Starting /dee2/code/volunteer_pipeline.sh SRR12161373 current disk space = 3087352102912 free memory = 1443356428 SRR12161373 SRAfilesize 9a06e7d04ac9f9f8111808dfdf81006d SRR12161373.sra SRR12161373.sra file validated SRR12161373 is paired end SRR12161373 is conventional basespace SRR12161373 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54925 37.0 37.0 37.0 37.0 37.0 2 36.4525 37.0 37.0 37.0 37.0 37.0 3 36.5505 37.0 37.0 37.0 37.0 37.0 4 36.6115 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.624 37.0 37.0 37.0 37.0 37.0 7 36.4645 37.0 37.0 37.0 37.0 37.0 8 36.5605 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.5649 37.0 37.0 37.0 37.0 37.0 15-19 36.5515 37.0 37.0 37.0 37.0 37.0 20-24 36.533699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4981 37.0 37.0 37.0 37.0 37.0 30-34 36.4808 37.0 37.0 37.0 37.0 37.0 35-39 36.4447 37.0 37.0 37.0 37.0 37.0 40-44 36.410000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.402 37.0 37.0 37.0 37.0 37.0 50-54 36.3628 37.0 37.0 37.0 37.0 37.0 55-59 36.3905 37.0 37.0 37.0 37.0 37.0 60-64 36.3895 37.0 37.0 37.0 37.0 37.0 65-69 36.31999999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.34570000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.322500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3729 37.0 37.0 37.0 37.0 37.0 85-89 36.2676 37.0 37.0 37.0 37.0 37.0 90-94 36.246500000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2346 37.0 37.0 37.0 37.0 37.0 100-104 36.20589999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.15069999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.2226 37.0 37.0 37.0 37.0 37.0 115-119 36.1529 37.0 37.0 37.0 37.0 37.0 120-124 36.0998 37.0 37.0 37.0 37.0 37.0 125-129 36.1143 37.0 37.0 37.0 37.0 37.0 130-134 36.09340000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9945 37.0 37.0 37.0 37.0 37.0 140-144 35.9597 37.0 37.0 37.0 37.0 37.0 145-149 35.8914 37.0 37.0 37.0 37.0 37.0 150-151 35.8585 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 5.0 27 7.0 28 10.0 29 14.0 30 26.0 31 25.0 32 54.0 33 65.0 34 117.0 35 289.0 36 2975.0 37 408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.735183795948984 11.202800700175043 6.2015503875969 41.86046511627907 2 18.925 13.325000000000001 35.9 31.85 3 17.05 16.85 26.875 39.225 4 20.925 25.900000000000002 24.375 28.799999999999997 5 22.15 32.425 24.625 20.8 6 19.075 34.25 25.124999999999996 21.55 7 14.399999999999999 25.55 43.275000000000006 16.775000000000002 8 17.25 25.2 32.225 25.324999999999996 9 17.375 22.45 36.325 23.849999999999998 10-14 19.0 29.685 27.744999999999997 23.57 15-19 18.93 28.389999999999997 28.12 24.560000000000002 20-24 19.259999999999998 28.42 28.42 23.9 25-29 19.63 28.34 28.285 23.745 30-34 18.83 28.444999999999997 28.225 24.5 35-39 19.575 28.685 27.705000000000002 24.035 40-44 19.885 28.744999999999997 27.935 23.435 45-49 20.235 28.1 28.075 23.59 50-54 19.71 28.615000000000002 27.73 23.945 55-59 19.919999999999998 27.865000000000002 28.71 23.505000000000003 60-64 20.169999999999998 28.34 28.000000000000004 23.49 65-69 19.830000000000002 28.265 27.775 24.13 70-74 20.02 27.805000000000003 28.26 23.915 75-79 19.515 27.68 28.79 24.015 80-84 19.655 28.754999999999995 27.365000000000002 24.224999999999998 85-89 20.185 27.92 27.815 24.08 90-94 19.235 28.945 27.755000000000003 24.065 95-99 19.77 27.915 28.435 23.880000000000003 100-104 19.63 28.18 28.560000000000002 23.630000000000003 105-109 20.03 28.084999999999997 28.095 23.79 110-114 20.29 27.92 28.115000000000002 23.674999999999997 115-119 20.255000000000003 28.665000000000003 27.465 23.615 120-124 20.294999999999998 28.17 27.79 23.745 125-129 20.150000000000002 27.915 28.244999999999997 23.69 130-134 20.26 28.544999999999998 27.655 23.54 135-139 20.175 27.61 28.23 23.985 140-144 20.32 27.72 28.384999999999998 23.575 145-149 20.1 28.275 27.935 23.69 150-151 19.8125 28.299999999999997 27.4125 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 2.5 24 3.5 25 3.5 26 4.0 27 7.0 28 12.0 29 15.5 30 18.5 31 23.0 32 30.0 33 36.5 34 54.5 35 84.5 36 100.0 37 111.5 38 133.5 39 159.0 40 176.5 41 211.5 42 243.5 43 245.5 44 266.0 45 276.5 46 263.0 47 249.5 48 230.0 49 217.0 50 184.0 51 139.0 52 113.0 53 94.5 54 73.0 55 52.0 56 43.0 57 37.5 58 26.5 59 14.5 60 9.0 61 7.0 62 3.5 63 2.5 64 3.0 65 3.0 66 3.0 67 3.