Starting /dee2/code/volunteer_pipeline.sh SRR12161376 current disk space = 3088760406016 free memory = 1582479832 SRR12161376 SRAfilesize b370e721bb53149b6c006efdb59423f1 SRR12161376.sra SRR12161376.sra file validated SRR12161376 is paired end SRR12161376 is conventional basespace SRR12161376 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59575 37.0 37.0 37.0 37.0 37.0 2 36.4075 37.0 37.0 37.0 37.0 37.0 3 36.6095 37.0 37.0 37.0 37.0 37.0 4 36.5775 37.0 37.0 37.0 37.0 37.0 5 36.626 37.0 37.0 37.0 37.0 37.0 6 36.5735 37.0 37.0 37.0 37.0 37.0 7 36.6285 37.0 37.0 37.0 37.0 37.0 8 36.5625 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.5595 37.0 37.0 37.0 37.0 37.0 15-19 36.540800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5373 37.0 37.0 37.0 37.0 37.0 25-29 36.459900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4563 37.0 37.0 37.0 37.0 37.0 35-39 36.436699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.451800000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4437 37.0 37.0 37.0 37.0 37.0 50-54 36.3717 37.0 37.0 37.0 37.0 37.0 55-59 36.3818 37.0 37.0 37.0 37.0 37.0 60-64 36.37050000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3954 37.0 37.0 37.0 37.0 37.0 70-74 36.375699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.362700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3455 37.0 37.0 37.0 37.0 37.0 85-89 36.3087 37.0 37.0 37.0 37.0 37.0 90-94 36.266200000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.273 37.0 37.0 37.0 37.0 37.0 100-104 36.2422 37.0 37.0 37.0 37.0 37.0 105-109 36.1657 37.0 37.0 37.0 37.0 37.0 110-114 36.2125 37.0 37.0 37.0 37.0 37.0 115-119 36.200100000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.1409 37.0 37.0 37.0 37.0 37.0 125-129 36.1479 37.0 37.0 37.0 37.0 37.0 130-134 36.0993 37.0 37.0 37.0 37.0 37.0 135-139 36.015100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9918 37.0 37.0 37.0 37.0 37.0 145-149 36.006800000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.90275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 2.0 26 4.0 27 9.0 28 16.0 29 21.0 30 13.0 31 30.0 32 36.0 33 74.0 34 109.0 35 269.0 36 2984.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.66016504126031 11.527881970492624 5.676419104776194 42.13553388347086 2 18.975 12.275 36.25 32.5 3 16.525000000000002 16.7 26.150000000000002 40.625 4 20.775 24.875 23.425 30.925000000000004 5 22.55 31.374999999999996 23.825 22.25 6 20.825 34.625 23.425 21.125 7 15.7 27.425 40.675 16.2 8 17.224999999999998 25.75 32.6 24.425 9 17.525 23.125 34.875 24.474999999999998 10-14 19.375 29.665000000000003 27.54 23.419999999999998 15-19 19.68 28.410000000000004 27.63 24.279999999999998 20-24 19.98 27.88 28.194999999999997 23.945 25-29 19.805 28.315 27.279999999999998 24.6 30-34 20.235 28.485 27.29 23.990000000000002 35-39 19.384999999999998 28.215 27.54 24.86 40-44 20.57 28.005000000000003 27.32 24.104999999999997 45-49 20.11 28.249999999999996 27.76 23.880000000000003 50-54 20.0 27.825 27.255000000000003 24.92 55-59 19.905 28.645 27.51 23.94 60-64 20.04 27.925 27.52 24.515 65-69 20.085 28.08 27.83 24.005000000000003 70-74 19.935 28.26 27.834999999999997 23.97 75-79 20.285 28.035 27.51 24.169999999999998 80-84 20.255000000000003 28.544999999999998 26.99 24.21 85-89 20.424999999999997 28.675 27.155 23.745 90-94 20.560000000000002 27.625 27.495000000000005 24.32 95-99 20.75 27.49 27.900000000000002 23.86 100-104 20.65 27.68 27.595 24.075 105-109 20.57 28.205000000000002 27.384999999999998 23.84 110-114 20.89 28.15 27.644999999999996 23.315 115-119 20.375 27.994999999999997 27.77 23.86 120-124 20.544999999999998 28.93 26.325 24.2 125-129 20.990000000000002 27.73 27.915 23.365 130-134 20.845 27.685 27.639999999999997 23.830000000000002 135-139 20.61 29.054999999999996 26.484999999999996 23.849999999999998 140-144 21.445 