002 27.875 25.825 9 20.225 24.575 30.049999999999997 25.15 10-14 23.385 29.285 25.814999999999998 21.515 15-19 23.335 27.88 27.55 21.235 20-24 23.474999999999998 28.24 27.215 21.07 25-29 23.365 28.075 27.705000000000002 20.855 30-34 22.63 28.139999999999997 28.435 20.794999999999998 35-39 23.44 27.815 27.725 21.02 40-44 22.99 28.815 27.255000000000003 20.94 45-49 23.294999999999998 27.845 27.91 20.95 50-54 23.39 27.805000000000003 27.67 21.135 55-59 23.095 27.74 28.125 21.04 60-64 23.669999999999998 27.525 27.675 21.13 65-69 23.385 27.735 27.825 21.055 70-74 23.51 28.139999999999997 27.16 21.19 75-79 23.494999999999997 27.91 27.315 21.279999999999998 80-84 23.745 27.884999999999998 26.99 21.38 85-89 23.28 27.925 27.405 21.39 90-94 23.465 27.6 27.62 21.315 95-99 23.565 28.475 27.08 20.880000000000003 100-104 24.165 27.36 27.29 21.185000000000002 105-109 23.835 27.650000000000002 27.785 20.73 110-114 24.09 27.49 27.71 20.71 115-119 23.46 27.750000000000004 27.16 21.63 120-124 23.73 27.37 27.500000000000004 21.4 125-129 24.46 27.37 27.800000000000004 20.369999999999997 130-134 24.435000000000002 27.38 27.065 21.12 135-139 23.555 27.505000000000003 28.189999999999998 20.75 140-144 24.404999999999998 27.63 27.235 20.73 145-149 24.62 27.58 27.245 20.555 150-151 25.674999999999997 27.35 26.987499999999997 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 1.0 22 1.5 23 2.0 24 4.0 25 3.5 26 3.0 27 5.0 28 7.5 29 10.0 30 13.5 31 22.5 32 26.5 33 30.0 34 49.5 35 61.5 36 71.5 37 104.0 38 127.5 39 153.0 40 189.5 41 214.5 42 250.5 43 276.5 44 266.0 45 262.0 46 256.0 47 255.0 48 250.0 49 220.5 50 177.5 51 136.0 52 112.0 53 95.0 54 83.0 55 59.5 56 43.5 57 40.0 58 29.5 59 23.0 60 18.0 61 10.0 62 6.5 63 3.0 64 2.0 65 1.5 66 1.5 67 1.0 68 0.0 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.5 94 1.0 95 0.5 96 0.5 97 0.5 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58733565870673 87.2 2 5.849208478669171 10.9 3 0.3756372417493963 1.05 4 0.10732492621411323 0.4 5 0.053662463107056614 0.25 6 0.0 0.0 7 0.0 0.0 8 0.026831231553528307 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit ATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.7374999999999998 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655717 spots for SRR12161368.sra Written 655717 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra Read 655709 spots for SRR12161368.sra Written 655709 spots for SRR12161368.sra SRR ids: ['SRR12161368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7ah0mie SRR12161368.sra spots: 13114188 blocks: [[1, 655709], [655710, 1311418], [1311419, 1967127], [1967128, 2622836], [2622837, 3278545], [3278546, 3934254], [3934255, 4589963], [4589964, 5245672], [5245673, 5901381], [5901382, 6557090], [6557091, 7212799], [7212800, 7868508], [7868509, 8524217], [8524218, 9179926], [9179927, 9835635], [9835636, 10491344], [10491345, 11147053], [11147054, 11802762], [11802763, 12458471], [12458472, 13114188]] SRR12161368 file size 4435074 SRR12161368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161368 SRR12161368_1.fastq SRR12161368_2.fastq Input file: SRR12161368_1.fastq Paired file: SRR12161368_2.fastq trimmed: SRR12161368-trimmed-pair1.fastq, SRR12161368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:44:23 2025 >> started Thu Feb 13 18:44:39 2025 >> done (15.448s) 13114188 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 982 ( 0.01%) empty read pairs filtered out after trimming by size control 13113162 (99.99%) read pairs available; of these: 541128 ( 4.13%) trimmed read pairs available after processing 12572034 (95.