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4356120826709 89.1 2 5.219925808161102 9.85 3 0.29146793852676206 0.8250000000000001 4 0.026497085320614733 0.1 5 0.026497085320614733 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.1749999999999998 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161373 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.187 37.0 37.0 37.0 37.0 37.0 2 35.9375 37.0 37.0 37.0 37.0 37.0 3 35.9295 37.0 37.0 37.0 37.0 37.0 4 35.99 37.0 37.0 37.0 37.0 37.0 5 36.145 37.0 37.0 37.0 37.0 37.0 6 36.1605 37.0 37.0 37.0 37.0 37.0 7 36.0135 37.0 37.0 37.0 37.0 37.0 8 36.1865 37.0 37.0 37.0 37.0 37.0 9 36.1685 37.0 37.0 37.0 37.0 37.0 10-14 36.1726 37.0 37.0 37.0 37.0 37.0 15-19 36.1676 37.0 37.0 37.0 37.0 37.0 20-24 36.16850000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0814 37.0 37.0 37.0 37.0 37.0 30-34 36.0553 37.0 37.0 37.0 37.0 37.0 35-39 36.038 37.0 37.0 37.0 37.0 37.0 40-44 36.0378 37.0 37.0 37.0 37.0 37.0 45-49 35.9872 37.0 37.0 37.0 37.0 37.0 50-54 36.0433 37.0 37.0 37.0 37.0 37.0 55-59 35.947500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9392 37.0 37.0 37.0 37.0 37.0 65-69 35.898199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8346 37.0 37.0 37.0 37.0 37.0 75-79 35.7829 37.0 37.0 37.0 37.0 37.0 80-84 35.874300000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.7769 37.0 37.0 37.0 37.0 37.0 90-94 35.761900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.812599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.77760000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.6579 37.0 37.0 37.0 37.0 37.0 110-114 35.66160000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6304 37.0 37.0 37.0 37.0 37.0 120-124 35.6393 37.0 37.0 37.0 37.0 37.0 125-129 35.5371 37.0 37.0 37.0 37.0 37.0 130-134 35.4725 37.0 37.0 37.0 37.0 37.0 135-139 35.5167 37.0 37.0 37.0 37.0 37.0 140-144 35.468 37.0 37.0 37.0 37.0 37.0 145-149 35.50920000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.01275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 1.0 16 1.0 17 1.0 18 0.0 19 3.0 20 2.0 21 5.0 22 1.0 23 4.0 24 10.0 25 8.0 26 7.0 27 11.0 28 7.0 29 22.0 30 34.0 31 34.0 32 57.0 33 110.0 34 230.0 35 626.0 36 2612.0 37 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.525 21.75 10.6 26.125 2 28.599999999999998 25.224999999999998 31.1 15.075 3 19.6 28.775000000000002 32.35 19.275000000000002 4 23.125 34.25 23.65 18.975 5 23.65 38.824999999999996 20.225 17.299999999999997 6 18.825 43.4 21.175 16.6 7 19.6 22.075 38.5 19.825 8 21.275 25.650000000000002 27.825 25.25 9 21.775 25.1 30.325000000000003 22.8 10-14 23.035 29.549999999999997 26.625 20.79 15-19 22.650000000000002 28.15 28.07 21.13 20-24 22.785 28.53 28.189999999999998 20.495 25-29 22.79 28.32 28.215 20.674999999999997 30-34 22.66 28.74 28.060000000000002 20.54 35-39 22.865 29.075 27.725 20.335 40-44 22.84 28.849999999999998 28.27 20.04 45-49 22.375 28.994999999999997 27.73 20.9 50-54 22.650000000000002 28.455000000000002 28.139999999999997 20.755000000000003 55-59 23.189999999999998 28.395 27.905 20.51 60-64 23.115 28.525 27.650000000000002 20.71 65-69 23.595 27.76 28.165000000000003 20.48 70-74 23.415 28.59 27.415 20.580000000000002 75-79 23.605 27.925 27.465 21.005 