Starting /dee2/code/volunteer_pipeline.sh SRR12161374 current disk space = 3087460896768 free memory = 1572274732 SRR12161374 SRAfilesize 48858c8773f97bd27748ebd32f4b92b6 SRR12161374.sra SRR12161374.sra file validated SRR12161374 is paired end SRR12161374 is conventional basespace SRR12161374 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.3705 37.0 37.0 37.0 37.0 37.0 3 36.528 37.0 37.0 37.0 37.0 37.0 4 36.518 37.0 37.0 37.0 37.0 37.0 5 36.5745 37.0 37.0 37.0 37.0 37.0 6 36.6 37.0 37.0 37.0 37.0 37.0 7 36.5425 37.0 37.0 37.0 37.0 37.0 8 36.633 37.0 37.0 37.0 37.0 37.0 9 36.5215 37.0 37.0 37.0 37.0 37.0 10-14 36.5812 37.0 37.0 37.0 37.0 37.0 15-19 36.5289 37.0 37.0 37.0 37.0 37.0 20-24 36.522800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4525 37.0 37.0 37.0 37.0 37.0 30-34 36.4683 37.0 37.0 37.0 37.0 37.0 35-39 36.3924 37.0 37.0 37.0 37.0 37.0 40-44 36.4091 37.0 37.0 37.0 37.0 37.0 45-49 36.3985 37.0 37.0 37.0 37.0 37.0 50-54 36.3703 37.0 37.0 37.0 37.0 37.0 55-59 36.396699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3688 37.0 37.0 37.0 37.0 37.0 65-69 36.3222 37.0 37.0 37.0 37.0 37.0 70-74 36.305099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2703 37.0 37.0 37.0 37.0 37.0 80-84 36.3371 37.0 37.0 37.0 37.0 37.0 85-89 36.3002 37.0 37.0 37.0 37.0 37.0 90-94 36.2472 37.0 37.0 37.0 37.0 37.0 95-99 36.2881 37.0 37.0 37.0 37.0 37.0 100-104 36.241600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1019 37.0 37.0 37.0 37.0 37.0 110-114 36.2168 37.0 37.0 37.0 37.0 37.0 115-119 36.1592 37.0 37.0 37.0 37.0 37.0 120-124 36.1714 37.0 37.0 37.0 37.0 37.0 125-129 36.1132 37.0 37.0 37.0 37.0 37.0 130-134 36.1221 37.0 37.0 37.0 37.0 37.0 135-139 36.0154 37.0 37.0 37.0 37.0 37.0 140-144 35.9369 37.0 37.0 37.0 37.0 37.0 145-149 35.974900000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.769 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 4.0 26 5.0 27 12.0 28 8.0 29 13.0 30 29.0 31 38.0 32 48.0 33 69.0 34 112.0 35 264.0 36 2941.0 37 456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.82091045522761 11.230615307653826 5.602801400700351 41.34567283641821 2 19.475 12.5 36.4 31.624999999999996 3 16.650000000000002 16.1 28.7 38.550000000000004 4 23.275000000000002 24.875 23.325000000000003 28.525 5 22.85 31.85 22.575 22.725 6 20.05 33.900000000000006 23.925 22.125 7 15.5 24.775 42.85 16.875 8 17.8 25.224999999999998 32.775 24.2 9 17.599999999999998 23.025000000000002 34.575 24.8 10-14 19.355 29.67 27.034999999999997 23.94 15-19 20.34 28.515 27.034999999999997 24.11 20-24 19.42 28.375 27.96 24.245 25-29 20.349999999999998 28.845 27.63 23.175 30-34 19.744999999999997 28.410000000000004 26.919999999999998 24.925 35-39 20.765 28.07 27.189999999999998 23.974999999999998 40-44 20.155 28.035 27.83 23.98 45-49 20.48 28.48 27.27 23.77 50-54 20.200000000000003 28.57 27.655 23.575 55-59 20.69 27.855 27.655 23.799999999999997 60-64 20.84 28.24 27.0 23.919999999999998 65-69 21.2 28.105000000000004 27.055 23.64 70-74 20.4 28.405 27.355 23.84 75-79 20.655 28.065 27.189999999999998 24.09 80-84 20.3 28.27 28.134999999999998 23.294999999999998 85-89 20.53 28.38 27.345000000000002 23.745 90-94 20.830000000000002 27.894999999999996 27.339999999999996 23.935000000000002 95-99 21.085 27.839999999999996 27.785 23.29 100-104 21.19 27.584999999999997 27.815 23.41 105-109 21.154999999999998 27.455000000000002 28.02 23.369999999999997 110-114 21.025 28.025 27.975 22.975 115-119 21.165 28.565 27.35 22.919999999999998 120-124 20.735 27.894999999999996 27.36 24.01 125-129 21.185000000000002 28.29 26.96 23.565 130-134 20.855 28.42 27.0 23.724999999999998 135-139 21.545 28.444999999999997 27.08 22.93 140-144 21.69 28.03 26.900000000000002 23.380000000000003 145-149 21.37 28.904999999999998 26.56 23.165 150-151 21.7375 27.9125 26.0625 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 