Starting /dee2/code/volunteer_pipeline.sh SRR12161371 current disk space = 3087351537664 free memory = 1500433628 SRR12161371 SRAfilesize 0cb1c0569f85d9e0f365ffe669af8f6c SRR12161371.sra SRR12161371.sra file validated SRR12161371 is paired end SRR12161371 is conventional basespace SRR12161371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.579 37.0 37.0 37.0 37.0 37.0 2 36.3585 37.0 37.0 37.0 37.0 37.0 3 36.512 37.0 37.0 37.0 37.0 37.0 4 36.5855 37.0 37.0 37.0 37.0 37.0 5 36.6045 37.0 37.0 37.0 37.0 37.0 6 36.586 37.0 37.0 37.0 37.0 37.0 7 36.539 37.0 37.0 37.0 37.0 37.0 8 36.609 37.0 37.0 37.0 37.0 37.0 9 36.5395 37.0 37.0 37.0 37.0 37.0 10-14 36.591899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.55030000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4938 37.0 37.0 37.0 37.0 37.0 25-29 36.5176 37.0 37.0 37.0 37.0 37.0 30-34 36.45700000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4405 37.0 37.0 37.0 37.0 37.0 40-44 36.4599 37.0 37.0 37.0 37.0 37.0 45-49 36.435500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.390100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3792 37.0 37.0 37.0 37.0 37.0 60-64 36.353899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.333000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3202 37.0 37.0 37.0 37.0 37.0 75-79 36.305 37.0 37.0 37.0 37.0 37.0 80-84 36.254000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.308 37.0 37.0 37.0 37.0 37.0 90-94 36.297200000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2527 37.0 37.0 37.0 37.0 37.0 100-104 36.1687 37.0 37.0 37.0 37.0 37.0 105-109 36.1254 37.0 37.0 37.0 37.0 37.0 110-114 36.1674 37.0 37.0 37.0 37.0 37.0 115-119 36.1333 37.0 37.0 37.0 37.0 37.0 120-124 36.111000000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.051100000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0432 37.0 37.0 37.0 37.0 37.0 135-139 35.980000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9698 37.0 37.0 37.0 37.0 37.0 145-149 35.92229999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.86025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 4.0 27 8.0 28 11.0 29 14.0 30 27.0 31 33.0 32 47.0 33 68.0 34 116.0 35 295.0 36 2961.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.49724862431216 12.231115557778889 6.803401700850426 36.46823411705853 2 19.85 12.825000000000001 34.425 32.9 3 17.2 15.825 27.450000000000003 39.525 4 21.85 25.124999999999996 24.675 28.349999999999998 5 22.900000000000002 30.4 24.625 22.075 6 20.525 34.599999999999994 23.25 21.625 7 17.275 26.3 40.375 16.05 8 17.599999999999998 26.525 31.125000000000004 24.75 9 17.1 25.5 33.5 23.9 10-14 20.575 29.310000000000002 27.37 22.745 15-19 19.75 28.305000000000003 27.839999999999996 24.104999999999997 20-24 20.48 28.560000000000002 27.13 23.830000000000002 25-29 20.255000000000003 28.425 27.565 23.755000000000003 30-34 19.52 28.299999999999997 27.775 24.404999999999998 35-39 20.355 28.585 27.150000000000002 23.91 40-44 20.46 27.99 27.794999999999998 23.755000000000003 45-49 19.869999999999997 28.51 27.96 23.66 50-54 20.5 28.044999999999998 27.55 23.905 55-59 20.57 28.28 27.57 23.580000000000002 60-64 20.45 28.360000000000003 26.900000000000002 24.29 65-69 20.294999999999998 28.095 27.650000000000002 23.96 70-74 20.31 28.384999999999998 27.875 23.43 75-79 20.265 27.955000000000002 27.63 24.15 80-84 21.095 28.485 27.05 23.369999999999997 85-89 20.345 27.855 27.71 24.09 90-94 20.435 28.08 27.089999999999996 24.395 95-99 20.24 27.61 27.865000000000002 24.285 100-104 20.695 27.83 27.55 23.925 105-109 20.525 27.785 27.650000000000002 24.04 110-114 20.905 27.800000000000004 27.785 23.51 115-119 20.830000000000002 28.12 27.544999999999998 23.505000000000003 120-124 20.845 28.095 26.87 24.19 125-129 20.72 28.01 27.639999999999997 23.630000000000003 130-134 20.59 27.815 27.82 23.775 135-139 21.335 27.685 27.250000000000004 23.73 140-144 21.295 28.475 26.474999999999998 23.755000000000003 145-149 20.974999999999998 27.925 27.61 23.49 150-151 20.5625 27.6125 27.450000000000003 24.