80-84 23.080000000000002 27.925 28.410000000000004 20.585 85-89 23.49 28.410000000000004 27.21 20.89 90-94 24.15 27.71 27.67 20.47 95-99 22.985 27.889999999999997 28.18 20.945 100-104 23.525 28.499999999999996 27.215 20.76 105-109 24.169999999999998 28.389999999999997 27.634999999999998 19.805 110-114 23.76 27.855 27.725 20.66 115-119 23.275000000000002 28.325 28.04 20.36 120-124 23.93 28.925 27.485 19.66 125-129 23.794999999999998 28.01 27.365000000000002 20.830000000000002 130-134 23.9 28.384999999999998 27.950000000000003 19.765 135-139 24.385 28.155 27.439999999999998 20.02 140-144 23.990000000000002 28.325 27.195000000000004 20.49 145-149 24.224999999999998 27.93 27.785 20.06 150-151 24.087500000000002 28.4125 27.500000000000004 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 2.0 24 2.0 25 1.5 26 5.0 27 6.0 28 8.0 29 9.5 30 17.0 31 29.0 32 31.5 33 36.5 34 55.0 35 67.5 36 86.0 37 122.5 38 148.5 39 169.5 40 203.5 41 231.0 42 266.5 43 284.5 44 272.0 45 278.5 46 274.0 47 243.5 48 225.0 49 205.0 50 173.0 51 136.5 52 95.5 53 71.0 54 58.0 55 48.0 56 40.0 57 27.0 58 17.0 59 10.5 60 5.5 61 7.0 62 5.5 63 2.5 64 1.5 65 1.0 66 0.0 67 0.0 68 1.0 69 1.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.49175093134646 88.775 2 5.002660989888239 9.4 3 0.2660989888238425 0.75 4 0.13304949441192124 0.5 5 0.05321979776476849 0.25 6 0.026609898882384245 0.15 7 0.026609898882384245 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCACCAT 5 0.125 No Hit GCAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.1749999999999998 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTACTG 10 0.006830828 145.0 7 CGGGCCA 10 0.006830828 145.0 145 GGGTGTT 10 0.006830828 145.0 7 >>END_MODULE Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072218 spots for SRR12161373.sra Written 1072218 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra Read 1072214 spots for SRR12161373.sra Written 1072214 spots for SRR12161373.sra SRR ids: ['SRR12161373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6hwnmyhv SRR12161373.sra spots: 21444284 blocks: [[1, 1072214], [1072215, 2144428], [2144429, 3216642], [3216643, 4288856], [4288857, 5361070], [5361071, 6433284], [6433285, 7505498], [7505499, 8577712], [8577713, 9649926], [9649927, 10722140], [10722141, 11794354], [11794355, 12866568], [12866569, 13938782], [13938783, 15010996], [15010997, 16083210], [16083211, 17155424], [17155425, 18227638], [18227639, 19299852], [19299853, 20372066], [20372067, 21444284]] SRR12161373 file size 7266005 SRR12161373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161373 SRR12161373_1.fastq SRR12161373_2.fastq Input file: SRR12161373_1.fastq Paired file: SRR12161373_2.fastq trimmed: SRR12161373-trimmed-pair1.fastq, SRR12161373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:09:38 2025 >> started Thu Feb 13 19:10:03 2025 >> done (25.073s) 21444284 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 1555 ( 0.01%) empty read pairs filtered out after trimming by size control 21442700 (99.99%) read pairs available; of these: 701065 ( 3.27%) trimmed read pairs available after processing 20741635 (96.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 8 0.00% 28 9 0.00% 29 11 0.00% 30 6 0.00% 31 15 0.00% 32 14 0.00% 33 16 0.00% 34 10 0.00% 35 19 0.00% 36 9 0.00% 37 14 0.00% 38 14 0.00% 39 17 0.00% 40 19 0.00% 41 17 0.00% 42 14 0.00% 43 16 0.00% 44 21 0.00% 45 26 0.00% 46 19 0.00% 47 23 0.00% 48 23 0.00% 49 36 0.00% 50 25 0.00% 51 38 0.00% 52 44 0.00% 53 35 0.00% 54 36 0.00% 55 50 0.00% 56 51 0.00% 57 46 0.00% 58 71 0.00% 59 61 0.00% 60 74 0.00% 61 89 0.00% 62 98 0.00% 63 102 0.00% 64 101 0.00% 65 108 0.00% 66 132 0.00% 67 122 0.00% 68 153 0.00% 69 163 0.00% 70 170 0.00% 71 206 0.00% 72 232 0.00% 73 232 0.00% 74 284 0.00% 75 288 0.00% 76 335 