28.02 26.855 23.68 145-149 20.549999999999997 28.205000000000002 27.450000000000003 23.794999999999998 150-151 20.9 28.125 26.650000000000002 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 1.5 26 2.0 27 4.0 28 6.0 29 13.0 30 18.0 31 17.0 32 21.5 33 34.5 34 51.0 35 63.0 36 81.5 37 106.5 38 116.0 39 132.0 40 173.5 41 200.5 42 222.5 43 248.5 44 250.0 45 272.5 46 288.0 47 263.5 48 241.0 49 220.5 50 198.0 51 170.0 52 138.0 53 109.0 54 88.5 55 66.0 56 47.5 57 36.0 58 24.5 59 19.5 60 15.5 61 12.5 62 8.5 63 4.5 64 2.0 65 1.0 66 1.5 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57671957671958 89.375 2 5.026455026455026 9.5 3 0.3968253968253968 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.5750000000000002 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.1624999999999996 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTGC 10 0.006830828 145.0 6 GTTCAGT 10 0.006830828 145.0 1 TCAGTGT 10 0.006830828 145.0 3 CCCAAGT 10 0.006830828 145.0 1 CCACATT 10 0.006830828 145.0 2 AAAAAAA 115 0.0025531333 10.086957 100-104 >>END_MODULE SRR12161376 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.263 37.0 37.0 37.0 37.0 37.0 2 36.021 37.0 37.0 37.0 37.0 37.0 3 36.033 37.0 37.0 37.0 37.0 37.0 4 36.1355 37.0 37.0 37.0 37.0 37.0 5 36.27 37.0 37.0 37.0 37.0 37.0 6 36.2375 37.0 37.0 37.0 37.0 37.0 7 36.1635 37.0 37.0 37.0 37.0 37.0 8 36.2905 37.0 37.0 37.0 37.0 37.0 9 36.2545 37.0 37.0 37.0 37.0 37.0 10-14 36.267399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2367 37.0 37.0 37.0 37.0 37.0 20-24 36.192400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.1727 37.0 37.0 37.0 37.0 37.0 30-34 36.1578 37.0 37.0 37.0 37.0 37.0 35-39 36.0955 37.0 37.0 37.0 37.0 37.0 40-44 36.1342 37.0 37.0 37.0 37.0 37.0 45-49 36.1108 37.0 37.0 37.0 37.0 37.0 50-54 36.153 37.0 37.0 37.0 37.0 37.0 55-59 36.0832 37.0 37.0 37.0 37.0 37.0 60-64 35.9714 37.0 37.0 37.0 37.0 37.0 65-69 36.0074 37.0 37.0 37.0 37.0 37.0 70-74 35.884 37.0 37.0 37.0 37.0 37.0 75-79 35.92790000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.925599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8825 37.0 37.0 37.0 37.0 37.0 90-94 35.852 37.0 37.0 37.0 37.0 37.0 95-99 35.8485 37.0 37.0 37.0 37.0 37.0 100-104 35.8208 37.0 37.0 37.0 37.0 37.0 105-109 35.8476 37.0 37.0 37.0 37.0 37.0 110-114 35.8073 37.0 37.0 37.0 37.0 37.0 115-119 35.7987 37.0 37.0 37.0 37.0 37.0 120-124 35.8103 37.0 37.0 37.0 37.0 37.0 125-129 35.699 37.0 37.0 37.0 37.0 37.0 130-134 35.560199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.628 37.0 37.0 37.0 37.0 37.0 140-144 35.5661 37.0 37.0 37.0 37.0 37.0 145-149 35.634100000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.088750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 2.0 23 2.0 24 3.0 25 4.0 26 15.0 27 13.0 28 13.0 29 26.0 30 31.0 31 40.0 32 48.0 33 81.0 34 189.0 35 546.0 36 2731.0 37 244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 25.25 9.825000000000001 26.825 2 26.5 28.749999999999996 29.099999999999998 15.65 3 20.05 28.875 32.775 18.3 4 23.625 34.525 23.575 18.275 5 24.75 37.15 22.075 16.025 6 20.599999999999998 40.075 22.1 17.224999999999998 7 20.4 23.125 38.875 17.599999999999998 8 21.025 25.224999999999998 27.200000000000003 26.55 9 21.8 24.825 29.925 23.45 10-14 23.400000000000002 29.7 26.0 20.9 15-19 22.825 28.549999999999997 27.500000000000004 21.125 20-24 22.8 28.810000000000002 27.13 21.26 25-29 23.294999999999998 28.425 27.455000000000002 20.825 30-34 23.26 28.23 27.575 20.935000000000002 35-39 22.314999999999998 27.665 28.435 21.584999999999997 40-44 22.52 28.035 27.994999999999997 21.45 45-49 22.795 27.98 27.950000000000003 21.275 50-54 22.965 28.485 27.395000000000003 21.154999999999998 55-59 23.285 27.26 27.48 21.975 60-64 23.05 27.889999999999997 28.225 20.835 65-69 23.11 28.060000000000002 27.389999999999997 21.44 70-74 