Starting /dee2/code/volunteer_pipeline.sh SRR12161369 current disk space = 3087412293632 free memory = 1582594344 SRR12161369 SRAfilesize 250d2d368d8153d7d8b0ac185d936425 SRR12161369.sra SRR12161369.sra file validated SRR12161369 is paired end SRR12161369 is conventional basespace SRR12161369 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.64925 37.0 37.0 37.0 37.0 37.0 2 36.429 37.0 37.0 37.0 37.0 37.0 3 36.475 37.0 37.0 37.0 37.0 37.0 4 36.546 37.0 37.0 37.0 37.0 37.0 5 36.582 37.0 37.0 37.0 37.0 37.0 6 36.5565 37.0 37.0 37.0 37.0 37.0 7 36.6235 37.0 37.0 37.0 37.0 37.0 8 36.5985 37.0 37.0 37.0 37.0 37.0 9 36.5865 37.0 37.0 37.0 37.0 37.0 10-14 36.5731 37.0 37.0 37.0 37.0 37.0 15-19 36.5711 37.0 37.0 37.0 37.0 37.0 20-24 36.5046 37.0 37.0 37.0 37.0 37.0 25-29 36.4688 37.0 37.0 37.0 37.0 37.0 30-34 36.5121 37.0 37.0 37.0 37.0 37.0 35-39 36.479299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4439 37.0 37.0 37.0 37.0 37.0 45-49 36.4215 37.0 37.0 37.0 37.0 37.0 50-54 36.4028 37.0 37.0 37.0 37.0 37.0 55-59 36.3959 37.0 37.0 37.0 37.0 37.0 60-64 36.3685 37.0 37.0 37.0 37.0 37.0 65-69 36.3793 37.0 37.0 37.0 37.0 37.0 70-74 36.3787 37.0 37.0 37.0 37.0 37.0 75-79 36.3346 37.0 37.0 37.0 37.0 37.0 80-84 36.317899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2452 37.0 37.0 37.0 37.0 37.0 90-94 36.2961 37.0 37.0 37.0 37.0 37.0 95-99 36.2393 37.0 37.0 37.0 37.0 37.0 100-104 36.2598 37.0 37.0 37.0 37.0 37.0 105-109 36.178700000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.2091 37.0 37.0 37.0 37.0 37.0 115-119 36.1808 37.0 37.0 37.0 37.0 37.0 120-124 36.1268 37.0 37.0 37.0 37.0 37.0 125-129 36.126 37.0 37.0 37.0 37.0 37.0 130-134 36.0649 37.0 37.0 37.0 37.0 37.0 135-139 35.9608 37.0 37.0 37.0 37.0 37.0 140-144 35.96939999999999 37.0 37.0 37.0 37.0 37.0 145-149 36.0034 37.0 37.0 37.0 37.0 37.0 150-151 35.8945 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 1.0 25 1.0 26 2.0 27 6.0 28 9.0 29 19.0 30 31.0 31 36.0 32 46.0 33 71.0 34 95.0 35 276.0 36 2963.0 37 441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.58614653663416 11.902975743935984 5.051262815703926 38.45961490372593 2 19.5 12.675 35.225 32.6 3 16.05 16.325 30.85 36.775000000000006 4 21.15 25.124999999999996 25.074999999999996 28.65 5 24.125 31.3 23.200000000000003 21.375 6 21.125 34.25 22.725 21.9 7 14.549999999999999 25.6 41.375 18.475 8 17.525 26.974999999999998 32.324999999999996 23.175 9 16.3 25.2 34.575 23.925 10-14 20.155 29.515 27.060000000000002 23.27 15-19 19.875 28.205000000000002 27.889999999999997 24.03 20-24 20.055 28.32 27.855 23.77 25-29 20.235 27.805000000000003 27.185 24.775 30-34 19.54 28.525 27.565 24.37 35-39 20.075000000000003 28.194999999999997 27.91 23.82 40-44 19.45 28.63 27.975 23.945 45-49 19.97 28.605000000000004 27.01 24.415 50-54 19.84 28.18 27.27 24.709999999999997 55-59 20.5 27.544999999999998 27.744999999999997 24.21 60-64 19.875 28.465 27.560000000000002 24.099999999999998 65-69 20.525 27.98 27.76 23.735 70-74 20.275000000000002 28.17 27.735 23.82 75-79 20.25 28.33 27.26 24.16 80-84 20.16 28.084999999999997 27.41 24.345 85-89 20.5 28.285 27.0 24.215 90-94 20.465 27.534999999999997 27.644999999999996 24.355 95-99 20.57 28.294999999999998 27.54 23.595 100-104 21.095 27.85 27.055 24.0 105-109 20.369999999999997 28.060000000000002 27.68 23.89 110-114 20.62 27.975 27.38 24.025 115-119 20.635 28.53 26.8 24.035 120-124 20.895 28.15 27.245 23.71 125-129 20.935000000000002 28.105000000000004 26.905 24.055 130-134 20.3 27.605 27.83 24.265 135-139 21.15 27.765 26.75 24.335 140-144 20.810000000000002 27.68 28.03 23.48 145-149 20.845 27.12 27.705000000000002 24.33 150-151 20.8875 27.325 27.462500000000002 24.