0.00% 77 385 0.00% 78 423 0.00% 79 460 0.00% 80 538 0.00% 81 559 0.00% 82 615 0.00% 83 692 0.00% 84 796 0.00% 85 873 0.00% 86 985 0.00% 87 1046 0.00% 88 1167 0.01% 89 1312 0.01% 90 1395 0.01% 91 1556 0.01% 92 1591 0.01% 93 1873 0.01% 94 2068 0.01% 95 2259 0.01% 96 2426 0.01% 97 2615 0.01% 98 2730 0.01% 99 2991 0.01% 100 3321 0.02% 101 3461 0.02% 102 3799 0.02% 103 3910 0.02% 104 4378 0.02% 105 4647 0.02% 106 4809 0.02% 107 5055 0.02% 108 5401 0.03% 109 5580 0.03% 110 5928 0.03% 111 6306 0.03% 112 6606 0.03% 113 7035 0.03% 114 7394 0.03% 115 7794 0.04% 116 8151 0.04% 117 8439 0.04% 118 9065 0.04% 119 9175 0.04% 120 9766 0.05% 121 10176 0.05% 122 10341 0.05% 123 10915 0.05% 124 11618 0.05% 125 11831 0.06% 126 12888 0.06% 127 13152 0.06% 128 13166 0.06% 129 13846 0.06% 130 14336 0.07% 131 14670 0.07% 132 14971 0.07% 133 15859 0.07% 134 16304 0.08% 135 17131 0.08% 136 17660 0.08% 137 18184 0.08% 138 18688 0.09% 139 19659 0.09% 140 19421 0.09% 141 21009 0.10% 142 21461 0.10% 143 22013 0.10% 144 23245 0.11% 145 23643 0.11% 146 24377 0.11% 147 24682 0.12% 148 26410 0.12% 149 26438 0.12% 150 27835 0.13% 151 20741635 96.73% 21442700 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=5.09 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=3.6 sequence=CATCTTCTCATCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=112.64 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.7 sequence=ATTTCATCAAAAAAGGAACGTACGTACATGTGGATGATATACACCCCAGTTTATTTAAATTAGGAGGCCAT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=32 prefix-density=1.66 prefix-fanout=1.0 sequence=CTACACTGCTGACATCGTTGAGACTGAGAAGAGCCATGTCTACACTGGAGTCATGGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=617.84 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=23.9 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTC SRR12161373 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:10:44 Started mapping on | Feb 13 19:10:45 Finished on | Feb 13 19:12:53 Mapping speed, Million of reads per hour | 603.08 Number of input reads | 21442700 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20116802 Uniquely mapped reads % | 93.82% Average mapped length | 299.28 Number of splices: Total | 20687990 Number of splices: Annotated (sjdb) | 20101616 Number of splices: GT/AG | 20308230 Number of splices: GC/AG | 283348 Number of splices: AT/AC | 14998 Number of splices: Non-canonical | 81414 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522113 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 65141 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 803785 803785 803785 N_multimapping 522113 522113 522113 N_noFeature 802930 19781552 894847 N_ambiguous 357524 1307 113531 UnstrandedReadsAssigned:18956348 PositiveStrandReadsAssigned:333943 NegativeStrandReadsAssigned:19108424 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161373-trimmed-pair1.fastq SRR12161373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,442,700 reads, 18,933,744 reads pseudoaligned [quant] estimated average fragment length: 285.573 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR12161373.ke.tsv 34699 SRR12161373.se.tsv 87100 total ==> SRR12161373.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.43 1026 21.6843 Potri.005G024800.1.v4.1 1035 750.427 1843 89.9747 Potri.004G059700.1.v4.1 961 676.584 25 1.3537 Potri.007G009000.2.v4.1 1416 1131.43 0 0 Potri.003G141000.2.v4.1 2943 2658.43 1331 18.3424 Potri.016G087400.1.v4.1 270 62.4093 1113.54 653.675 Potri.015G069301.1.v4.1 564 291.445 0 0 Potri.010G195200.1.v4.1 1773 1488.43 283.923 6.98839 Potri.012G127500.1.v4.1 977 692.504 57 3.01548 ==> SRR12161373.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 140 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12161373 completed mapping pipeline successfully