Starting /dee2/code/volunteer_pipeline.sh SRR12161375 current disk space = 3087363481600 free memory = 1450056324 SRR12161375 SRAfilesize 8a27ba868ad0e841072ad628f575a02e SRR12161375.sra SRR12161375.sra file validated SRR12161375 is paired end SRR12161375 is conventional basespace SRR12161375 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5055 37.0 37.0 37.0 37.0 37.0 2 36.3505 37.0 37.0 37.0 37.0 37.0 3 36.484 37.0 37.0 37.0 37.0 37.0 4 36.5665 37.0 37.0 37.0 37.0 37.0 5 36.549 37.0 37.0 37.0 37.0 37.0 6 36.561 37.0 37.0 37.0 37.0 37.0 7 36.4395 37.0 37.0 37.0 37.0 37.0 8 36.584 37.0 37.0 37.0 37.0 37.0 9 36.5415 37.0 37.0 37.0 37.0 37.0 10-14 36.60039999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5026 37.0 37.0 37.0 37.0 37.0 20-24 36.519 37.0 37.0 37.0 37.0 37.0 25-29 36.459500000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.443 37.0 37.0 37.0 37.0 37.0 35-39 36.395 37.0 37.0 37.0 37.0 37.0 40-44 36.387699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3729 37.0 37.0 37.0 37.0 37.0 50-54 36.3012 37.0 37.0 37.0 37.0 37.0 55-59 36.3416 37.0 37.0 37.0 37.0 37.0 60-64 36.351 37.0 37.0 37.0 37.0 37.0 65-69 36.2742 37.0 37.0 37.0 37.0 37.0 70-74 36.31570000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2559 37.0 37.0 37.0 37.0 37.0 80-84 36.31060000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1923 37.0 37.0 37.0 37.0 37.0 90-94 36.2637 37.0 37.0 37.0 37.0 37.0 95-99 36.19350000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1842 37.0 37.0 37.0 37.0 37.0 105-109 36.1554 37.0 37.0 37.0 37.0 37.0 110-114 36.153099999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1203 37.0 37.0 37.0 37.0 37.0 120-124 36.083800000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0553 37.0 37.0 37.0 37.0 37.0 130-134 36.061600000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.9688 37.0 37.0 37.0 37.0 37.0 140-144 35.8812 37.0 37.0 37.0 37.0 37.0 145-149 35.875600000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.7095 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 1.0 25 1.0 26 2.0 27 8.0 28 8.0 29 24.0 30 31.0 31 48.0 32 39.0 33 77.0 34 118.0 35 283.0 36 2963.0 37 394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.647823911955975 12.331165582791396 5.152576288144072 36.86843421710855 2 20.549999999999997 12.2 35.475 31.775 3 16.175 15.049999999999999 28.325 40.45 4 19.725 25.3 24.875 30.099999999999998 5 22.475 31.8 24.325 21.4 6 21.675 33.225 22.925 22.175 7 16.150000000000002 26.1 41.225 16.525000000000002 8 16.900000000000002 25.75 32.05 25.3 9 16.400000000000002 23.5 36.7 23.400000000000002 10-14 19.905 29.7 27.339999999999996 23.055 15-19 19.105 28.095 28.110000000000003 24.69 20-24 20.005 27.884999999999998 27.82 24.29 25-29 19.825 27.98 27.944999999999997 24.25 30-34 19.950000000000003 28.194999999999997 27.765 24.09 35-39 20.075000000000003 28.375 27.37 24.18 40-44 20.24 28.610000000000003 27.365000000000002 23.785 45-49 20.73 28.09 27.185 23.995 50-54 20.595 28.000000000000004 27.955000000000002 23.45 55-59 20.169999999999998 28.499999999999996 27.02 24.310000000000002 60-64 20.105 28.549999999999997 27.115000000000002 24.23 65-69 20.345 27.26 28.075 24.32 70-74 20.96 28.125 26.69 24.224999999999998 75-79 20.215 27.93 27.85 24.005000000000003 80-84 20.055 28.395 27.250000000000004 24.3 85-89 20.61 28.49 26.979999999999997 23.919999999999998 90-94 20.549999999999997 27.74 27.455000000000002 24.255 95-99 20.77 27.839999999999996 27.495000000000005 23.895 100-104 20.54 27.68 27.534999999999997 24.245 105-109 20.415 28.325 27.389999999999997 23.87 110-114 20.775 27.85 27.445000000000004 23.93 115-119 20.855 28.49 27.405 23.25 120-124 21.32 28.139999999999997 27.025 23.515 