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 0.5 25 3.0 26 6.5 27 6.5 28 8.5 29 11.5 30 15.5 31 27.5 32 29.0 33 30.5 34 47.0 35 62.5 36 81.5 37 103.5 38 123.5 39 156.0 40 179.5 41 197.5 42 223.0 43 220.0 44 231.0 45 259.5 46 257.0 47 262.5 48 255.5 49 218.5 50 195.5 51 173.5 52 134.5 53 111.5 54 98.0 55 73.0 56 54.5 57 41.5 58 29.0 59 22.5 60 16.0 61 8.5 62 6.5 63 3.5 64 1.5 65 2.5 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.18944016980632 88.75 2 5.518705226850624 10.4 3 0.26532236667551073 0.75 4 0.02653223666755107 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.7124999999999999 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161369 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31 37.0 37.0 37.0 37.0 37.0 2 35.9495 37.0 37.0 37.0 37.0 37.0 3 35.998 37.0 37.0 37.0 37.0 37.0 4 36.082 37.0 37.0 37.0 37.0 37.0 5 36.2235 37.0 37.0 37.0 37.0 37.0 6 36.1375 37.0 37.0 37.0 37.0 37.0 7 36.1525 37.0 37.0 37.0 37.0 37.0 8 36.161 37.0 37.0 37.0 37.0 37.0 9 36.1925 37.0 37.0 37.0 37.0 37.0 10-14 36.1755 37.0 37.0 37.0 37.0 37.0 15-19 36.176500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.145 37.0 37.0 37.0 37.0 37.0 25-29 36.0844 37.0 37.0 37.0 37.0 37.0 30-34 36.095 37.0 37.0 37.0 37.0 37.0 35-39 36.0689 37.0 37.0 37.0 37.0 37.0 40-44 36.07340000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.04860000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9918 37.0 37.0 37.0 37.0 37.0 55-59 35.976 37.0 37.0 37.0 37.0 37.0 60-64 36.0029 37.0 37.0 37.0 37.0 37.0 65-69 35.94539999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.874 37.0 37.0 37.0 37.0 37.0 75-79 35.85459999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.9071 37.0 37.0 37.0 37.0 37.0 85-89 35.852799999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.8401 37.0 37.0 37.0 37.0 37.0 95-99 35.8406 37.0 37.0 37.0 37.0 37.0 100-104 35.8036 37.0 37.0 37.0 37.0 37.0 105-109 35.793 37.0 37.0 37.0 37.0 37.0 110-114 35.7384 37.0 37.0 37.0 37.0 37.0 115-119 35.7324 37.0 37.0 37.0 37.0 37.0 120-124 35.75430000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6434 37.0 37.0 37.0 37.0 37.0 130-134 35.533699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6782 37.0 37.0 37.0 37.0 37.0 140-144 35.5052 37.0 37.0 37.0 37.0 37.0 145-149 35.5558 37.0 37.0 37.0 37.0 37.0 150-151 35.04 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 4.0 15 1.0 16 1.0 17 4.0 18 6.0 19 1.0 20 0.0 21 1.0 22 6.0 23 6.0 24 6.0 25 9.0 26 6.0 27 9.0 28 16.0 29 14.0 30 20.0 31 35.0 32 53.0 33 100.0 34 189.0 35 541.0 36 2709.0 37 257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.3 23.925 8.774999999999999 24.0 2 27.725 26.700000000000003 29.549999999999997 16.025 3 22.05 26.950000000000003 32.35 18.65 4 24.6 34.225 22.8 18.375 5 24.825 36.675000000000004 21.7 16.8 6 20.125 40.525 21.825 17.525 7 20.724999999999998 22.175 38.05 19.05 8 21.875 25.900000000000002 27.650000000000002 24.575 9 22.525000000000002 24.525 28.599999999999998 24.349999999999998 10-14 22.84 29.695 25.955000000000002 21.51 15-19 22.89 28.904999999999998 27.389999999999997 20.815 20-24 23.200000000000003 28.970000000000002 26.63 21.2 25-29 22.875 28.98 26.91 21.235 30-34 23.05 27.805000000000003 27.689999999999998 21.455 35-39 23.06 28.53 27.255000000000003 21.154999999999998 40-44 23.244999999999997 28.215 27.275 21.265 45-49 22.625 27.505000000000003 27.815 22.055 50-54 23.29 28.03 27.584999999999997 21.095 55-59 23.16 27.715 27.700000000000003 21.425 60-64 23.105 27.860000000000003 27.265 21.77 65-69 23.195 27.99 26.995 21.82 70-74 23.494999999999997 27.925 