23.145 27.615000000000002 27.675 21.565 75-79 23.185 27.735 27.785 21.295 80-84 23.24 28.134999999999998 27.455000000000002 21.17 85-89 23.055 28.035 27.224999999999998 21.685 90-94 23.155 28.28 27.865000000000002 20.7 95-99 23.26 27.58 27.485 21.675 100-104 23.395 27.689999999999998 27.685 21.23 105-109 23.974999999999998 27.284999999999997 27.794999999999998 20.945 110-114 23.995 27.715 27.58 20.71 115-119 24.02 27.839999999999996 27.42 20.72 120-124 23.77 27.91 27.245 21.075 125-129 23.765 27.27 28.02 20.945 130-134 24.205 27.74 27.48 20.575 135-139 24.02 27.575 27.825 20.580000000000002 140-144 24.355 27.925 26.86 20.86 145-149 24.755 27.74 27.145000000000003 20.36 150-151 24.887500000000003 27.6375 26.875 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.0 21 1.5 22 3.5 23 2.5 24 0.5 25 2.0 26 4.0 27 4.5 28 9.0 29 11.5 30 11.5 31 19.5 32 30.0 33 36.0 34 41.5 35 51.0 36 67.0 37 100.0 38 144.0 39 178.0 40 210.0 41 246.0 42 260.5 43 255.5 44 266.0 45 286.5 46 285.0 47 237.0 48 195.5 49 189.0 50 178.5 51 155.5 52 116.5 53 80.5 54 67.0 55 57.0 56 42.0 57 33.0 58 30.5 59 25.5 60 14.5 61 10.0 62 9.0 63 6.0 64 5.0 65 3.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4518184231484 88.94999999999999 2 5.017255110167242 9.45 3 0.4778338200159278 1.35 4 0.026546323334218212 0.1 5 0.0 0.0 6 0.026546323334218212 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.1125 0.0 0.0 0.025 0.0 90-91 0.1375 0.0 0.0 0.025 0.0 92-93 0.1875 0.0 0.0 0.025 0.0 94-95 0.21250000000000002 0.0 0.0 0.025 0.0 96-97 0.225 0.0 0.0 0.025 0.0 98-99 0.2625 0.0 0.0 0.025 0.0 100-101 0.275 0.0 0.0 0.025 0.0 102-103 0.3 0.0 0.0 0.025 0.0 104-105 0.3375 0.0 0.0 0.025 0.0 106-107 0.42500000000000004 0.0 0.0 0.025 0.0 108-109 0.575 0.0 0.0 0.025 0.0 110-111 0.6125 0.0 0.0 0.025 0.0 112-113 0.7125 0.0 0.0 0.025 0.0 114-115 0.8 0.0 0.0 0.025 0.0 116-117 0.8375 0.0 0.0 0.025 0.0 118-119 1.0125 0.0 0.0 0.025 0.0 120-121 1.15 0.0 0.0 0.025 0.0 122-123 1.2875 0.0 0.0 0.025 0.0 124-125 1.3625 0.0 0.0 0.025 0.0 126-127 1.45 0.0 0.0 0.025 0.0 128-129 1.6 0.0 0.0 0.025 0.0 130-131 1.725 0.0 0.0 0.025 0.0 132-133 1.9125 0.0 0.0 0.025 0.0 134-135 2.1624999999999996 0.0 0.0 0.025 0.0 136-137 2.55 0.0 0.0 0.025 0.0 138-139 2.8375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606180 spots for SRR12161376.sra Written 606180 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra Read 606163 spots for SRR12161376.sra Written 606163 spots for SRR12161376.sra SRR ids: ['SRR12161376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hghrugq2 SRR12161376.sra spots: 12123277 blocks: [[1, 606163], [606164, 1212326], [1212327, 1818489], [1818490, 2424652], [2424653, 3030815], [3030816, 3636978], [3636979, 4243141], [4243142, 4849304], [4849305, 5455467], [5455468, 6061630], [6061631, 6667793], [6667794, 7273956], [7273957, 7880119], [7880120, 8486282], [8486283, 9092445], [9092446, 9698608], [9698609, 10304771], [10304772, 10910934], [10910935, 11517097], [11517098, 12123277]] SRR12161376 file size 4098319 SRR12161376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161376 SRR12161376_1.fastq SRR12161376_2.fastq Input file: SRR12161376_1.fastq Paired file: SRR12161376_2.fastq trimmed: SRR12161376-trimmed-pair1.fastq, SRR12161376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:58:59 2025 >> started Thu Feb 13 16:59:13 2025 >> done (13.149s) 12123277 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 925 ( 0.01%) empty read pairs filtered out after trimming by size control 12122338 (99.99%) read pairs available; of these: 574214 ( 4.74%) trimmed read pairs available after processing 11548124 (95.