125-129 21.065 27.575 27.715 23.645 130-134 21.245 27.82 27.46 23.474999999999998 135-139 21.13 27.42 27.26 24.19 140-144 20.61 28.165000000000003 27.04 24.185000000000002 145-149 21.04 28.194999999999997 26.88 23.885 150-151 20.424999999999997 28.425 27.025 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 2.0 25 3.0 26 6.5 27 10.0 28 12.5 29 16.5 30 21.0 31 25.0 32 32.0 33 43.5 34 53.0 35 63.5 36 82.0 37 99.0 38 115.5 39 136.0 40 164.0 41 192.0 42 200.5 43 233.0 44 244.0 45 232.0 46 255.0 47 255.5 48 248.5 49 242.0 50 206.5 51 169.5 52 146.5 53 119.5 54 80.5 55 69.5 56 65.0 57 46.0 58 34.5 59 21.5 60 14.5 61 10.5 62 7.5 63 6.0 64 3.5 65 1.0 66 1.5 67 1.0 68 0.5 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.92868462757528 89.85 2 4.543053354463814 8.6 3 0.5018489170628632 1.425 4 0.0 0.0 5 0.02641310089804543 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTCAA 10 0.006830828 145.0 4 >>END_MODULE SRR12161375 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2945 37.0 37.0 37.0 37.0 37.0 2 35.917 37.0 37.0 37.0 37.0 37.0 3 35.9785 37.0 37.0 37.0 37.0 37.0 4 36.044 37.0 37.0 37.0 37.0 37.0 5 36.1075 37.0 37.0 37.0 37.0 37.0 6 36.0895 37.0 37.0 37.0 37.0 37.0 7 36.0375 37.0 37.0 37.0 37.0 37.0 8 36.1565 37.0 37.0 37.0 37.0 37.0 9 36.19 37.0 37.0 37.0 37.0 37.0 10-14 36.181799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1891 37.0 37.0 37.0 37.0 37.0 20-24 36.1789 37.0 37.0 37.0 37.0 37.0 25-29 36.1518 37.0 37.0 37.0 37.0 37.0 30-34 36.113099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1202 37.0 37.0 37.0 37.0 37.0 40-44 36.0386 37.0 37.0 37.0 37.0 37.0 45-49 36.000600000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.03510000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.993900000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9274 37.0 37.0 37.0 37.0 37.0 65-69 35.92659999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.8411 37.0 37.0 37.0 37.0 37.0 75-79 35.837599999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9359 37.0 37.0 37.0 37.0 37.0 85-89 35.8233 37.0 37.0 37.0 37.0 37.0 90-94 35.81060000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7945 37.0 37.0 37.0 37.0 37.0 100-104 35.744600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7152 37.0 37.0 37.0 37.0 37.0 110-114 35.6356 37.0 37.0 37.0 37.0 37.0 115-119 35.671499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.655 37.0 37.0 37.0 37.0 37.0 125-129 35.5139 37.0 37.0 37.0 37.0 37.0 130-134 35.4535 37.0 37.0 37.0 37.0 37.0 135-139 35.578 37.0 37.0 37.0 37.0 37.0 140-144 35.5149 37.0 37.0 37.0 37.0 37.0 145-149 35.5304 37.0 37.0 37.0 37.0 37.0 150-151 34.980000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 5.0 23 1.0 24 4.0 25 14.0 26 7.0 27 17.0 28 20.0 29 23.0 30 27.0 31 36.0 32 64.0 33 104.0 34 228.0 35 589.0 36 2635.0 37 217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.75 25.55 8.4 24.3 2 26.1 26.700000000000003 30.85 16.35 3 20.549999999999997 27.125 32.775 19.55 4 23.549999999999997 33.1 25.0 18.35 5 24.55 37.375 21.325 16.75 6 21.175 38.85 22.425 17.549999999999997 7 19.400000000000002 22.825 37.5 20.275000000000002 8 20.974999999999998 27.250000000000004 28.349999999999998 23.425 9 22.775000000000002 24.3 28.7 24.224999999999998 10-14 23.11 30.055 26.040000000000003 20.794999999999998 15-19 22.875 28.74 27.37 21.015 20-24 22.445 28.804999999999996 27.175 21.575 25-29 22.45 28.96 27.205000000000002 21.385 30-34 22.065 28.439999999999998 27.74 21.755 35-39 22.325 27.605 28.01 22.06 40-44 22.255 28.175 27.689999999999998 21.88 45-49 22.17 27.365000000000002 28.415000000000003 22.05 50-54 22.825 27.529999999999998 27.894999999999996 21.75 55-59 23.1 27.195000000000004 27.55 22.155 60-64 