2.0 24 2.5 25 2.0 26 4.5 27 7.0 28 7.0 29 10.0 30 16.5 31 23.5 32 34.0 33 35.0 34 42.0 35 68.5 36 82.0 37 101.0 38 119.0 39 142.0 40 172.0 41 179.5 42 206.0 43 234.5 44 256.0 45 269.5 46 268.0 47 266.5 48 246.5 49 232.0 50 208.0 51 169.5 52 137.0 53 103.0 54 75.0 55 63.5 56 53.5 57 40.0 58 33.5 59 23.5 60 18.5 61 17.0 62 9.0 63 3.0 64 2.5 65 1.5 66 1.5 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.63246959280804 89.47500000000001 2 5.050237969328398 9.55 3 0.26441036488630354 0.75 4 0.026441036488630353 0.1 5 0.026441036488630353 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.8250000000000002 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.025 0.0 128-129 2.7375 0.0 0.0 0.025 0.0 130-131 3.0625 0.0 0.0 0.025 0.0 132-133 3.4 0.0 0.0 0.025 0.0 134-135 3.6875 0.0 0.0 0.025 0.0 136-137 3.9749999999999996 0.0 0.0 0.025 0.0 138-139 4.3625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161374 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2135 37.0 37.0 37.0 37.0 37.0 2 35.967 37.0 37.0 37.0 37.0 37.0 3 36.128 37.0 37.0 37.0 37.0 37.0 4 36.0185 37.0 37.0 37.0 37.0 37.0 5 36.1875 37.0 37.0 37.0 37.0 37.0 6 36.1365 37.0 37.0 37.0 37.0 37.0 7 36.182 37.0 37.0 37.0 37.0 37.0 8 36.119 37.0 37.0 37.0 37.0 37.0 9 36.146 37.0 37.0 37.0 37.0 37.0 10-14 36.1919 37.0 37.0 37.0 37.0 37.0 15-19 36.1894 37.0 37.0 37.0 37.0 37.0 20-24 36.14920000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.09930000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.0597 37.0 37.0 37.0 37.0 37.0 35-39 36.0708 37.0 37.0 37.0 37.0 37.0 40-44 36.0549 37.0 37.0 37.0 37.0 37.0 45-49 35.9994 37.0 37.0 37.0 37.0 37.0 50-54 35.997699999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.9652 37.0 37.0 37.0 37.0 37.0 60-64 35.9019 37.0 37.0 37.0 37.0 37.0 65-69 35.8948 37.0 37.0 37.0 37.0 37.0 70-74 35.816599999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.8639 37.0 37.0 37.0 37.0 37.0 80-84 35.9078 37.0 37.0 37.0 37.0 37.0 85-89 35.868199999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.748599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.784800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.822300000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.7536 37.0 37.0 37.0 37.0 37.0 110-114 35.695299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6733 37.0 37.0 37.0 37.0 37.0 120-124 35.691700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.5622 37.0 37.0 37.0 37.0 37.0 130-134 35.514799999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5221 37.0 37.0 37.0 37.0 37.0 140-144 35.360400000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.4072 37.0 37.0 37.0 37.0 37.0 150-151 34.713750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 2.0 16 3.0 17 0.0 18 1.0 19 2.0 20 2.0 21 0.0 22 3.0 23 0.0 24 5.0 25 6.0 26 14.0 27 9.0 28 13.0 29 22.0 30 39.0 31 44.0 32 67.0 33 106.0 34 206.0 35 563.0 36 2687.0 37 199.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.550000000000004 23.549999999999997 8.825 28.075 2 25.8 26.900000000000002 31.974999999999998 15.325 3 19.15 27.3 31.65 21.9 4 22.275 35.275 23.925 18.525 5 25.074999999999996 36.95 21.65 16.325 6 20.349999999999998 39.25 21.65 18.75 7 19.950000000000003 22.2 38.25 19.6 8 20.025000000000002 26.724999999999998 28.225 25.025 9 22.225 24.375 29.849999999999998 23.549999999999997 10-14 22.625 29.39 26.52 21.465 15-19 22.82 28.345 27.08 21.755 20-24 22.705000000000002 28.585 27.01 21.7 25-29 22.665 28.694999999999997 27.46 21.18 30-34 23.52 28.325 27.415 20.74 35-39 22.79 28.22 27.12 21.87 40-44 22.585 27.889999999999997 27.77 21.755 45-49 22.37 27.905 27.63 22.095000000000002 50-54 22.71 27.61 27.515 22.165000000000003 55-59 22.715 27.384999999999998 27.750000000000004 22.15 60-64 22.32 27.105 28.084999999999997 22.49 65-69 23.14 27.755000000000003 27.894999999999996 