Starting /dee2/code/volunteer_pipeline.sh SRR12161372 current disk space = 3087531053056 free memory = 1579228280 SRR12161372 SRAfilesize 409bcbef7cb85be02f7fe63037bc61e3 SRR12161372.sra SRR12161372.sra file validated SRR12161372 is paired end SRR12161372 is conventional basespace SRR12161372 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5065 37.0 37.0 37.0 37.0 37.0 2 36.3185 37.0 37.0 37.0 37.0 37.0 3 36.5795 37.0 37.0 37.0 37.0 37.0 4 36.6435 37.0 37.0 37.0 37.0 37.0 5 36.601 37.0 37.0 37.0 37.0 37.0 6 36.5585 37.0 37.0 37.0 37.0 37.0 7 36.5425 37.0 37.0 37.0 37.0 37.0 8 36.501 37.0 37.0 37.0 37.0 37.0 9 36.4915 37.0 37.0 37.0 37.0 37.0 10-14 36.565 37.0 37.0 37.0 37.0 37.0 15-19 36.5115 37.0 37.0 37.0 37.0 37.0 20-24 36.4875 37.0 37.0 37.0 37.0 37.0 25-29 36.493500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.492000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.41799999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4054 37.0 37.0 37.0 37.0 37.0 45-49 36.4357 37.0 37.0 37.0 37.0 37.0 50-54 36.3795 37.0 37.0 37.0 37.0 37.0 55-59 36.3429 37.0 37.0 37.0 37.0 37.0 60-64 36.3348 37.0 37.0 37.0 37.0 37.0 65-69 36.3267 37.0 37.0 37.0 37.0 37.0 70-74 36.3367 37.0 37.0 37.0 37.0 37.0 75-79 36.2548 37.0 37.0 37.0 37.0 37.0 80-84 36.2744 37.0 37.0 37.0 37.0 37.0 85-89 36.2689 37.0 37.0 37.0 37.0 37.0 90-94 36.257400000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.214600000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.207 37.0 37.0 37.0 37.0 37.0 105-109 36.13440000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1466 37.0 37.0 37.0 37.0 37.0 115-119 36.1353 37.0 37.0 37.0 37.0 37.0 120-124 36.114700000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0576 37.0 37.0 37.0 37.0 37.0 130-134 36.0345 37.0 37.0 37.0 37.0 37.0 135-139 35.9892 37.0 37.0 37.0 37.0 37.0 140-144 35.8584 37.0 37.0 37.0 37.0 37.0 145-149 35.936899999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.718999999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 2.0 25 2.0 26 5.0 27 7.0 28 4.0 29 18.0 30 24.0 31 48.0 32 44.0 33 62.0 34 118.0 35 283.0 36 2983.0 37 396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.025 13.15 6.125 36.7 2 20.025000000000002 13.575000000000001 35.949999999999996 30.45 3 16.75 16.45 28.349999999999998 38.45 4 20.775 24.7 24.525 30.0 5 22.6 30.825000000000003 23.525 23.05 6 21.825 35.225 22.725 20.225 7 16.35 25.825 41.175 16.650000000000002 8 17.224999999999998 26.775 31.900000000000002 24.099999999999998 9 16.950000000000003 24.125 34.725 24.2 10-14 18.955 30.555 27.605 22.884999999999998 15-19 19.905 28.02 27.68 24.395 20-24 20.45 27.98 27.67 23.9 25-29 20.085 28.994999999999997 26.97 23.95 30-34 19.67 28.71 27.22 24.4 35-39 19.86 28.015 27.485 24.64 40-44 19.580000000000002 28.605000000000004 27.205000000000002 24.610000000000003 45-49 20.1 28.560000000000002 27.029999999999998 24.310000000000002 50-54 20.435 27.834999999999997 27.700000000000003 24.03 55-59 20.1 28.165000000000003 27.375 24.36 60-64 20.16 27.925 27.87 24.044999999999998 65-69 20.544999999999998 27.939999999999998 27.21 24.305 70-74 20.835 28.33 27.26 23.575 75-79 20.085 28.1 27.534999999999997 24.279999999999998 80-84 20.51 28.64 27.200000000000003 23.65 85-89 19.85 28.825 27.145000000000003 24.18 90-94 20.275000000000002 28.65 27.05 24.025 95-99 21.165 27.16 27.650000000000002 24.025 100-104 20.825 27.939999999999998 27.415 23.82 105-109 19.939999999999998 28.249999999999996 27.975 23.835 110-114 20.505000000000003 27.744999999999997 27.894999999999996 23.855 115-119 20.895 27.92 27.345000000000002 23.84 120-124 20.41 27.445000000000004 27.6 24.545 125-129 20.225 28.315 27.525 23.935000000000002 130-134 20.72 27.605 27.71 23.965 135-139 21.545 27.235 27.139999999999997 24.08 140-144 20.905 27.97 27.205000000000002 23.919999999999998 145-149 21.34 28.105000000000004 26.435 24.12 150-151 21.0 27.987499999999997 26.8 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 2.5 26 2.0 27 2.5 28 7.5 29 12.0 30 17.0 31 21.5 32 27.5 33 37.5 34 45.0 35 56.5 36 86.5 37 111.0 38 135.5 39 146.5 40 163.5 41 193.5 42 220.0 43 238.0 44 257.5 45 279.5 46 266.0 47 246.0 48 230.5 49 223.0 50 196.5 51 165.0 52 152.5 53 112.5 54 78.0 55 71.5 56 53.5 57 37.0 58 28.5 59 23.5 60 16.5 61 9.0 62 6.0 63 4.0 64 1.5 65 2.5 66 2.