Starting /dee2/code/volunteer_pipeline.sh SRR12161370 current disk space = 3087372312576 free memory = 1502954604 SRR12161370 SRAfilesize b4ee29011d57e99610624edd6072f0d8 SRR12161370.sra SRR12161370.sra file validated SRR12161370 is paired end SRR12161370 is conventional basespace SRR12161370 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53525 37.0 37.0 37.0 37.0 37.0 2 36.3995 37.0 37.0 37.0 37.0 37.0 3 36.5245 37.0 37.0 37.0 37.0 37.0 4 36.545 37.0 37.0 37.0 37.0 37.0 5 36.5785 37.0 37.0 37.0 37.0 37.0 6 36.576 37.0 37.0 37.0 37.0 37.0 7 36.4985 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.4515 37.0 37.0 37.0 37.0 37.0 10-14 36.58919999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.536199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.516200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4609 37.0 37.0 37.0 37.0 37.0 30-34 36.485899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4557 37.0 37.0 37.0 37.0 37.0 40-44 36.4585 37.0 37.0 37.0 37.0 37.0 45-49 36.4681 37.0 37.0 37.0 37.0 37.0 50-54 36.4112 37.0 37.0 37.0 37.0 37.0 55-59 36.403800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3733 37.0 37.0 37.0 37.0 37.0 65-69 36.3623 37.0 37.0 37.0 37.0 37.0 70-74 36.3688 37.0 37.0 37.0 37.0 37.0 75-79 36.333299999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2902 37.0 37.0 37.0 37.0 37.0 85-89 36.235299999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2761 37.0 37.0 37.0 37.0 37.0 95-99 36.257799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2725 37.0 37.0 37.0 37.0 37.0 105-109 36.1403 37.0 37.0 37.0 37.0 37.0 110-114 36.167100000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.178200000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.168400000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.1034 37.0 37.0 37.0 37.0 37.0 130-134 36.0883 37.0 37.0 37.0 37.0 37.0 135-139 36.00320000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8996 37.0 37.0 37.0 37.0 37.0 145-149 35.9196 37.0 37.0 37.0 37.0 37.0 150-151 35.754999999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 3.0 25 0.0 26 2.0 27 3.0 28 11.0 29 13.0 30 19.0 31 44.0 32 57.0 33 69.0 34 113.0 35 297.0 36 2958.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.13309982486865 11.983987990993244 5.253940455341506 38.62897172879659 2 20.474999999999998 13.075000000000001 34.449999999999996 32.0 3 16.900000000000002 16.650000000000002 29.175 37.275000000000006 4 20.349999999999998 25.25 24.575 29.825000000000003 5 23.0 31.1 24.625 21.275 6 20.125 34.775 23.825 21.275 7 13.925 26.775 42.15 17.150000000000002 8 18.175 25.6 33.025 23.200000000000003 9 17.4 22.35 36.425000000000004 23.825 10-14 19.935 29.65 27.474999999999998 22.939999999999998 15-19 20.235 28.044999999999998 27.54 24.18 20-24 20.635 27.975 27.694999999999997 23.695 25-29 19.72 28.83 27.544999999999998 23.905 30-34 19.994999999999997 28.01 28.01 23.985 35-39 20.485 27.865000000000002 27.400000000000002 24.25 40-44 20.345 27.975 27.474999999999998 24.205 45-49 20.474999999999998 28.015 27.435 24.075 50-54 20.68 28.02 26.950000000000003 24.349999999999998 55-59 20.18 28.134999999999998 27.63 24.055 60-64 20.62 27.775 27.365000000000002 24.240000000000002 65-69 20.27 28.465 26.93 24.335 70-74 20.32 28.139999999999997 27.405 24.135 75-79 20.34 28.215 27.445000000000004 24.0 80-84 21.035 28.675 26.545 23.745 85-89 20.285 27.915 27.625 24.175 90-94 20.335 27.915 27.655 24.095 95-99 20.369999999999997 27.515 28.15 23.965 100-104 21.365000000000002 27.505000000000003 27.894999999999996 23.235 105-109 20.369999999999997 27.884999999999998 28.15 23.595 110-114 20.845 28.515 26.965 23.674999999999997 115-119 21.42 28.65 26.615 23.315 120-124 20.355 27.99 27.805000000000003 23.849999999999998 125-129 20.745 27.310000000000002 27.455000000000002 24.490000000000002 130-134 20.68 27.01 28.27 24.04 135-139 21.245 27.37 27.58 23.805 140-144 21.755 27.894999999999996 26.86 23.49 145-149 21.305 27.345000000000002 27.595 23.755000000000003 150-151 20.875 27.8875 27.224999999999998 24.