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 2.5 26 4.5 27 6.5 28 13.0 29 16.0 30 19.0 31 25.0 32 28.5 33 35.5 34 52.0 35 75.5 36 86.5 37 97.5 38 117.5 39 146.0 40 166.0 41 180.5 42 214.0 43 222.5 44 231.0 45 247.0 46 265.5 47 266.0 48 258.5 49 251.5 50 206.0 51 154.5 52 129.0 53 120.0 54 93.0 55 66.5 56 46.0 57 40.5 58 38.5 59 24.5 60 11.5 61 6.5 62 10.5 63 8.0 64 2.5 65 1.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.87320191795419 88.1 2 5.727224294086308 10.75 3 0.37293553542887586 1.05 4 0.02663825253063399 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCACAC 10 0.006830828 145.0 1 >>END_MODULE SRR12161371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2015 37.0 37.0 37.0 37.0 37.0 2 35.8725 37.0 37.0 37.0 37.0 37.0 3 36.0355 37.0 37.0 37.0 37.0 37.0 4 36.0085 37.0 37.0 37.0 37.0 37.0 5 36.0705 37.0 37.0 37.0 37.0 37.0 6 36.0325 37.0 37.0 37.0 37.0 37.0 7 36.0105 37.0 37.0 37.0 37.0 37.0 8 36.259 37.0 37.0 37.0 37.0 37.0 9 36.229 37.0 37.0 37.0 37.0 37.0 10-14 36.2111 37.0 37.0 37.0 37.0 37.0 15-19 36.185700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.166900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.11039999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1274 37.0 37.0 37.0 37.0 37.0 35-39 36.105999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.018299999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9873 37.0 37.0 37.0 37.0 37.0 50-54 36.0588 37.0 37.0 37.0 37.0 37.0 55-59 35.980399999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9417 37.0 37.0 37.0 37.0 37.0 65-69 35.931599999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.87820000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.844100000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.9315 37.0 37.0 37.0 37.0 37.0 85-89 35.839 37.0 37.0 37.0 37.0 37.0 90-94 35.7892 37.0 37.0 37.0 37.0 37.0 95-99 35.7884 37.0 37.0 37.0 37.0 37.0 100-104 35.76090000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.7053 37.0 37.0 37.0 37.0 37.0 110-114 35.6646 37.0 37.0 37.0 37.0 37.0 115-119 35.6582 37.0 37.0 37.0 37.0 37.0 120-124 35.6611 37.0 37.0 37.0 37.0 37.0 125-129 35.5298 37.0 37.0 37.0 37.0 37.0 130-134 35.4306 37.0 37.0 37.0 34.6 37.0 135-139 35.5461 37.0 37.0 37.0 37.0 37.0 140-144 35.5072 37.0 37.0 37.0 37.0 37.0 145-149 35.5835 37.0 37.0 37.0 37.0 37.0 150-151 34.88375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 1.0 20 1.0 21 1.0 22 6.0 23 7.0 24 5.0 25 10.0 26 9.0 27 9.0 28 17.0 29 17.0 30 26.0 31 41.0 32 67.0 33 114.0 34 221.0 35 585.0 36 2616.0 37 239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125 25.724999999999998 9.1 24.05 2 27.025 27.575 29.4 16.0 3 20.200000000000003 28.15 32.35 19.3 4 23.5 35.15 23.925 17.424999999999997 5 25.3 36.275 21.65 16.775000000000002 6 21.349999999999998 39.1 21.05 18.5 7 19.8 23.549999999999997 38.15 18.5 8 22.1 25.674999999999997 28.199999999999996 24.025 9 22.475 24.95 29.25 23.325000000000003 10-14 22.96 29.775000000000002 26.215 21.05 15-19 23.28 27.665 27.815 21.240000000000002 20-24 22.915 28.32 27.615000000000002 21.15 25-29 22.720000000000002 28.705000000000002 27.345000000000002 21.23 30-34 22.64 28.22 27.284999999999997 21.855 35-39 22.994999999999997 28.355000000000004 27.465 21.185000000000002 