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.21430449645017 90.525 2 4.443860110439127 8.450000000000001 3 0.28924533263213253 0.8250000000000001 4 0.05259006047856955 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.1375 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.5125 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTCTT 10 0.006830828 145.0 2 >>END_MODULE SRR12161372 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3645 37.0 37.0 37.0 37.0 37.0 2 36.044 37.0 37.0 37.0 37.0 37.0 3 36.05 37.0 37.0 37.0 37.0 37.0 4 36.151 37.0 37.0 37.0 37.0 37.0 5 36.31 37.0 37.0 37.0 37.0 37.0 6 36.239 37.0 37.0 37.0 37.0 37.0 7 36.255 37.0 37.0 37.0 37.0 37.0 8 36.246 37.0 37.0 37.0 37.0 37.0 9 36.284 37.0 37.0 37.0 37.0 37.0 10-14 36.2581 37.0 37.0 37.0 37.0 37.0 15-19 36.2247 37.0 37.0 37.0 37.0 37.0 20-24 36.172399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1294 37.0 37.0 37.0 37.0 37.0 30-34 36.111599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1238 37.0 37.0 37.0 37.0 37.0 40-44 36.095600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.040800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.075900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.041999999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.975699999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.992 37.0 37.0 37.0 37.0 37.0 70-74 35.88420000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8851 37.0 37.0 37.0 37.0 37.0 80-84 35.9321 37.0 37.0 37.0 37.0 37.0 85-89 35.780899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.841899999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8212 37.0 37.0 37.0 37.0 37.0 100-104 35.835899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.7981 37.0 37.0 37.0 37.0 37.0 110-114 35.783699999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7419 37.0 37.0 37.0 37.0 37.0 120-124 35.723 37.0 37.0 37.0 37.0 37.0 125-129 35.673199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.528000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.61030000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.5381 37.0 37.0 37.0 37.0 37.0 145-149 35.636900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.09325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 4.0 15 3.0 16 1.0 17 2.0 18 2.0 19 0.0 20 2.0 21 2.0 22 3.0 23 4.0 24 7.0 25 5.0 26 8.0 27 5.0 28 8.0 29 22.0 30 30.0 31 49.0 32 68.0 33 90.0 34 182.0 35 514.0 36 2702.0 37 282.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.25 25.424999999999997 8.425 23.9 2 28.425 26.474999999999998 28.675 16.425 3 20.65 27.500000000000004 32.625 19.225 4 23.549999999999997 34.675 23.35 18.425 5 24.675 36.55 21.175 17.599999999999998 6 20.45 40.300000000000004 20.875 18.375 7 20.599999999999998 23.625 36.0 19.775000000000002 8 21.125 26.400000000000002 28.325 24.15 9 21.5 25.15 30.3 23.05 10-14 23.36 28.955 26.56 21.125 15-19 23.51 28.675 26.87 20.945 20-24 22.985 29.195 26.85 20.97 25-29 22.770000000000003 28.655 27.134999999999998 21.44 30-34 22.75 27.810000000000002 27.544999999999998 21.895 35-39 22.89 28.04 27.994999999999997 21.075 40-44 23.43 27.74 27.224999999999998 21.605 45-49 22.82 27.99 27.845 21.345 50-54 23.380000000000003 27.815 27.215 21.59 55-59 22.99 27.839999999999996 27.139999999999997 