26.979999999999997 21.6 75-79 23.105 28.325 26.765 21.805 80-84 22.605 29.01 26.405 21.98 85-89 23.27 27.66 27.735 21.335 90-94 23.580000000000002 27.834999999999997 27.33 21.255 95-99 23.41 27.6 27.395000000000003 21.595 100-104 23.905 27.905 26.99 21.2 105-109 23.015 28.08 27.27 21.634999999999998 110-114 23.09 27.76 27.755000000000003 21.395 115-119 23.855 28.595 26.995 20.555 120-124 23.28 28.134999999999998 27.41 21.175 125-129 23.62 28.205000000000002 27.529999999999998 20.645 130-134 24.095 27.944999999999997 27.1 20.86 135-139 23.535 27.66 27.805000000000003 21.0 140-144 23.54 27.705000000000002 27.83 20.925 145-149 24.305 27.85 26.985 20.86 150-151 25.0375 28.025 26.6625 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 1.0 14 1.0 15 1.5 16 1.5 17 3.0 18 3.5 19 2.0 20 1.5 21 0.5 22 0.5 23 1.0 24 2.5 25 4.0 26 4.5 27 5.0 28 7.5 29 8.5 30 15.5 31 22.5 32 26.0 33 36.0 34 49.5 35 66.5 36 78.0 37 85.5 38 107.0 39 135.5 40 175.0 41 211.5 42 229.5 43 259.5 44 265.0 45 269.5 46 257.0 47 246.0 48 248.0 49 215.0 50 185.5 51 163.5 52 134.0 53 102.0 54 84.0 55 64.5 56 53.0 57 44.0 58 29.0 59 22.5 60 18.5 61 11.5 62 12.0 63 9.0 64 2.0 65 1.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.04221212930804 88.0 2 5.423457119957254 10.15 3 0.4007480630510286 1.125 4 0.05343307507347048 0.2 5 0.02671653753673524 0.125 6 0.0 0.0 7 0.02671653753673524 0.17500000000000002 8 0.0 0.0 9 0.02671653753673524 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.9625 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138-139 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATAC 10 0.006830828 145.0 9 TAGTGAT 10 0.006830828 145.0 9 >>END_MODULE Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra Read 915619 spots for SRR12161369.sra Written 915619 spots for SRR12161369.sra Read 915615 spots for SRR12161369.sra Written 915615 spots for SRR12161369.sra SRR ids: ['SRR12161369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sm2up25_ SRR12161369.sra spots: 18312304 blocks: [[1, 915615], [915616, 1831230], [1831231, 2746845], [2746846, 3662460], [3662461, 4578075], [4578076, 5493690], [5493691, 6409305], [6409306, 7324920], [7324921, 8240535], [8240536, 9156150], [9156151, 10071765], [10071766, 10987380], [10987381, 11902995], [11902996, 12818610], [12818611, 13734225], [13734226, 14649840], [14649841, 15565455], [15565456, 16481070], [16481071, 17396685], [17396686, 18312304]] SRR12161369 file size 6201621 SRR12161369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161369 SRR12161369_1.fastq SRR12161369_2.fastq Input file: SRR12161369_1.fastq Paired file: SRR12161369_2.fastq trimmed: SRR12161369-trimmed-pair1.fastq, SRR12161369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:38:53 2025 >> started Thu Feb 13 19:39:12 2025 >> done (19.166s) 18312304 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 2014 ( 0.01%) empty read pairs filtered out after trimming by size control 18310273 (99.99%) read pairs available; of these: 697416 ( 3.81%) trimmed read pairs available after processing 17612857 (96.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 9 0.00% 23 3 0.00% 24 10 0.00% 25 8 0.00% 26 3 0.00% 27 8 0.00% 28 7 0.00% 29 12 0.00% 30 5 0.00% 31 12 0.00% 32 12 0.00% 33 7 0.00% 34 5 0.00% 35 12 0.00% 36 20 0.00% 37 11 0.00% 38 8 0.00% 39 12 0.00% 40 11 0.00% 41 9 0.00% 42 6 0.00% 43 14 0.00% 44 12 0.00% 45 20 0.00% 46 18 0.00% 47 18 0.00% 48 22 0.00% 49 22 0.00% 50 21 0.00% 51 35 0.00% 52 20 0.00% 53 33 0.00% 54 35 0.00% 55 34 0.00% 56 28 0.00% 57 25 0.00% 58 39 0.00% 59 47 0.00% 60 50 0.00% 61 53 0.00% 62 49 0.00% 63 62 0.00% 64 59 0.00% 65 81 0.00% 66 77 0.00% 