40-44 22.725 28.32 27.43 21.525 45-49 23.0 27.950000000000003 27.725 21.325 50-54 23.25 27.79 27.52 21.44 55-59 23.26 28.225 27.584999999999997 20.93 60-64 23.595 27.615000000000002 27.485 21.305 65-69 23.665 27.495000000000005 27.625 21.215 70-74 22.845 27.825 27.450000000000003 21.88 75-79 23.345 27.560000000000002 27.82 21.275 80-84 23.285 27.794999999999998 27.544999999999998 21.375 85-89 23.595 27.57 27.29 21.545 90-94 23.72 27.32 26.985 21.975 95-99 23.555 27.42 27.735 21.29 100-104 23.485 27.655 27.42 21.44 105-109 23.595 27.505000000000003 27.855 21.044999999999998 110-114 23.380000000000003 27.57 27.750000000000004 21.3 115-119 23.335 27.474999999999998 28.02 21.17 120-124 23.865 27.465 27.634999999999998 21.035 125-129 23.5 27.145000000000003 28.055000000000003 21.3 130-134 23.9 28.365000000000002 26.884999999999998 20.849999999999998 135-139 23.474999999999998 27.29 27.865000000000002 21.37 140-144 24.445 27.685 27.405 20.465 145-149 23.549999999999997 27.825 27.49 21.135 150-151 24.5125 27.800000000000004 26.3625 21.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 2.0 15 2.0 16 0.5 17 1.5 18 2.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.0 26 1.5 27 3.5 28 9.0 29 12.5 30 15.5 31 19.0 32 24.0 33 34.0 34 48.0 35 62.5 36 75.0 37 98.0 38 122.0 39 159.0 40 187.5 41 203.5 42 221.5 43 241.0 44 272.0 45 281.0 46 269.5 47 250.5 48 236.5 49 216.0 50 189.5 51 154.0 52 121.5 53 101.5 54 92.5 55 70.0 56 43.5 57 37.5 58 27.5 59 25.0 60 15.5 61 6.5 62 8.5 63 5.0 64 0.5 65 1.5 66 2.0 67 1.5 68 2.5 69 2.0 70 0.5 71 1.5 72 1.5 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.19131361577405 88.375 2 5.2491340261124435 9.85 3 0.4796163069544364 1.35 4 0.05329070077271516 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02664535038635758 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCC 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.9625 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583413 spots for SRR12161371.sra Written 583413 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra Read 583396 spots for SRR12161371.sra Written 583396 spots for SRR12161371.sra SRR ids: ['SRR12161371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_99898mv8 SRR12161371.sra spots: 11667937 blocks: [[1, 583396], [583397, 1166792], [1166793, 1750188], [1750189, 2333584], [2333585, 2916980], [2916981, 3500376], [3500377, 4083772], [4083773, 4667168], [4667169, 5250564], [5250565, 5833960], [5833961, 6417356], [6417357, 7000752], [7000753, 7584148], [7584149, 8167544], [8167545, 8750940], [8750941, 9334336], [9334337, 9917732], [9917733, 10501128], [10501129, 11084524], [11084525, 11667937]] SRR12161371 file size 3943575 SRR12161371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161371 SRR12161371_1.fastq SRR12161371_2.fastq Input file: SRR12161371_1.fastq Paired file: SRR12161371_2.fastq trimmed: SRR12161371-trimmed-pair1.fastq, SRR12161371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:08:20 2025 >> started Thu Feb 13 19:08:33 2025 >> done (12.696s) 11667937 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1212 ( 0.01%) empty read pairs filtered out after trimming by size control 11666706 (99.99%) read pairs available; of these: 428095 ( 3.67%) trimmed read pairs available after processing 11238611 (96.