22.03 60-64 23.365 27.82 27.575 21.240000000000002 65-69 23.52 27.325 27.79 21.365000000000002 70-74 23.11 27.839999999999996 27.48 21.57 75-79 23.515 27.725 26.724999999999998 22.035 80-84 23.325000000000003 28.035 26.810000000000002 21.83 85-89 23.915 27.595 26.810000000000002 21.68 90-94 24.08 27.51 27.37 21.04 95-99 23.555 26.884999999999998 27.705000000000002 21.855 100-104 24.255 26.889999999999997 27.11 21.745 105-109 23.18 28.050000000000004 27.26 21.51 110-114 23.255 28.065 27.3 21.38 115-119 23.89 28.205000000000002 27.189999999999998 20.715 120-124 23.575 27.88 27.584999999999997 20.96 125-129 24.445 27.235 27.065 21.255 130-134 24.13 27.644999999999996 27.26 20.965 135-139 23.835 27.655 27.715 20.794999999999998 140-144 24.265 27.625 27.105 21.005 145-149 24.185000000000002 27.625 27.169999999999998 21.02 150-151 23.95 28.3875 26.625 21.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 1.5 24 1.0 25 3.0 26 3.0 27 3.5 28 8.0 29 11.0 30 15.0 31 21.0 32 27.0 33 28.5 34 36.5 35 63.0 36 74.0 37 94.0 38 135.0 39 150.5 40 171.5 41 202.5 42 227.5 43 253.0 44 270.5 45 267.5 46 270.0 47 263.0 48 217.0 49 201.0 50 195.5 51 156.0 52 124.0 53 99.0 54 88.5 55 84.5 56 59.0 57 40.5 58 31.5 59 28.0 60 21.0 61 12.5 62 9.5 63 4.0 64 1.5 65 1.0 66 1.5 67 0.5 68 2.0 69 2.0 70 0.0 71 0.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.86228813559322 89.55 2 4.661016949152542 8.799999999999999 3 0.3442796610169491 0.975 4 0.1059322033898305 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026483050847457626 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCC 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.1375 0.0 0.0 0.0 0.0 130-131 1.2625 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 2.0250000000000004 0.0 0.0 0.0 0.0 138-139 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCAGT 10 0.006830828 145.0 7 AGGGCAG 10 0.006830828 145.0 6 AAGGGCA 10 0.006830828 145.0 5 CAAGGGC 10 0.006830828 145.0 4 GGCAGTA 10 0.006830828 145.0 8 >>END_MODULE Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754560 spots for SRR12161372.sra Written 754560 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra Read 754559 spots for SRR12161372.sra Written 754559 spots for SRR12161372.sra SRR ids: ['SRR12161372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_40p5hsmu SRR12161372.sra spots: 15091181 blocks: [[1, 754559], [754560, 1509118], [1509119, 2263677], [2263678, 3018236], [3018237, 3772795], [3772796, 4527354], [4527355, 5281913], [5281914, 6036472], [6036473, 6791031], [6791032, 7545590], [7545591, 8300149], [8300150, 9054708], [9054709, 9809267], [9809268, 10563826], [10563827, 11318385], [11318386, 12072944], [12072945, 12827503], [12827504, 13582062], [13582063, 14336621], [14336622, 15091181]] SRR12161372 file size 5106943 SRR12161372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161372 SRR12161372_1.fastq SRR12161372_2.fastq Input file: SRR12161372_1.fastq Paired file: SRR12161372_2.fastq trimmed: SRR12161372-trimmed-pair1.fastq, SRR12161372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:58:21 2025 >> started Thu Feb 13 19:58:38 2025 >> done (17.072s) 15091181 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 1532 ( 0.01%) empty read pairs filtered out after trimming by size control 15089634 (99.99%) read pairs available; of these: 460663 ( 3.05%) trimmed read pairs available after processing 14628971 (96.