22.814999999999998 27.389999999999997 27.650000000000002 22.145 65-69 23.195 27.305 27.639999999999997 21.86 70-74 22.74 27.295 28.04 21.925 75-79 23.275000000000002 27.034999999999997 27.455000000000002 22.235 80-84 22.884999999999998 27.800000000000004 27.245 22.07 85-89 23.02 27.96 27.060000000000002 21.959999999999997 90-94 22.795 27.565 27.37 22.27 95-99 22.805 27.73 27.52 21.945 100-104 23.645 27.815 26.900000000000002 21.64 105-109 23.544999999999998 28.005000000000003 27.105 21.345 110-114 23.265 28.060000000000002 27.665 21.01 115-119 23.74 27.894999999999996 26.795 21.57 120-124 23.44 28.18 27.355 21.025 125-129 23.79 27.115000000000002 27.189999999999998 21.905 130-134 23.425 28.285 26.865 21.425 135-139 24.125 28.025 26.93 20.919999999999998 140-144 23.565 27.775 27.955000000000002 20.705000000000002 145-149 24.04 27.279999999999998 26.979999999999997 21.7 150-151 24.875 28.1125 26.0375 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 2.0 13 2.0 14 0.5 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 2.5 26 7.0 27 9.0 28 7.5 29 12.5 30 16.5 31 17.0 32 28.5 33 41.0 34 47.0 35 62.5 36 90.0 37 111.0 38 127.0 39 157.0 40 180.5 41 199.5 42 234.5 43 247.0 44 253.0 45 256.5 46 250.0 47 254.0 48 229.0 49 195.5 50 177.0 51 151.5 52 131.5 53 115.0 54 93.0 55 70.5 56 51.0 57 39.0 58 31.5 59 29.0 60 19.5 61 10.5 62 11.0 63 7.5 64 2.5 65 1.5 66 2.0 67 2.0 68 2.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10840824960339 89.925 2 4.283447911158118 8.1 3 0.4494976203067161 1.275 4 0.07932310946589106 0.3 5 0.052882072977260705 0.25 6 0.026441036488630353 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.36250000000000004 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAAT 10 0.006830828 145.0 1 TTGTTGA 20 0.00593511 29.0 75-79 >>END_MODULE Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782315 spots for SRR12161375.sra Written 782315 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra Read 782296 spots for SRR12161375.sra Written 782296 spots for SRR12161375.sra SRR ids: ['SRR12161375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s287b9sh SRR12161375.sra spots: 15645939 blocks: [[1, 782296], [782297, 1564592], [1564593, 2346888], [2346889, 3129184], [3129185, 3911480], [3911481, 4693776], [4693777, 5476072], [5476073, 6258368], [6258369, 7040664], [7040665, 7822960], [7822961, 8605256], [8605257, 9387552], [9387553, 10169848], [10169849, 10952144], [10952145, 11734440], [11734441, 12516736], [12516737, 13299032], [13299033, 14081328], [14081329, 14863624], [14863625, 15645939]] SRR12161375 file size 5295474 SRR12161375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161375 SRR12161375_1.fastq SRR12161375_2.fastq Input file: SRR12161375_1.fastq Paired file: SRR12161375_2.fastq trimmed: SRR12161375-trimmed-pair1.fastq, SRR12161375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:07:20 2025 >> started Thu Feb 13 19:07:38 2025 >> done (17.827s) 15645939 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1329 ( 0.01%) empty read pairs filtered out after trimming by size control 15644591 (99.99%) read pairs available; of these: 387626 ( 2.48%) trimmed read pairs available after processing 15256965 (97.