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 8 0.00% 28 0 0.00% 29 8 0.00% 30 6 0.00% 31 8 0.00% 32 7 0.00% 33 4 0.00% 34 11 0.00% 35 8 0.00% 36 5 0.00% 37 8 0.00% 38 11 0.00% 39 16 0.00% 40 11 0.00% 41 6 0.00% 42 6 0.00% 43 10 0.00% 44 9 0.00% 45 8 0.00% 46 9 0.00% 47 12 0.00% 48 22 0.00% 49 10 0.00% 50 11 0.00% 51 9 0.00% 52 13 0.00% 53 15 0.00% 54 15 0.00% 55 18 0.00% 56 27 0.00% 57 24 0.00% 58 24 0.00% 59 21 0.00% 60 33 0.00% 61 37 0.00% 62 27 0.00% 63 37 0.00% 64 44 0.00% 65 48 0.00% 66 46 0.00% 67 49 0.00% 68 59 0.00% 69 74 0.00% 70 82 0.00% 71 95 0.00% 72 92 0.00% 73 88 0.00% 74 134 0.00% 75 114 0.00% 76 141 0.00% 77 161 0.00% 78 186 0.00% 79 178 0.00% 80 206 0.00% 81 231 0.00% 82 291 0.00% 83 330 0.00% 84 393 0.00% 85 379 0.00% 86 487 0.00% 87 488 0.00% 88 486 0.00% 89 622 0.01% 90 660 0.01% 91 748 0.01% 92 771 0.01% 93 971 0.01% 94 1044 0.01% 95 1118 0.01% 96 1285 0.01% 97 1237 0.01% 98 1446 0.01% 99 1523 0.01% 100 1616 0.01% 101 1772 0.02% 102 1955 0.02% 103 2048 0.02% 104 2355 0.02% 105 2431 0.02% 106 2571 0.02% 107 2738 0.02% 108 2875 0.02% 109 3206 0.03% 110 3348 0.03% 111 3504 0.03% 112 3779 0.03% 113 4001 0.03% 114 4285 0.04% 115 4341 0.04% 116 4643 0.04% 117 4868 0.04% 118 5059 0.04% 119 5315 0.05% 120 5722 0.05% 121 5952 0.05% 122 6203 0.05% 123 6539 0.06% 124 7002 0.06% 125 7116 0.06% 126 7421 0.06% 127 7810 0.07% 128 8189 0.07% 129 8301 0.07% 130 8611 0.07% 131 9250 0.08% 132 9705 0.08% 133 9826 0.08% 134 10400 0.09% 135 10913 0.09% 136 11147 0.10% 137 11514 0.10% 138 12020 0.10% 139 12692 0.11% 140 12798 0.11% 141 13143 0.11% 142 13938 0.12% 143 14002 0.12% 144 15085 0.13% 145 15487 0.13% 146 15512 0.13% 147 16508 0.14% 148 16971 0.15% 149 16935 0.15% 150 17823 0.15% 151 11238611 96.33% 11666706 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=82.55 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.0 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=1.19 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=123.58 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=18.9 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCA SRR12161371 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:09:39 Started mapping on | Feb 13 19:09:41 Finished on | Feb 13 19:10:56 Mapping speed, Million of reads per hour | 560.00 Number of input reads | 11666706 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 10864773 Uniquely mapped reads % | 93.13% Average mapped length | 299.40 Number of splices: Total | 10934994 Number of splices: Annotated (sjdb) | 10728133 Number of splices: GT/AG | 10713937 Number of splices: GC/AG | 188193 Number of splices: AT/AC | 7948 Number of splices: Non-canonical | 24916 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348841 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 128880 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453092 453092 453092 N_multimapping 348841 348841 348841 N_noFeature 311714 10753909 344436 N_ambiguous 155777 615 77258 UnstrandedReadsAssigned:10397282 PositiveStrandReadsAssigned:110249 NegativeStrandReadsAssigned:10443079 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161371-trimmed-pair1.fastq SRR12161371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,666,706 reads, 10,605,253 reads pseudoaligned [quant] estimated average fragment length: 287.634 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR12161371.ke.tsv 34699 SRR12161371.se.tsv 87100 total ==> SRR12161371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.37 223 10.4681 Potri.005G024800.1.v4.1 1035 748.366 92 9.99134 Potri.004G059700.1.v4.1 961 674.537 31 3.73513 Potri.007G009000.2.v4.1 1416 1129.37 0 0 Potri.003G141000.2.v4.1 2943 2656.37 242.196 7.41018 Potri.016G087400.1.v4.1 270 66.685 775 944.548 Potri.015G069301.1.v4.1 564 294.288 0 0 Potri.010G195200.1.v4.1 1773 1486.37 1 0.0546795 Potri.012G127500.1.v4.1 977 690.438 802 94.4061 ==> SRR12161371.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12161371 completed mapping pipeline successfully