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 6 0.00% 22 10 0.00% 23 6 0.00% 24 7 0.00% 25 6 0.00% 26 10 0.00% 27 11 0.00% 28 11 0.00% 29 12 0.00% 30 8 0.00% 31 9 0.00% 32 16 0.00% 33 10 0.00% 34 11 0.00% 35 14 0.00% 36 18 0.00% 37 20 0.00% 38 13 0.00% 39 16 0.00% 40 6 0.00% 41 14 0.00% 42 25 0.00% 43 15 0.00% 44 24 0.00% 45 16 0.00% 46 15 0.00% 47 18 0.00% 48 15 0.00% 49 15 0.00% 50 21 0.00% 51 23 0.00% 52 20 0.00% 53 32 0.00% 54 21 0.00% 55 26 0.00% 56 31 0.00% 57 38 0.00% 58 39 0.00% 59 37 0.00% 60 53 0.00% 61 40 0.00% 62 47 0.00% 63 66 0.00% 64 66 0.00% 65 69 0.00% 66 77 0.00% 67 72 0.00% 68 90 0.00% 69 94 0.00% 70 90 0.00% 71 109 0.00% 72 134 0.00% 73 137 0.00% 74 182 0.00% 75 182 0.00% 76 159 0.00% 77 221 0.00% 78 244 0.00% 79 297 0.00% 80 317 0.00% 81 316 0.00% 82 384 0.00% 83 468 0.00% 84 466 0.00% 85 529 0.00% 86 616 0.00% 87 642 0.00% 88 706 0.00% 89 758 0.01% 90 832 0.01% 91 941 0.01% 92 1081 0.01% 93 1237 0.01% 94 1263 0.01% 95 1360 0.01% 96 1454 0.01% 97 1579 0.01% 98 1748 0.01% 99 1961 0.01% 100 2055 0.01% 101 2080 0.01% 102 2308 0.02% 103 2543 0.02% 104 2816 0.02% 105 2825 0.02% 106 2998 0.02% 107 3211 0.02% 108 3392 0.02% 109 3466 0.02% 110 3692 0.02% 111 3998 0.03% 112 4394 0.03% 113 4341 0.03% 114 4689 0.03% 115 5033 0.03% 116 5241 0.03% 117 5458 0.04% 118 5782 0.04% 119 5911 0.04% 120 6203 0.04% 121 6508 0.04% 122 6893 0.05% 123 7254 0.05% 124 7343 0.05% 125 7690 0.05% 126 8292 0.05% 127 8454 0.06% 128 8469 0.06% 129 8993 0.06% 130 9337 0.06% 131 9599 0.06% 132 10066 0.07% 133 10458 0.07% 134 10950 0.07% 135 11530 0.08% 136 11935 0.08% 137 11869 0.08% 138 12612 0.08% 139 13043 0.09% 140 13325 0.09% 141 13785 0.09% 142 14296 0.09% 143 14863 0.10% 144 15488 0.10% 145 16145 0.11% 146 16442 0.11% 147 16995 0.11% 148 17431 0.12% 149 17762 0.12% 150 18642 0.12% 151 14628971 96.95% 15089634 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=1.00 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=27.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.7 sequence=AAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=19 prefix-density=1.11 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=25.68 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12161372 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:59:20 Started mapping on | Feb 13 19:59:20 Finished on | Feb 13 20:01:04 Mapping speed, Million of reads per hour | 522.33 Number of input reads | 15089634 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14116824 Uniquely mapped reads % | 93.55% Average mapped length | 299.57 Number of splices: Total | 14680657 Number of splices: Annotated (sjdb) | 14407176 Number of splices: GT/AG | 14388648 Number of splices: GC/AG | 246455 Number of splices: AT/AC | 9117 Number of splices: Non-canonical | 36437 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360213 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 107810 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 612597 612597 612597 N_multimapping 360213 360213 360213 N_noFeature 424832 13935662 469290 N_ambiguous 236882 749 99887 UnstrandedReadsAssigned:13455110 PositiveStrandReadsAssigned:180413 NegativeStrandReadsAssigned:13547647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161372-trimmed-pair1.fastq SRR12161372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,089,634 reads, 13,570,163 reads pseudoaligned [quant] estimated average fragment length: 292.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR12161372.ke.tsv 34699 SRR12161372.se.tsv 87100 total ==> SRR12161372.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.81 363 12.586 Potri.005G024800.1.v4.1 1035 743.808 161 12.9595 Potri.004G059700.1.v4.1 961 670.036 67 5.98688 Potri.007G009000.2.v4.1 1416 1124.81 0 0 Potri.003G141000.2.v4.1 2943 2651.81 478.416 10.8016 Potri.016G087400.1.v4.1 270 63.1753 612 580 Potri.015G069301.1.v4.1 564 289.543 0 0 Potri.010G195200.1.v4.1 1773 1481.81 18 0.727285 Potri.012G127500.1.v4.1 977 685.915 142 12.3949 ==> SRR12161372.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 425 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 11 SRR12161372 completed mapping pipeline successfully