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 4 0.00% 31 5 0.00% 32 3 0.00% 33 7 0.00% 34 8 0.00% 35 9 0.00% 36 11 0.00% 37 7 0.00% 38 7 0.00% 39 8 0.00% 40 11 0.00% 41 7 0.00% 42 9 0.00% 43 12 0.00% 44 12 0.00% 45 13 0.00% 46 17 0.00% 47 9 0.00% 48 8 0.00% 49 18 0.00% 50 16 0.00% 51 11 0.00% 52 22 0.00% 53 22 0.00% 54 23 0.00% 55 26 0.00% 56 22 0.00% 57 28 0.00% 58 22 0.00% 59 37 0.00% 60 27 0.00% 61 45 0.00% 62 46 0.00% 63 53 0.00% 64 60 0.00% 65 61 0.00% 66 58 0.00% 67 66 0.00% 68 76 0.00% 69 73 0.00% 70 88 0.00% 71 121 0.00% 72 132 0.00% 73 165 0.00% 74 171 0.00% 75 196 0.00% 76 219 0.00% 77 223 0.00% 78 279 0.00% 79 266 0.00% 80 329 0.00% 81 390 0.00% 82 458 0.00% 83 485 0.00% 84 532 0.00% 85 651 0.01% 86 746 0.01% 87 727 0.01% 88 794 0.01% 89 911 0.01% 90 1102 0.01% 91 1123 0.01% 92 1223 0.01% 93 1386 0.01% 94 1496 0.01% 95 1672 0.01% 96 1789 0.01% 97 1944 0.02% 98 2121 0.02% 99 2237 0.02% 100 2492 0.02% 101 2633 0.02% 102 2884 0.02% 103 3046 0.03% 104 3331 0.03% 105 3516 0.03% 106 3715 0.03% 107 4004 0.03% 108 4319 0.04% 109 4645 0.04% 110 4652 0.04% 111 5070 0.04% 112 5338 0.04% 113 5441 0.04% 114 5739 0.05% 115 6256 0.05% 116 6473 0.05% 117 6847 0.06% 118 7370 0.06% 119 7408 0.06% 120 7864 0.06% 121 8311 0.07% 122 8500 0.07% 123 8923 0.07% 124 9274 0.08% 125 9586 0.08% 126 10429 0.09% 127 10573 0.09% 128 10974 0.09% 129 11559 0.10% 130 11868 0.10% 131 12201 0.10% 132 12774 0.11% 133 13455 0.11% 134 13873 0.11% 135 14203 0.12% 136 14625 0.12% 137 15247 0.13% 138 15739 0.13% 139 16533 0.14% 140 16882 0.14% 141 17236 0.14% 142 18281 0.15% 143 18490 0.15% 144 19340 0.16% 145 19868 0.16% 146 20378 0.17% 147 20986 0.17% 148 21369 0.18% 149 21921 0.18% 150 22783 0.19% 151 11548124 95.26% 12122338 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.50 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=21.53 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=27 prefix-density=0.61 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=24 fanout-score=28.14 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=11.4 sequence=AAAGAAAAGAAAA SRR12161376 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:00:12 Started mapping on | Feb 13 17:00:20 Finished on | Feb 13 17:01:39 Mapping speed, Million of reads per hour | 552.41 Number of input reads | 12122338 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11444203 Uniquely mapped reads % | 94.41% Average mapped length | 298.91 Number of splices: Total | 11868538 Number of splices: Annotated (sjdb) | 11597310 Number of splices: GT/AG | 11637773 Number of splices: GC/AG | 189231 Number of splices: AT/AC | 7977 Number of splices: Non-canonical | 33557 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289026 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 75724 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 389109 389109 389109 N_multimapping 289026 289026 289026 N_noFeature 394979 11289770 432774 N_ambiguous 192247 875 75104 UnstrandedReadsAssigned:10856977 PositiveStrandReadsAssigned:153558 NegativeStrandReadsAssigned:10936325 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161376-trimmed-pair1.fastq SRR12161376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,122,338 reads, 10,896,073 reads pseudoaligned [quant] estimated average fragment length: 276.248 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR12161376.ke.tsv 34699 SRR12161376.se.tsv 87100 total ==> SRR12161376.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.75 398 16.9137 Potri.005G024800.1.v4.1 1035 759.752 235 22.908 Potri.004G059700.1.v4.1 961 685.858 70 7.55883 Potri.007G009000.2.v4.1 1416 1140.75 0 0 Potri.003G141000.2.v4.1 2943 2667.75 474.458 13.1717 Potri.016G087400.1.v4.1 270 69.6773 537.179 570.976 Potri.015G069301.1.v4.1 564 301.636 0 0 Potri.010G195200.1.v4.1 1773 1497.75 26 1.28565 Potri.012G127500.1.v4.1 977 701.798 159 16.7794 ==> SRR12161376.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 109 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR12161376 completed mapping pipeline successfully