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 4 0.00% 21 7 0.00% 22 9 0.00% 23 6 0.00% 24 11 0.00% 25 11 0.00% 26 15 0.00% 27 9 0.00% 28 11 0.00% 29 5 0.00% 30 12 0.00% 31 11 0.00% 32 10 0.00% 33 8 0.00% 34 15 0.00% 35 11 0.00% 36 22 0.00% 37 9 0.00% 38 18 0.00% 39 11 0.00% 40 12 0.00% 41 16 0.00% 42 5 0.00% 43 20 0.00% 44 16 0.00% 45 20 0.00% 46 12 0.00% 47 27 0.00% 48 32 0.00% 49 17 0.00% 50 28 0.00% 51 29 0.00% 52 28 0.00% 53 29 0.00% 54 34 0.00% 55 35 0.00% 56 37 0.00% 57 45 0.00% 58 37 0.00% 59 46 0.00% 60 50 0.00% 61 50 0.00% 62 51 0.00% 63 76 0.00% 64 62 0.00% 65 80 0.00% 66 94 0.00% 67 87 0.00% 68 79 0.00% 69 114 0.00% 70 141 0.00% 71 149 0.00% 72 182 0.00% 73 201 0.00% 74 181 0.00% 75 212 0.00% 76 253 0.00% 77 265 0.00% 78 287 0.00% 79 322 0.00% 80 389 0.00% 81 415 0.00% 82 517 0.00% 83 567 0.00% 84 637 0.00% 85 687 0.01% 86 717 0.01% 87 809 0.01% 88 831 0.01% 89 973 0.01% 90 1048 0.01% 91 1200 0.01% 92 1333 0.01% 93 1456 0.01% 94 1596 0.01% 95 1721 0.01% 96 1750 0.01% 97 1911 0.01% 98 2085 0.02% 99 2162 0.02% 100 2405 0.02% 101 2521 0.02% 102 2930 0.02% 103 3074 0.02% 104 3322 0.03% 105 3520 0.03% 106 3659 0.03% 107 3794 0.03% 108 3861 0.03% 109 4165 0.03% 110 4400 0.03% 111 4707 0.04% 112 5115 0.04% 113 5383 0.04% 114 5853 0.04% 115 6070 0.05% 116 6257 0.05% 117 6429 0.05% 118 6460 0.05% 119 6884 0.05% 120 7209 0.05% 121 7657 0.06% 122 8041 0.06% 123 8834 0.07% 124 9063 0.07% 125 9390 0.07% 126 9754 0.07% 127 9973 0.08% 128 10300 0.08% 129 10444 0.08% 130 10791 0.08% 131 11049 0.08% 132 11894 0.09% 133 12714 0.10% 134 13187 0.10% 135 13642 0.10% 136 14070 0.11% 137 14385 0.11% 138 14475 0.11% 139 15102 0.12% 140 15146 0.12% 141 15936 0.12% 142 16384 0.12% 143 17125 0.13% 144 17893 0.14% 145 18605 0.14% 146 19572 0.15% 147 19911 0.15% 148 20187 0.15% 149 20123 0.15% 150 20971 0.16% 151 12572034 95.87% 13113162 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=17 prefix-density=0.88 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=8.51 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.1 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=23 prefix-density=1.05 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=452.99 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.8 sequence=AGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGG SRR12161368 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:45:23 Started mapping on | Feb 13 18:45:23 Finished on | Feb 13 18:46:55 Mapping speed, Million of reads per hour | 513.12 Number of input reads | 13113162 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11931751 Uniquely mapped reads % | 90.99% Average mapped length | 298.78 Number of splices: Total | 12050106 Number of splices: Annotated (sjdb) | 11771609 Number of splices: GT/AG | 11801208 Number of splices: GC/AG | 200057 Number of splices: AT/AC | 9851 Number of splices: Non-canonical | 38990 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302220 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 68123 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.89% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 879191 879191 879191 N_multimapping 302220 302220 302220 N_noFeature 419440 11774538 466757 N_ambiguous 193104 776 82828 UnstrandedReadsAssigned:11319207 PositiveStrandReadsAssigned:156437 NegativeStrandReadsAssigned:11382166 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161368-trimmed-pair1.fastq SRR12161368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,113,162 reads, 11,472,504 reads pseudoaligned [quant] estimated average fragment length: 286.878 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR12161368.ke.tsv 34699 SRR12161368.se.tsv 87100 total ==> SRR12161368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.12 322 13.7056 Potri.005G024800.1.v4.1 1035 749.122 245 24.1121 Potri.004G059700.1.v4.1 961 675.327 8 0.873369 Potri.007G009000.2.v4.1 1416 1130.12 0 0 Potri.003G141000.2.v4.1 2943 2657.12 479.452 13.3032 Potri.016G087400.1.v4.1 270 68.7018 551 591.296 Potri.015G069301.1.v4.1 564 296.009 0 0 Potri.010G195200.1.v4.1 1773 1487.12 5 0.247882 Potri.012G127500.1.v4.1 977 691.242 68 7.25271 ==> SRR12161368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 126 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12161368 completed mapping pipeline successfully