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 9 0.00% 25 3 0.00% 26 7 0.00% 27 16 0.00% 28 10 0.00% 29 7 0.00% 30 9 0.00% 31 12 0.00% 32 7 0.00% 33 5 0.00% 34 14 0.00% 35 11 0.00% 36 14 0.00% 37 15 0.00% 38 22 0.00% 39 11 0.00% 40 11 0.00% 41 14 0.00% 42 12 0.00% 43 5 0.00% 44 18 0.00% 45 18 0.00% 46 20 0.00% 47 20 0.00% 48 13 0.00% 49 15 0.00% 50 22 0.00% 51 16 0.00% 52 12 0.00% 53 25 0.00% 54 17 0.00% 55 19 0.00% 56 25 0.00% 57 27 0.00% 58 27 0.00% 59 34 0.00% 60 41 0.00% 61 48 0.00% 62 53 0.00% 63 44 0.00% 64 62 0.00% 65 45 0.00% 66 53 0.00% 67 58 0.00% 68 76 0.00% 69 79 0.00% 70 86 0.00% 71 92 0.00% 72 107 0.00% 73 109 0.00% 74 148 0.00% 75 152 0.00% 76 167 0.00% 77 184 0.00% 78 209 0.00% 79 224 0.00% 80 263 0.00% 81 291 0.00% 82 332 0.00% 83 372 0.00% 84 399 0.00% 85 473 0.00% 86 454 0.00% 87 586 0.00% 88 593 0.00% 89 648 0.00% 90 690 0.00% 91 768 0.00% 92 847 0.01% 93 944 0.01% 94 1054 0.01% 95 1099 0.01% 96 1197 0.01% 97 1341 0.01% 98 1402 0.01% 99 1554 0.01% 100 1686 0.01% 101 1655 0.01% 102 1950 0.01% 103 2098 0.01% 104 2245 0.01% 105 2277 0.01% 106 2391 0.02% 107 2636 0.02% 108 2756 0.02% 109 2998 0.02% 110 3032 0.02% 111 3306 0.02% 112 3505 0.02% 113 3662 0.02% 114 3940 0.03% 115 4171 0.03% 116 4235 0.03% 117 4578 0.03% 118 4672 0.03% 119 4888 0.03% 120 5187 0.03% 121 5355 0.03% 122 5604 0.04% 123 5921 0.04% 124 6049 0.04% 125 6396 0.04% 126 6919 0.04% 127 6971 0.04% 128 7479 0.05% 129 7630 0.05% 130 7914 0.05% 131 8079 0.05% 132 8590 0.05% 133 9061 0.06% 134 9102 0.06% 135 9816 0.06% 136 10042 0.06% 137 10237 0.07% 138 10585 0.07% 139 11133 0.07% 140 11156 0.07% 141 11670 0.07% 142 12134 0.08% 143 12477 0.08% 144 13205 0.08% 145 13691 0.09% 146 13984 0.09% 147 14541 0.09% 148 14745 0.09% 149 15177 0.10% 150 16189 0.10% 151 15256965 97.52% 15644591 reads passed initial QC criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=16 prefix-density=1.06 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=12.94 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=ACGAAGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATTAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTGCT criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=1.29 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=50.84 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161375 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:08:23 Started mapping on | Feb 13 19:08:23 Finished on | Feb 13 19:10:40 Mapping speed, Million of reads per hour | 411.10 Number of input reads | 15644591 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 14450808 Uniquely mapped reads % | 92.37% Average mapped length | 299.90 Number of splices: Total | 14786992 Number of splices: Annotated (sjdb) | 14517154 Number of splices: GT/AG | 14499291 Number of splices: GC/AG | 246872 Number of splices: AT/AC | 10202 Number of splices: Non-canonical | 30627 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381908 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 136840 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 811875 811875 811875 N_multimapping 381908 381908 381908 N_noFeature 419516 14292378 457225 N_ambiguous 212006 682 90933 UnstrandedReadsAssigned:13819286 PositiveStrandReadsAssigned:157748 NegativeStrandReadsAssigned:13902650 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161375-trimmed-pair1.fastq SRR12161375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,644,591 reads, 13,986,678 reads pseudoaligned [quant] estimated average fragment length: 304.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR12161375.ke.tsv 34699 SRR12161375.se.tsv 87100 total ==> SRR12161375.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.77 373 12.8381 Potri.005G024800.1.v4.1 1035 731.771 68 5.48443 Potri.004G059700.1.v4.1 961 657.997 83 7.44478 Potri.007G009000.2.v4.1 1416 1112.77 0 0 Potri.003G141000.2.v4.1 2943 2639.77 496 11.0895 Potri.016G087400.1.v4.1 270 61.18 742 715.8 Potri.015G069301.1.v4.1 564 280.403 0 0 Potri.010G195200.1.v4.1 1773 1469.77 7 0.28109 Potri.012G127500.1.v4.1 977 673.885 1024 89.6833 ==> SRR12161375.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 19 SRR12161375 completed mapping pipeline successfully