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 2.0 25 2.0 26 2.0 27 4.0 28 9.0 29 12.0 30 9.5 31 17.0 32 28.0 33 40.5 34 56.5 35 69.0 36 80.5 37 91.5 38 117.5 39 146.5 40 165.0 41 190.5 42 222.0 43 252.5 44 276.5 45 262.0 46 245.5 47 248.0 48 238.5 49 226.5 50 197.0 51 164.5 52 141.5 53 119.5 54 89.5 55 62.0 56 50.5 57 43.0 58 33.5 59 27.5 60 21.0 61 11.5 62 8.0 63 3.5 64 1.5 65 2.0 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.86291408564503 86.2 2 6.571505521141933 12.2 3 0.5386479935362241 1.5 4 0.026932399676811204 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.075 0.0 0.0 0.0 0.0 138-139 1.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161370 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.237 37.0 37.0 37.0 37.0 37.0 2 35.903 37.0 37.0 37.0 37.0 37.0 3 36.075 37.0 37.0 37.0 37.0 37.0 4 36.126 37.0 37.0 37.0 37.0 37.0 5 36.2235 37.0 37.0 37.0 37.0 37.0 6 36.176 37.0 37.0 37.0 37.0 37.0 7 36.246 37.0 37.0 37.0 37.0 37.0 8 36.184 37.0 37.0 37.0 37.0 37.0 9 36.246 37.0 37.0 37.0 37.0 37.0 10-14 36.2448 37.0 37.0 37.0 37.0 37.0 15-19 36.2245 37.0 37.0 37.0 37.0 37.0 20-24 36.178000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.192600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.147499999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1415 37.0 37.0 37.0 37.0 37.0 40-44 36.1306 37.0 37.0 37.0 37.0 37.0 45-49 36.0711 37.0 37.0 37.0 37.0 37.0 50-54 36.081 37.0 37.0 37.0 37.0 37.0 55-59 36.0444 37.0 37.0 37.0 37.0 37.0 60-64 36.0212 37.0 37.0 37.0 37.0 37.0 65-69 35.9626 37.0 37.0 37.0 37.0 37.0 70-74 35.8698 37.0 37.0 37.0 37.0 37.0 75-79 35.9017 37.0 37.0 37.0 37.0 37.0 80-84 35.940099999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.90839999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.8504 37.0 37.0 37.0 37.0 37.0 95-99 35.8586 37.0 37.0 37.0 37.0 37.0 100-104 35.8703 37.0 37.0 37.0 37.0 37.0 105-109 35.7798 37.0 37.0 37.0 37.0 37.0 110-114 35.7818 37.0 37.0 37.0 37.0 37.0 115-119 35.7654 37.0 37.0 37.0 37.0 37.0 120-124 35.7709 37.0 37.0 37.0 37.0 37.0 125-129 35.6559 37.0 37.0 37.0 37.0 37.0 130-134 35.5594 37.0 37.0 37.0 37.0 37.0 135-139 35.6297 37.0 37.0 37.0 37.0 37.0 140-144 35.6624 37.0 37.0 37.0 37.0 37.0 145-149 35.6492 37.0 37.0 37.0 37.0 37.0 150-151 35.0005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 5.0 23 8.0 24 3.0 25 6.0 26 4.0 27 10.0 28 10.0 29 20.0 30 24.0 31 39.0 32 70.0 33 111.0 34 187.0 35 565.0 36 2666.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 27.200000000000003 8.450000000000001 26.525 2 26.75 27.425 29.599999999999998 16.225 3 20.025000000000002 28.125 32.625 19.225 4 23.625 35.25 22.25 18.875 5 23.549999999999997 36.8 21.099999999999998 18.55 6 19.475 40.849999999999994 23.075000000000003 16.6 7 19.325 23.75 38.725 18.2 8 21.325 26.400000000000002 27.175 25.1 9 20.9 23.525 30.599999999999998 24.975 10-14 23.330000000000002 28.92 26.31 21.44 15-19 23.22 28.475 27.32 20.985 20-24 22.455 28.83 27.435 21.279999999999998 25-29 23.335 27.785 27.725 21.154999999999998 30-34 22.765 27.57 28.035 21.63 35-39 22.505 27.975 27.67 21.85 40-44 22.515 28.155 28.08 21.25 45-49 22.575 27.615000000000002 27.63 22.18 50-54 22.53 27.584999999999997 28.005000000000003 21.88 55-59 22.915 27.810000000000002 28.125 21.15 60-64 22.755 27.834999999999997 