67 90 0.00% 68 103 0.00% 69 105 0.00% 70 112 0.00% 71 140 0.00% 72 185 0.00% 73 180 0.00% 74 196 0.00% 75 254 0.00% 76 273 0.00% 77 275 0.00% 78 308 0.00% 79 369 0.00% 80 367 0.00% 81 440 0.00% 82 482 0.00% 83 577 0.00% 84 628 0.00% 85 690 0.00% 86 746 0.00% 87 818 0.00% 88 967 0.01% 89 996 0.01% 90 1125 0.01% 91 1268 0.01% 92 1331 0.01% 93 1546 0.01% 94 1741 0.01% 95 1876 0.01% 96 2005 0.01% 97 2179 0.01% 98 2433 0.01% 99 2577 0.01% 100 2842 0.02% 101 2950 0.02% 102 3271 0.02% 103 3435 0.02% 104 3972 0.02% 105 4227 0.02% 106 4348 0.02% 107 4501 0.02% 108 4952 0.03% 109 5152 0.03% 110 5461 0.03% 111 5769 0.03% 112 6163 0.03% 113 6496 0.04% 114 7019 0.04% 115 7229 0.04% 116 7617 0.04% 117 8083 0.04% 118 8565 0.05% 119 8909 0.05% 120 9204 0.05% 121 9748 0.05% 122 10221 0.06% 123 10891 0.06% 124 11348 0.06% 125 11647 0.06% 126 12129 0.07% 127 12848 0.07% 128 13395 0.07% 129 13634 0.07% 130 14563 0.08% 131 14647 0.08% 132 15215 0.08% 133 16214 0.09% 134 16921 0.09% 135 17648 0.10% 136 18075 0.10% 137 18758 0.10% 138 19205 0.10% 139 20358 0.11% 140 20738 0.11% 141 21339 0.12% 142 22165 0.12% 143 23070 0.13% 144 24208 0.13% 145 24720 0.14% 146 25441 0.14% 147 26140 0.14% 148 27097 0.15% 149 27405 0.15% 150 29001 0.16% 151 17612857 96.19% 18310273 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.81 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=11.94 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.6 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=20 prefix-density=0.99 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.22 sequence-density-rank=27 fanout-score=21.98 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=6.4 sequence=GCAATGGCAGCCTCAGTTATGGCTTCA SRR12161369 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:39:57 Started mapping on | Feb 13 19:39:57 Finished on | Feb 13 19:42:08 Mapping speed, Million of reads per hour | 503.18 Number of input reads | 18310273 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17123379 Uniquely mapped reads % | 93.52% Average mapped length | 299.30 Number of splices: Total | 18024846 Number of splices: Annotated (sjdb) | 17694864 Number of splices: GT/AG | 17649892 Number of splices: GC/AG | 316077 Number of splices: AT/AC | 10537 Number of splices: Non-canonical | 48340 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460618 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 108319 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 726276 726276 726276 N_multimapping 460618 460618 460618 N_noFeature 531546 16893396 586634 N_ambiguous 287149 988 111661 UnstrandedReadsAssigned:16304684 PositiveStrandReadsAssigned:228995 NegativeStrandReadsAssigned:16425084 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161369-trimmed-pair1.fastq SRR12161369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,310,273 reads, 16,398,613 reads pseudoaligned [quant] estimated average fragment length: 285.673 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 997 rounds 52401 SRR12161369.ke.tsv 34699 SRR12161369.se.tsv 87100 total ==> SRR12161369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.33 493 13.8521 Potri.005G024800.1.v4.1 1035 750.327 525 34.0768 Potri.004G059700.1.v4.1 961 676.462 15 1.07993 Potri.007G009000.2.v4.1 1416 1131.33 0 0 Potri.003G141000.2.v4.1 2943 2658.33 602.065 11.0302 Potri.016G087400.1.v4.1 270 66.649 587 428.937 Potri.015G069301.1.v4.1 564 294.804 0 0 Potri.010G195200.1.v4.1 1773 1488.33 17 0.556288 Potri.012G127500.1.v4.1 977 692.385 146 10.2696 ==> SRR12161369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 66 SRR12161369 completed mapping pipeline successfully