21.21 70-74 23.36 28.455000000000002 26.44 21.745 75-79 23.35 27.694999999999997 27.24 21.715 80-84 22.84 27.544999999999998 27.584999999999997 22.03 85-89 23.335 26.950000000000003 27.900000000000002 21.815 90-94 22.96 28.26 27.12 21.66 95-99 22.6 27.91 27.77 21.72 100-104 22.935 27.560000000000002 27.26 22.245 105-109 23.385 27.900000000000002 27.224999999999998 21.490000000000002 110-114 23.79 27.255000000000003 28.005000000000003 20.95 115-119 23.73 27.855 27.01 21.404999999999998 120-124 23.845 28.134999999999998 26.6 21.42 125-129 24.015 28.249999999999996 26.474999999999998 21.26 130-134 23.705000000000002 27.800000000000004 27.505000000000003 20.990000000000002 135-139 24.66 27.625 27.125 20.59 140-144 24.6 27.71 27.165 20.525 145-149 24.765 27.395000000000003 27.060000000000002 20.78 150-151 25.324999999999996 27.537499999999998 26.5875 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 3.5 25 4.5 26 7.0 27 6.5 28 5.0 29 11.0 30 18.0 31 23.0 32 25.5 33 36.0 34 50.0 35 58.0 36 70.0 37 97.0 38 125.5 39 155.0 40 184.5 41 210.0 42 236.5 43 269.5 44 275.0 45 256.0 46 277.0 47 256.0 48 205.5 49 203.0 50 189.5 51 148.0 52 115.0 53 93.5 54 72.5 55 64.5 56 61.0 57 49.0 58 30.5 59 25.0 60 21.5 61 11.0 62 9.5 63 9.0 64 5.5 65 2.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 1.0 78 1.0 79 1.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40021231422506 88.925 2 5.2282377919320595 9.85 3 0.23885350318471338 0.675 4 0.07961783439490447 0.3 5 0.05307855626326964 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.1624999999999996 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.7875 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.4625000000000004 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAACA 10 0.006830828 145.0 4 CACAAAC 10 0.006830828 145.0 9 CAACACA 10 0.006830828 145.0 6 TGTTAGT 10 0.006830828 145.0 7 GTTAGTA 10 0.006830828 145.0 8 AGGTTTC 10 0.006830828 145.0 145 GCACACA 10 0.006830828 145.0 1 GGTGTTA 10 0.006830828 145.0 5 >>END_MODULE Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767204 spots for SRR12161374.sra Written 767204 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra Read 767195 spots for SRR12161374.sra Written 767195 spots for SRR12161374.sra SRR ids: ['SRR12161374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ady1bi0i SRR12161374.sra spots: 15343909 blocks: [[1, 767195], [767196, 1534390], [1534391, 2301585], [2301586, 3068780], [3068781, 3835975], [3835976, 4603170], [4603171, 5370365], [5370366, 6137560], [6137561, 6904755], [6904756, 7671950], [7671951, 8439145], [8439146, 9206340], [9206341, 9973535], [9973536, 10740730], [10740731, 11507925], [11507926, 12275120], [12275121, 13042315], [13042316, 13809510], [13809511, 14576705], [14576706, 15343909]] SRR12161374 file size 5192831 SRR12161374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161374 SRR12161374_1.fastq SRR12161374_2.fastq Input file: SRR12161374_1.fastq Paired file: SRR12161374_2.fastq trimmed: SRR12161374-trimmed-pair1.fastq, SRR12161374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:56:09 2025 >> started Thu Feb 13 19:56:26 2025 >> done (17.449s) 15343909 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 1460 ( 0.01%) empty read pairs filtered out after trimming by size control 15342421 (99.99%) read pairs available; of these: 1111597 ( 7.25%) trimmed read pairs available after processing 14230824 (92.