27.694999999999997 21.715 65-69 22.89 27.465 27.32 22.325 70-74 23.13 27.395000000000003 27.565 21.91 75-79 23.05 27.810000000000002 27.01 22.13 80-84 23.3 28.065 26.895000000000003 21.740000000000002 85-89 23.580000000000002 27.76 27.045 21.615000000000002 90-94 24.295 27.939999999999998 26.605 21.16 95-99 23.52 27.605 26.924999999999997 21.95 100-104 23.805 27.705000000000002 26.85 21.64 105-109 23.355 28.37 27.305 20.97 110-114 23.885 28.1 27.315 20.7 115-119 24.13 28.565 26.57 20.735 120-124 23.465 27.72 27.500000000000004 21.315 125-129 23.945 27.325 27.295 21.435000000000002 130-134 23.705000000000002 27.13 27.994999999999997 21.17 135-139 23.97 27.485 27.700000000000003 20.845 140-144 23.91 27.735 27.51 20.845 145-149 24.26 27.589999999999996 27.655 20.495 150-151 24.6875 27.650000000000002 27.025 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.5 19 1.0 20 1.0 21 1.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 5.5 28 6.5 29 8.5 30 10.5 31 15.5 32 27.0 33 35.0 34 40.5 35 53.0 36 83.0 37 114.5 38 120.5 39 142.0 40 186.0 41 217.5 42 240.5 43 254.5 44 261.5 45 271.0 46 266.0 47 262.0 48 239.5 49 209.5 50 180.5 51 144.5 52 134.5 53 110.0 54 86.5 55 74.0 56 53.5 57 35.5 58 24.5 59 22.5 60 18.0 61 8.5 62 7.5 63 6.0 64 2.0 65 1.0 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.90531427029943 86.1 2 6.447261936876181 11.95 3 0.5395198273536552 1.5 4 0.08092797410304828 0.3 5 0.0 0.0 6 0.02697599136768276 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.5874999999999999 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTGA 10 0.006830828 145.0 8 CTCAACA 10 0.006830828 145.0 3 >>END_MODULE Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876798 spots for SRR12161370.sra Written 876798 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra Read 876792 spots for SRR12161370.sra Written 876792 spots for SRR12161370.sra SRR ids: ['SRR12161370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_igfxdjsa SRR12161370.sra spots: 17535846 blocks: [[1, 876792], [876793, 1753584], [1753585, 2630376], [2630377, 3507168], [3507169, 4383960], [4383961, 5260752], [5260753, 6137544], [6137545, 7014336], [7014337, 7891128], [7891129, 8767920], [8767921, 9644712], [9644713, 10521504], [10521505, 11398296], [11398297, 12275088], [12275089, 13151880], [13151881, 14028672], [14028673, 14905464], [14905465, 15782256], [15782257, 16659048], [16659049, 17535846]] SRR12161370 file size 5937747 SRR12161370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161370 SRR12161370_1.fastq SRR12161370_2.fastq Input file: SRR12161370_1.fastq Paired file: SRR12161370_2.fastq trimmed: SRR12161370-trimmed-pair1.fastq, SRR12161370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:15:31 2025 >> started Thu Feb 13 19:15:49 2025 >> done (18.795s) 17535846 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 2606 ( 0.01%) empty read pairs filtered out after trimming by size control 17533223 (99.99%) read pairs available; of these: 457618 ( 2.61%) trimmed read pairs available after processing 17075605 (97.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 4 0.00% 21 5 0.00% 22 0 0.00% 23 4 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 6 0.00% 28 13 0.00% 29 13 0.00% 30 7 0.00% 31 16 0.00% 32 7 0.00% 33 11 0.00% 34 9 0.00% 35 11 0.00% 36 8 0.00% 37 12 0.00% 38 12 0.00% 39 14 0.00% 40 18 0.00% 41 15 0.00% 42 10 0.00% 43 15 0.00% 44 9 0.00% 45 14 0.00% 46 15 0.00% 47 16 0.00% 48 13 0.00% 49 19 0.00% 50 18 0.00% 51 17 0.00% 52 27 0.00% 53 31 0.00% 54 21 0.00% 55 29 0.00% 56 28 0.00% 57 42 0.00% 58 36 0.00% 59 51 0.00% 60 40 0.00% 61 53 0.00% 62 51 0.00% 63 53 0.00% 64 68 0.00% 65 61 0.00% 66 80 0.00% 67 101 0.00% 68 95 0.00% 69 113 0.00% 70 118 0.00% 71 128 0.00% 72 145 0.00% 73 145 0.00% 74 159 0.00% 75 215 0.00% 76 217 0.00% 77 237 0.00% 78 287 0.00% 79 328 0.00% 80 310 0.00% 81 295 0.00% 82 420 0.00% 83 442 0.00% 84 495 0.00% 85 584 0.00% 86 649 0.00% 87 682 0.00% 88 720 0.00% 89 820 0.00% 90 893 0.01% 91 953 0.01% 92 1073 0.01% 93 1168 0.01% 94 1313 0.01% 95 1324 0.01% 96 1474 0.01% 97 1699 0.01% 98 1798 0.01% 99 1943 0.01% 100 2015 0.01% 101 2137 0.01% 102 2338 0.01% 103 2551 0.01% 104 2719 0.02% 105 2882 0.02% 106 2986 0.02% 107 3276 0.02% 108 3408 0.02% 109 3656 0.02% 110 3749 0.02% 111 3971 0.02% 112 4279 0.02% 113 4601 0.03% 114 4744 0.03% 115 4925 0.03% 116 5338 0.03% 117 5563 0.03% 118 5605 0.03% 119 6045 0.03% 120 6097 0.03% 121 6502 0.04% 122 6900 0.04% 123 7060 0.04% 124 7337 0.04% 125 7851 0.04% 126 8180 0.05% 127 8416 0.05% 128 8648 0.05% 129 9044 0.05% 130 9476 0.05% 131 9662 0.06% 132 9913 0.06% 133 10477 0.06% 134 10676 0.06% 135 11222 0.06% 136 11528 0.07% 137 11849 0.07% 138 12379 0.07% 139 12851 0.07% 140 13084 0.07% 141 13585 0.08% 142 14247 0.08% 143 14622 0.08% 144 15065 0.09% 145 15697 0.09% 146 16160 0.09% 147 16578 0.09% 148 17348 0.10% 149 17592 0.10% 150 18418 0.11% 151 17075605 97.39% 17533223 reads passed initial QC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=1.10 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=87.81 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.3 sequence=AGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCC criterion=sequence-density sequence-density=1.65 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=1.65 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=37.20 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12161370 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:16:29 Started mapping on | Feb 13 19:16:29 Finished on | Feb 13 19:18:17 Mapping speed, Million of reads per hour | 584.44 Number of input reads | 17533223 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16584560 Uniquely mapped reads % | 94.59% Average mapped length | 299.78 Number of splices: Total | 17504607 Number of splices: Annotated (sjdb) | 17210080 Number of splices: GT/AG | 17153661 Number of splices: GC/AG | 302024 Number of splices: AT/AC | 10014 Number of splices: Non-canonical | 38908 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361326 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 47655 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587337 587337 587337 N_multimapping 361326 361326 361326 N_noFeature 446319 16364274 496646 N_ambiguous 279818 678 109528 UnstrandedReadsAssigned:15858423 PositiveStrandReadsAssigned:219608 NegativeStrandReadsAssigned:15978386 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161370-trimmed-pair1.fastq SRR12161370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,533,223 reads, 15,940,970 reads pseudoaligned [quant] estimated average fragment length: 296.958 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR12161370.ke.tsv 34699 SRR12161370.se.tsv 87100 total ==> SRR12161370.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1722.04 397 11.6524 Potri.005G024800.1.v4.1 1035 739.042 169 11.5581 Potri.004G059700.1.v4.1 961 665.325 15 1.13953 Potri.007G009000.2.v4.1 1416 1120.04 0 0 Potri.003G141000.2.v4.1 2943 2647.04 579 11.0557 Potri.016G087400.1.v4.1 270 60.5062 614 512.907 Potri.015G069301.1.v4.1 564 284.292 0 0 Potri.010G195200.1.v4.1 1773 1477.04 12 0.410637 Potri.012G127500.1.v4.1 977 681.226 203 15.0617 ==> SRR12161370.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 187 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12161370 completed mapping pipeline successfully