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 1 0.00% 23 2 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 16 0.00% 28 2 0.00% 29 7 0.00% 30 6 0.00% 31 10 0.00% 32 9 0.00% 33 10 0.00% 34 19 0.00% 35 13 0.00% 36 6 0.00% 37 15 0.00% 38 11 0.00% 39 12 0.00% 40 13 0.00% 41 7 0.00% 42 11 0.00% 43 13 0.00% 44 7 0.00% 45 21 0.00% 46 22 0.00% 47 22 0.00% 48 16 0.00% 49 29 0.00% 50 27 0.00% 51 30 0.00% 52 31 0.00% 53 33 0.00% 54 27 0.00% 55 23 0.00% 56 29 0.00% 57 46 0.00% 58 62 0.00% 59 56 0.00% 60 63 0.00% 61 84 0.00% 62 91 0.00% 63 90 0.00% 64 120 0.00% 65 112 0.00% 66 125 0.00% 67 174 0.00% 68 155 0.00% 69 177 0.00% 70 212 0.00% 71 253 0.00% 72 284 0.00% 73 301 0.00% 74 352 0.00% 75 397 0.00% 76 437 0.00% 77 534 0.00% 78 676 0.00% 79 709 0.00% 80 696 0.00% 81 834 0.01% 82 938 0.01% 83 1029 0.01% 84 1179 0.01% 85 1371 0.01% 86 1534 0.01% 87 1608 0.01% 88 1882 0.01% 89 2033 0.01% 90 2290 0.01% 91 2583 0.02% 92 2831 0.02% 93 3038 0.02% 94 3308 0.02% 95 3781 0.02% 96 4079 0.03% 97 4401 0.03% 98 4836 0.03% 99 5076 0.03% 100 5632 0.04% 101 6006 0.04% 102 6511 0.04% 103 7123 0.05% 104 7607 0.05% 105 7921 0.05% 106 8444 0.06% 107 8857 0.06% 108 9575 0.06% 109 9904 0.06% 110 10232 0.07% 111 11363 0.07% 112 11829 0.08% 113 12185 0.08% 114 13106 0.09% 115 13522 0.09% 116 14306 0.09% 117 14836 0.10% 118 15522 0.10% 119 16016 0.10% 120 16700 0.11% 121 17488 0.11% 122 18348 0.12% 123 18556 0.12% 124 19333 0.13% 125 20110 0.13% 126 21102 0.14% 127 21876 0.14% 128 22231 0.14% 129 22843 0.15% 130 23815 0.16% 131 24100 0.16% 132 25163 0.16% 133 25970 0.17% 134 26740 0.17% 135 27189 0.18% 136 27943 0.18% 137 28864 0.19% 138 29545 0.19% 139 30311 0.20% 140 30547 0.20% 141 31265 0.20% 142 31980 0.21% 143 32947 0.21% 144 33630 0.22% 145 34537 0.23% 146 35182 0.23% 147 35578 0.23% 148 37095 0.24% 149 36945 0.24% 150 37799 0.25% 151 14230824 92.75% 15342421 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.92 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.34 sequence-density-rank=15 fanout-score=6.30 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=4.4 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGAGGAGAGGGCCATTGTTGCTGCTGCCATTG criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=13 prefix-density=1.48 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=57.58 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12161374 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:57:09 Started mapping on | Feb 13 19:57:09 Finished on | Feb 13 19:58:39 Mapping speed, Million of reads per hour | 613.70 Number of input reads | 15342421 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14503258 Uniquely mapped reads % | 94.53% Average mapped length | 297.76 Number of splices: Total | 14401611 Number of splices: Annotated (sjdb) | 14128933 Number of splices: GT/AG | 14119887 Number of splices: GC/AG | 236910 Number of splices: AT/AC | 9581 Number of splices: Non-canonical | 35233 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356340 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 86014 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 482823 482823 482823 N_multimapping 356340 356340 356340 N_noFeature 450451 14356149 497869 N_ambiguous 192261 825 92073 UnstrandedReadsAssigned:13860546 PositiveStrandReadsAssigned:146284 NegativeStrandReadsAssigned:13913316 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161374-trimmed-pair1.fastq SRR12161374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,342,421 reads, 13,970,444 reads pseudoaligned [quant] estimated average fragment length: 269.99 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR12161374.ke.tsv 34699 SRR12161374.se.tsv 87100 total ==> SRR12161374.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.01 326 12.075 Potri.005G024800.1.v4.1 1035 766.01 99 8.37268 Potri.004G059700.1.v4.1 961 692.186 49 4.58603 Potri.007G009000.2.v4.1 1416 1147.01 0 0 Potri.003G141000.2.v4.1 2943 2674.01 432.275 10.4727 Potri.016G087400.1.v4.1 270 76.6036 855.626 723.599 Potri.015G069301.1.v4.1 564 309.556 0 0 Potri.010G195200.1.v4.1 1773 1504.01 9 0.387664 Potri.012G127500.1.v4.1 977 708.13 874 79.958 ==> SRR12161374.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12161374 completed mapping pipeline successfully